SciELO - Scientific Electronic Library Online

vol.47 issue6Onychomycosis by Scytalidium dimidiatum: report of two cases in Santa Catarina, BrazilAbdominal angiostrongyliasis: a case with severe evolution author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Related links

Revista do Instituto de Medicina Tropical de São Paulo

On-line version ISSN 1678-9946

Rev. Inst. Med. trop. S. Paulo vol.47 no.6 São Paulo Nov./Dec. 2005 

Disseminated nocardiosis due to Nocardia farcinica: diagnosis by thyroid abscess culture

Nocardiose disseminada por Nocardia farcinica diagnosticada através do cultivo de abscesso da tireóide

Cecília Bittencourt SeveroI; Flávio de Mattos OliveiraI; Lenine CunhaII; Vlademir CantarelliIII; Luiz Carlos SeveroI

ILaboratório de Micologia, Hospital Santa Rita, Santa Casa Complexo-Hospitalar, Porto Alegre, RS, Brasil
IIServiço de Tomografia, Hospital Santa Rita, Santa Casa Complexo-Hospitalar, Porto Alegre, RS, Brasil
IIIBiologia Molecular, Weinmann Laboratório, Porto Alegre, RS, Brasil

Correspondence to

A previously healthy 75-year-old white male dentist presented with a 6-month history of low-back pain treated with chronic steroid therapy had a Nocardia farcinica infection diagnosed by aspirate of thyroid abscess and six blood cultures. Despite the treatment with parenteral combination of trimethoprim/sulfamethoxazole, the patient failed to respond and died after two days of therapy. Autopsy revealed disseminated nocardiosis, involving lungs with pleural purulent exudate in both sides, heart, thyroid, kidneys, brain, bones, and lumbosacral soft tissue with destruction of L2-L4.

Keywords: Nocardia; Nocardia farcinica; Thyroiditis; Disseminated nocardiosis; Bacteremia; Osteomyelitis; Psoas Abscess.

Paciente previamente hígido, homem de 75 anos, branco, dentista, apresentou história de seis meses de dor lombar, fez uso crônico de corticoterapia e teve diagnóstico de infecção por Nocardia farcinica através do aspirado de abscesso da tireóide e seis hemocultivos positivos. Apesar do tratamento com a combinação de sulfametoxazol/trimetoprim, o paciente não respondeu indo a óbito dois dias após. A necropsia revelou nocardiose disseminada, envolvendo ambos os pulmões, empiema bilateral, coração, tireóide, rins, cérebro, ossos, e tecidos moles lombossacrais, com destruição da L2-L4.

Nocardiosis is an uncommon but worldwide infectious disease, with reported cases increasing in number among patients with immunosuppression1,14. In human, nocardiosis is most frequently caused by Nocardia asteroides complex that includes two established species, N. nova and N. farcinica. N. farcinica has been reported to cause a variety of infections and affecting almost every organ, but very rarely the infection is diagnosed by blood culture12,15,17,19,21 and from spine lesion6. To our knowledge, only four cases of Nocardia thyroiditis have been published3,13,22 and this is the first reported case on N. farcinica as the pathogen responsible for thyroid abscess.

The purpose of our report was to show that a negative diagnosis of malignancy is the key to a presumptive diagnosis of more rare infectious condition. Because of the considerable morbidity and mortality of untreated disease, we advocate a high index of suspicion for nocardiosis and routine microbiology should attempt to identify it.

A previously healthy 75-year-old white male dentist, with cough productive of purulent sputum and low-grade fever associated with a recurrent chronic low-back pain that began six months prior to admission was referred to our hospital in June 2001 for complementary investigation. He had been treated with various regimens of corticosteroids, especially prednisone (20-30 mg/d). On physical examination his temperature was 38 ºC, heart rate was 100, respirations were 22/min, and blood pressure was 130/80 mm Hg. There were no antibodies to the human immunodeficiency virus (HIV). Radiological studies, including computed tomography (CT) and magnetic resonance imaging (MRI) scan, revealed changes in soft tissue of lumbosacral region with partial destruction of L2-L4 vertebras. With presumptive diagnosis of multiple myeloma or bone metastasis, four biopsies were performed on different occasions (three at vertebral bodies and one at scapula). No specific diagnosis was made. Based on clinical and radiological findings strongly suggestive of neoplasia the patient underwent radiotherapy for metastatic spine cancer and because of the deterioration of the physical conditions, persistent low-back pain, and elevation of intracranial pressure intravenous dexamethazone (4 mg every six hours) was instituted.

The patient was discharged from the hospital, with corticotherapy, but three days later he was readmitted to the hospital because of persistent fever and continued deterioration of clinical condition. On reexamination, a node was palpable at the thyroid right lobe and his chest showed signs of consolidation in both lower zones.

The contrast-unenhanced CT scan of the head showed two nodules that become hyperdense, located in the basal ganglia region. A MRI scan of the head showed the same two nodules.

A CT scan of the chest demonstrated multiple nodules and consolidation throughout both lungs, predominantly in the lower lobes (Fig. 1). Bilateral pleural effusions were also present.

The CT scan of thoracolumbar spine and pelvis showed iliac and sacral osteolytic lesions and partial destruction of several vertebral bodies in thoracic and lumbar spine. The osseous destruction was more extensive in L2-L4. T1-weighted MRI scan with gadolinium contrast demonstrated multiple lesions with hypointense (T1) and hyperintense periphery (T2) in thoracolumbar spine (Fig. 2). Abscesses formation in both psoas muscles was present.

A CT post contrast of the neck demonstrated hypodense lesion (66 UH) in the right thyroid lobe. This nodule was aspirated with a thick needle (Fig. 3) and four mL of a purulent liquid was obtained.

A gram-stained smear of the abscess fluid showed gram-positive filaments that were also stained positively by Ziehl-Neelsen stain (Fig. 4). Portion of the exudates was inoculated onto Sabouraud dextrose agar and blood agar. Nocardia-like organisms were noted after six days of incubation. Blood cultures were automatically checked for bacterial growth using BacT/ALERT® SA (Organon Tecnika) system, and the same Nocardia-like microorganisms was yielded from six different culture bottles. Sputum examination revealed a gram-positive, acid-fast branching organism consistent with Nocardia, but cultures were all negative.

DNA was obtained from a bacterial suspension using the guanidine-isothiocyanate modified method9, and the 16S rRNA gene (ca. 1500 bp) was amplified using primers 285 (5' - GAGAGTTTGATCCTGGCTCAG - 3') and 261 (5'- AAGGAGGTGATCCAGCCGCA - 3')10, and GeneAmpä PCR reagent kit (Applied Biosystems). PCR products were cleaned using shrimp alkaline phosphatase and Exonuclease I (USB). The firsts 500 bp nucleotides were determined using primers 352-F (5' - CAGACTCCTACGGGAGGC - 3') and 16S-R (5' - TATTACCGCRGCTGCTGG - 3') and big dye terminator DNA Sequencing kit (Applied Biosystems), as described elsewhere5. Homology search revealed 100% homology with several sequences of N. farcinica deposited in the GenBank. Moreover, we noted the presence of the sequence 5'-TTACATC-3' at the position 149 to 155 (compared to N. asteroides ATCC 19247), which is exactly the variable site for N. farcinica proposed by CONVILLE et al. 4.

Patient's evolution: Despite the prompt initiation of therapy with intravenous trimethoprim/sulfamethoxazole (TMP/SMX) 320/1600 mg every six hours, the patient rapidly developed respiratory distress and died on the second day of treatment.

At autopsy systemic nocardiosis was present. The histopathologic sections revealed multiple abscesses formation throughout the body organs including lungs with pleural purulent exudate in both sides, heart, thyroid, kidneys, brain, bones, and lumbosacral soft tissue with destruction of L2-L4. Special stain for acid-fast bacilli revealed numerous delicate, branched filaments within the purulent centers. Gram stain of tissue clearly demonstrate the same delicate gram-positive filaments. The searches for malignant cells in those organs were all negative.

In 1888, on the Guadeloupe Island, the veterinarian Edmond Nocard described N. farcinica by the first time, from a case of bovine farcy16. The increasing frequency of N. farcinica as a cause of severe human nocardiosis is because of AIDS and the resistance of this species of Nocardia to most antimicrobial agents2.

The most common sites of infection are lung, pleural, and chest wall (43%). The clinical presentation is protean and the findings on chest radiographs are non-specific. The infection often spreads to the brain (30%), kidney, bones, and deep-seated soft tissues; usually the host has underlying immunosuppressive conditions (85%), specially impair of cell-mediated immunity by medications or serious underlying conditions21. We speculate that the use of corticosteroids over the course of many weeks led to unusual location (blood, spine, and thyroid) and the serious clinical manifestation of infection. This and the delayed instituition of monotherapy with TMP/SMX7 both contributed to the death of this patient. We urge caution and restrition in the corticoids use.

N. farcinica infections in our patient bears both differences and similarities when compared with previously reported cases. First, no case of N. farcinica thyroiditis has been reported. The extreme rarity of suppurative thyroiditis is attributed to the anatomic isolation of the gland, its rich system of drainage, and the presumptive antibacterial effect of the high iodine concentration22. Second, only one other case of osteomyelitis has been reported6. Third, similarly to other reported case bacteremia was reported in a small number of cases as a preterminal finding12,15,17,19,21. Is important to emphasise that cultures of Nocardia typically take more than five days. Because of this, Nocardia is often overlooked since routine cultures are discarded at three days. Fourth, as in our patient only occasionally psoas abcsess is due to N. farcinica6,8,20.

It is important to realize that N. farcinica has emerged as a pathogen that has often a wrong initial clinical diagnosis, as in the present case, that had clinical and radiological features strongly suggestive of cancer. By this reason, nocardiosis should always be considered in the differential diagnosis when a pulmonary mass with metastatic focuses develops in an immunocompromised patient.

Finally, we wish to emphasize the critical importance of early diagnosis to achive good outcome. Only a high level of suspicion can make this with confirmation by biopsy. Microscopic study of stained smears of infected material could, in few minutes, direct one to appropriate therapy and culture gives the etiologic agent. Since phenotypic tests are too cumbersome or inaccurate to identify the species within the genera Nocardia11, molecular methods such as 16S rRNA sequencing represent an important advance for rapid bacterial identification18. In the case of Nocardia, the correct identification of species is also warranted by the natural resistance of these organisms to most antimicrobial agents7.

1. BEAMAN, B.L. & BEAMAN, L. - Nocardia species: host-parasite relationships. Clin. Microbiol. Rev., 7: 213-264, 1994.        [ Links ]

2. BOIRON, P.; PROVOST, F.; CHEVRIER, G. & DUPONT, B. - Review of nocardial infections in France 1987 to 1990. Europ. J. clin. Microbiol. infect. Dis., 11: 709-714, 1992.        [ Links ]

3. CARRIERE, C.; MARCHANDIN, H.; ANDRIEU, J.M.; VANDOME, A. & PEREZ, C. - Nocardia thyroiditis: unusual location of infection. J. clin. Microbiol., 37: 2323-2325, 1999.        [ Links ]

4. CONVILLE, P.S.; FISCHER, S.H.; CARTWRIGHT, C.P. & WITEBSKY, F.G. - Identification of Nocardia species by restriction endonuclease analysis of an amplified portion of the 16S rRNA gene. J. clin. Microbiol., 38: 158-164, 2000.        [ Links ]

5. GERMER, J.J.; RYS, P.N.; THORVILSON, J.N. & PERSING, D.H. - Determination of hepatitis C virus genotype by direct sequence analysis of products generated with the Amplicor HCV test. J. clin. Microbiol., 37: 2625-2630, 1999.        [ Links ]

6. GRAAT, H.C.A.; VAN OOIJ, A.; DAY, G.A. & McPHEE, I.B. - Nocardia farcinica spinal osteomyelitis. Spine, 15: E253-E257, 2002.        [ Links ]

7. HITTI, W. & WOLFF, M. - Two cases of multidrug-resistant Nocardia farcinica infection in immunosuppressed patients and implications for empiric therapy. Europ. J. clin. Microbiol. infect. Dis., 24: 142-144, 2005.        [ Links ]

8. HOLM, P. - Seven cases of human nocardiosis caused by Nocardia farcinica. Sabouraudia, 13: 161-169, 1975.        [ Links ]

9. JOHNSON, G.; NELSON, S.; PETRIC, M. & TELLIER, R. - Comprehensive PCR-based assay for detection and species identification of human herpesviruses. J. clin. Microbiol., 38: 3274-3279, 2000.        [ Links ]

10. KIRSCHNER, P.; MEIER, A. & BÖTTGER, E. - Genotypic identification and detection of mycobacteria facing novel and uncultured pathogens. In: PERSING, D.H.; SMITH, T.F.; TENOVER, F.C. & WHITE, T.J., ed. Diagnostic molecular microbiology principles and applications. Washington, American Society for Microbiology, 1993.        [ Links ]

11. KISKA, D.L.; HICKS, K. & PETTIT, D.J. - Identification of medically relevant Nocardia species with an abbreviated battery of tests. J. clin. Microbiol., 40: 1346-1351, 2002.        [ Links ]

12. KONTOYIANNIS, D.P.; RUOFF, K. & HOOPER, D.C. - Nocardia bacteremia: report of 4 cases and review of the literature. Medicine (Baltimore), 77: 255-267, 1998.        [ Links ]

13. LEONG, K.P.; TEE, N.W.; YAP, W.M.; CHEE, T.S. & KOH, E.T. - Nocardiosis in patients with systemic lupus erythematous. The Singapore lupus study group. J. Rheum., 27: 1306-1312, 2000.        [ Links ]

14. McNEIL, M.M. & BROWN, J.M. - The medically important aerobic actinomycetes: epidemiology and microbiology. Clin. Microbiol. Rev., 7: 357-417, 1994.        [ Links ]

15. MINAMOTO, G.Y. & SORDILLO, E.M. - Disseminated nocardiosis in a patient with AIDS: diagnosis by blood and cerebrospinal fluid cultures. Clin. infect. Dis., 26: 242-243, 1998.        [ Links ]

16. NOCARD, E. - Note sur la maladie des boeufs de la Guadaloupe connue sous le nom de farcin. Ann. Inst. Pasteur (Paris), 2: 293-302, 1888.        [ Links ]

17. PETERS, B.R.; SAUBOLLE, M.A. & COSTANTINO, J.M. - Disseminated and cerebral infection due to Nocardia farcinica: diagnosis by blood culture and cure with antibiotics alone. Clin. infect. Dis., 23: 1165-1167, 1996.        [ Links ]

18. ROTH, A.; ANDREES, S.; KROPPENSTEDT, R.M.; HARMSEN, D. & MAUCH, H. - Phylogeny of the genus Nocardia based on reassessed 16S rRNA gene sequences reveals underspeciation and division of strains classified as Nocardia asteroides into three established species and two unnamed taxons. J. clin. Microbiol., 41: 851-856, 2003.        [ Links ]

19. SMILACK, J.D. - Images in clinical Medicine. Pulmonary and disseminated Nocardiosis. New Engl. J. Med., 341: 885, 1999.        [ Links ]

20. SMIT, L.H.M.; LEEMANS, R. & OVERBEEK, B.P. - Nocardia farcinica as the causative agent in a primary psoas abscess in a previously healthy cattle inspector. Clin. Microbiol. Infect., 9: 445-448, 2003.        [ Links ]

21. TORRES, O.H.; DOMINGO, P.; PERICAS, R. et al. - Infection caused by Nocardia farcinica: case report and review. Europ. J. clin. Microbiol. infect. Dis., 19: 205-212, 2000.        [ Links ]

22. VANDJME, A.; PAGEAUX, G.P.; BISMUTH, M. et al. - Nocardiosis revealed by thyroid abscess in a liver - kidney transplant recipient. Transplant. Int., 14: 202-204, 2001.        [ Links ]

Correspondence to:
Dr. Luiz Carlos Severo
Laboratório de Micologia
Hospital Santa Rita
Santa Casa Complexo Hospitalar Annes Dias 285
90020-090 Porto Alegre, RS, Brasil
Phone: + 55 51 32285208

Received: 27 April 2005
Accepted: 16 August 2005

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License