SciELO - Scientific Electronic Library Online

Home Pagealphabetic serial listing  

Services on Demand



  • text new page (beta)
  • English (pdf)
  • Article in xml format
  • How to cite this article
  • SciELO Analytics
  • Curriculum ScienTI
  • Automatic translation


Related links


Revista do Instituto de Medicina Tropical de São Paulo

On-line version ISSN 1678-9946

Rev. Inst. Med. trop. S. Paulo vol.55 no.5 São Paulo Sept./Oct. 2013 



Prevalência do herpes vírus tipo 2 e fatores de risco associados a sua infecção em mulheres do sul do Brasil

Thaís Duquia Moraes Caldeira

Carla Vitola Gonçalves

Gisele Rodrigues de Oliveira

Tânia Vieira da Fonseca

Regina Gonçalves

Clair Teixeira do Amaral

Vanusa Pousada da Hora

Ana Maria Barral de Martinez



The herpes simplex virus type 2 (HVS-2) is the most prevalent infection worldwide. It is a cofactor in the acquisition of human immunodeficiency virus (HIV) and the persistence of human papillomavirus (HPV). This study evaluated the prevalence of HSV-2, using the polymerase chain reaction (PCR), and associated factors in patients treated at the Federal University of Rio Grande (FURG) and Basic Health Units (BHU) in Rio Grande, Brazil. The observed prevalence of HSV-2 was 15.6%. Among the 302 women studied, 158 had received assistance in BHU and 144 were treated at FURG. The prevalence of HSV-2 in these groups was 10.8% and 20.8%, respectively, RR 1.9 and p = 0.012. Knowledge about the Pap smear, and the presence of lesions showed no association with HSV-2 infection. Multivariate analysis showed that the variable that most influenced the risk of HSV-2 infection was the presence of HIV infection, with a relative risk of 1.9 and p = 0.04. Discussion: Genital ulcers are an important entry point for HIV, and condom use is an important strategy to reduce transmission of HIV and HSV-2.

Key words: Human Herpesvirus 2; Polymerase Chain Reaction; Human Papillomavirus; HIV Infections



O vírus herpes simplex tipo 2 (HVS-2) é uma das infecções mais prevalentes em todo o mundo. Considera-se um co-factor na aquisição do vírus da imunodeficiência humana (HIV) e na persistência do papilomavirus humano (HPV). Este estudo tem como objetivo avaliar a prevalência de HSV-2 usando a reação em cadeia da polimerase (PCR) e fatores associados em pacientes atendidos na Universidade Federal do Rio Grande e em Unidades Básicas de Saúde (UBS) do Rio Grande, Brasil. A prevalência de HSV-2 encontrada neste estudo foi de 15,6%. Entre as 302 mulheres estudadas, 158 haviam recebido assistência na UBS e 144 foram atendidos na FURG. A prevalência de HSV-2 nestes grupos foi de 10,8 e 20,8%, respectivamente, com RR: 1,9 e p = 0,012. Conhecer o exame de Papanicolaou, e presença de lesão não teve associação com infecção HSV-2. A análise multivariada mostrou que a variável que influencia no risco de infecção HSV-2 foi o paciente ter HIV, com risco relativo 1,9 e p = 0,04. Discussão: As úlceras genitais são importante porta de entrada para o vírus HIV e o uso do preservativo é estratégia importante para reduzir a transmissão do HIV e do HSV-2.


Lesions caused by the herpes virus were first documented by Hippocrates (460-377 B.C.E.), who called them “herpes,” a word derived from reptiles, as a reference to the formation of skin vesicles. The herpes simplex virus (HSV) is a DNA virus that belongs to the family Herpesviridae. There are two types of HSV: HSV-1, associated with non-genital infections, and HSV-2, which causes lesions below the waist, especially in the genital area23. However, some studies suggest that the prevalence of HSV-1 in genital lesions has not only increased in recent years, but may even exceed that of HSV-223.

HSV-2 is one of the most prevalent infections in the world. It is estimated that, in the United States, 40-60 million people are infected, with an incidence of 1-2 million infections and 600,000-800,000 new cases per year29. The latest HSV-2 data published by the Centers for Disease Control and Prevention (CDC) at the National Sexually Transmitted Diseases Conference in 2010 in Atlanta indicated that the prevalence of HSV-2 is still high (16.2%), especially among black women, where rates may be as high as 48%. Global prevalence is higher in women compared to men, especially among young people8. GARNETT et al. (2004)14 concluded that there is a six times greater chance of herpes transmission from men to women compared with transmission from women to men. In developed countries, where the acquisition of HSV-1 in childhood has been reduced, HSV-2 seroprevalence has increased, suggesting a possible protective effect of HSV-1 against acquisition of HSV-229. In Brazil, 640,000 new cases of genital herpes are diagnosed annually20.

From 1960 to 1970, HSV-2 infection was considered a possible causative agent of cervical cancer1 11 12 24 27. The role of HSV-2 in the development of cervical cancer has been questioned, since HSV-2 DNA was not found in cervical cancer biopsies12. However, women with HSV-2 have a higher risk of developing cervical carcinoma, and therefore HSV-2 is considered as a cofactor in certain patients1 7 27. In vitro laboratory data and molecular evidence show a possible synergism between HPV and HSV-2 in cervical-cancer etiology1.

In addition, symptomatic or asymptomatic herpetic infections can facilitate the acquisition of human immunodeficiency virus (HIV)15. The presence of herpes lesions indicates a two-to-three-fold higher risk of HIV transmission3 14 16. Therefore, primary prevention of HSV-2 infection may be the best available strategy for reducing the risk of infection by HIV9.

Since herpes simplex virus type 2 (HSV-2) is one of the most prevalent infections in the world, and is a cofactor in HIV acquisition and in the persistence of human papillomavirus (HPV), this study assessed HSV-2 prevalence using the polymerase chain reaction (PCR) technique, as well as the factors associated with its infection.


This project was approved by the Ethics Committee in Health Area Research - CEPAS/FURG, no. 19/2010, CEPAS 67/2010; and by the Municipal Center of Health Permanent Education (NEPES), no. 013/2011.

Sample size was calculated using Epi-info 6.04® software. A 95% confidence level was used, with an estimated HSV-2 prevalence between 12 and 39% (mean 25%)19. A total of 288 women and a sample error of 5% were obtained. Samples of cervicovaginal secretions of the women included in the study were collected by the gynecologist during a gynecological examination, with the use of a VAGISPEC® brush, for further molecular analysis and Pap smear. Patients participating in the study sought by the average service complaints gynecological, obstetric or just to collect the pap smear samples. There was no patient in this group with complaints or symptoms of genital ulcer at the time of the examination.

For the molecular analysis, samples were stored in cryogenic tubes containing Tris-EDTA (TE) buffer (10 mM Tris-HCl pH 8.5; 1 mM EDTA) and sent to the Molecular Biology Laboratory of the School of Medicine (FAMED) at the Federal University of Rio Grande (FURG), until the extraction of viral DNA. A Pap smear was evaluated as a routine procedure at the Pathology Laboratory (FAMED, FURG) and the results were later compared to the molecular biology results for HSV-2 and HPV viruses.

DNA was extracted from the samples with the commercial kit GFX (GE Healthcare) ® GenomicBlood DNA Purification Kit, according to the protocol for blood cell extraction.

HSV-2 was detected by two PCR reactions in a nested configuration (nested-PCR), adapted to AURELIUS4 and SCHMUTZHARD26 protocols. First-round amplification of the gene encoding the HSV-2 viral capsid glycoprotein (gp) was performed using the primers HSV21F 5′ TCAGCCCATCCTCCTTCGGCAGTA 3′ and HSV21R 5′ GATCTGGTACTCGAATGTCTCCG 3′, generating a 184 bp fragment; and HSV22F 5′ AGACGTGCGGGTCGTACACG 3′ and HSV22R 5′ CGCGCGGTCCCAGATCGGCA 3′ primers, amplifying to 100 bp. Consecutive PCR reactions were performed using 6 µL of the extracted DNA and 4 µL of the first PCR product, respectively, 1 × PCR buffer, 2 mM MgCl2, 0.5 mMdNTP, 1 U of the recombinant enzyme Taq DNA polymerase (Invitrogen) and 0.5 µM of HSV21F, HSV21R, HSV22F, HSV22R, and H2O Milli-Q QSP primers. Both reactions were performed in a final volume of 50 µL. Reaction cycles were performed in a thermocycler (Biorad-MyCycler). Reaction conditions for the first and second rounds were the same, represented by an initial stage at 94°C for five min for DNA denaturation and 30 subsequent amplification cycles at 94 °C for 30 s for denaturation, 57 °C for 30 s for annealing, 72 °C for one min for primer extension, and a final stage at 72 °C for seven min. Based on electrophoresis, the molecules spin through the gel and the results obtained from the molecular techniques are shown. Amplicon was observed in 2.5% agarose gel for the second round in a UV transilluminator after staining in ethidium bromide (0.5 µg/mL) for 30 min. The image was photographed using Kodak EDAS software (Kodak 1D Image Analysis 3.5). Size was compared using the molecular weight marker Leidwing Biotec® Ladder 50 bp Puls. A positive and a negative cervical sample for HSV-2 were used as reaction controls, in addition to a blank reaction omitting any DNA (Fig. 1).

Fig. 1 Result of PCR reaction, performed by Thais D. M. Boiler Laboratory of Molecular Biology - FAMED / FURG - on 05.10.2011. Negative samples: 1, 2, 3, 5, 6, 7, 8, 10, 12, 14, 16. Positive samples: 4, 11, 15. Negative Control: 9. Positive Control: 13. Blank (no DNA): 18. Bookmark Leidwing Biotec®: 17. 

For HPV detection, nested PCR was performed. The first round was carried out with external primers: MY09/MY11: 5′ CGTCCMAARGGAWACTGATC3′ / 5′GCMCAGGGWCATAAYAATGG3′18, which amplifies a 450 bp fragment of the L1 viral capsid. The second round was held with the internal primers: GP5 / 6: 5′TTTGTTACTCTGGTAGATAC3 ‘and 5′GAAAAATAAACTGTAAATCA3 “28 amplifying a fragment of 150 bp, also of the L1. Both reactions were performed in a final volume of 50 µL, containing 2.5 U of Taq DNA polymerase, 25pmol/µL of each primer at a concentration of 1.5 mM MgCl, 200 µM of each dNTP and Milli-Q H2O QSP. For the first round, 3 µL of extracted DNA was used; and for the second round, a 5 µL aliquot of the product was used. The reaction conditions for the first round consisted of 40 repeated cycles of 94 °C for 30 s for denaturation, 45 °C for 30 s for annealing, 72 °C for 30 s for extension; and for the second round, 40 repeated cycles of 95 °C for one min, 55 °C for one min and 72 °C for one min for denaturation, annealing and extension, respectively. The amplicon was visualized on 1% and 2% agarose gel respectively in the first and second round transilluminator (UV), by a system photodocumentation EDAs Kodak ® after being plated with ethidium bromide solution (10 mg/mL). The size was compared with the molecular weight marker Leidwing Biotc ® Puls 50 bp ladder. As a positive control reaction, a positive sample was used (a fragment of the viral genome of 450 bp) and a negative control with omission of any DNA.

Statistical analyses were performed using SPSS software, predicting crude analysis, calculation of prevalence ratio, confidence intervals, and p value, considering that differences were statistically significant when p < 0.05 and using Fisher's exact test or chi-square. The main variables under analysis were: sociodemographic (skin color, age, education, income, marital status), gynecological (age at first sexual encounter, lifetime number of sexual partners, number of sexual partners in the past six months, contraceptive method, previous STD infection, number of pregnancies, number of deliveries, and knowledge of STDs) and clinical and laboratory data, such as Pap smear results. Data on plasma viral load and T CD4+ lymphocytes in HIV-positive patients were obtained by analysis of medical charts. Multivariate analysis was performed in the SPSS software using Poisson regression, followed by a hierarchic analysis model in which variables with p = 0.20 were integrated into the crude analysis. The first level included demographic and socioeconomic variables. The second level included variables that represented risk factors for HSV infection.


Of the 302 patients included in the study, 47 (15.6%) had an HSV-2 infection. Mean age was 32.7 years, standard deviation (SD) of 13.6, and mean family income of R$ 1,400, with 88.1% earning one minimum salary or more. Table 1 shows that the only demographic variable significantly associated with HSV-2 was education level; patients with less than four years of school had a higher prevalence of infection compared to patients with more than nine years of school (p = .232).

Table 1 Description of the sample and prevalence of herpes virus type 2, and physical and economic risk factors associated with the infection in women in southern Brazil 

Variables/Category n (%) HSV+ n (%) Prevalence ratio CI95% p
 ≤ 20 years 62 (21.2) 6 (9.4) 1.0 p=0.232b
 21-30 years 104 (34.4) 17 (16.3) 1.7 0.73 – 4.19
 31-40 years 57 (18.9) 13 (22.8) 2.4 0.99 – 5.98
 ≥ 41 years 77 (25.5) 11 (14.3) 1.5 0.60 – 3.89
Skin color
 White 202 (66.9) 31 (15.3) 1.0 p=0.503a
 Non-white 100 (33.1) 16 (16.0) 1.0 0.60 – 1.81
Marital status
 With partner 198 (65.6) 27 (13.6) 1.0 p= 0.135a
 Without partner 104 (34.4) 20 (19.2) 1.4 0.83 – 2.39
 9 years or more 55 (19.4) 6 (10.9) 1.0 p=0.032b
 5-8 years 68 (24) 5 (7.4) 0.7 0.22 – 2.09
 4 years or less 160 (56.5) 32 (20) 1.8 0.81 – 4.15
Income c
 2 or more minimum salaries 109 (41.9) 18 (16.5) 1.0 p=0.871b
 1-1.9 minimum salaries 120 (46.2) 20 (16.7) 1.0 0.56 – 1.81
 Under 1 minimum salary 31 (11.9) 4 (12.9) 0.8 0.29 – 2.14
 No 234 (77.5) 34 (14.5) 1.0 0.84 – 2.35 p=0.230a
 Yes 68 (22.5) 13 (19.1) 1.3

aFisher's exact test;

bChi-square test;

cMinimum salary at the time of the study: R$ 539.00.

As to the gynecological history, 71.5% of the patients had their first sexual encounter at a mean age of 17 years or less. The mean number of total sexual partners was five, and 86.7% reported having one partner over the past six months. The obstetric history showed that 62.9% had had two or more pregnancies, and 49.7% had two or more deliveries (Table 2).

Table 2 Description of the sample and prevalence of herpes virus type 2, and clinical and gynecological risk factors associated with the infection in women in southern Brazil 

Variables/Category n(%) HSV+ n (%) Prevalence ratio CI95% pa
Age at first sexual encounter
 ≥ 18 years 86 (28.5) 14 (16.3) 1.0 p=0.477a
 ≤ 17 years 216 (71.5) 33 (15.3) 0.9 0.53 – 1.66
Lifetime number of partners
 1 partner 85 (28.2) 11 (12.9) 1.0 p=0.595b
 2-4 partners 129 (42.9) 19 (14.7) 1.1 0.57 – 2.27
 5 partners or more 87 (28.9) 16 (18.4) 1.4 0.70 – 2.88
No. of partners over the past 6 months
 None 20 (6.6) 3 (15) 1.0 p=0.489b
 1 partner 261(86.7) 39 (14.9) 1.0 0.34 – 2.94
 2 partners or more 20 (6.6) 5 (25) 1.7 0.46 – 6.06
Number of pregnancies
 Nulligravida 38 (12.6) 8 (21.1) 1.0 p=0.348b
 Primigravida 74 (24.5) 9 (12.12) 0.6 0.24 – 1.38
 Secundigravida 71 (23.5) 8 (11.3) 0.5 0.22 – 1.31
 Multigravida 119 (39.4) 22 (18.5) 0.9 0.43 – 1.81
Number of deliveries
 Nulliparous 81 (26.8) 12 (14.8) 1.0 p=0.934b
 Primiparous 71 (23.5) 12 (16.9) 1.1 0.55 – 2.38
 Multiparous 150 (49.7) 22 (15.3) 1.0 0.54 – 1.97
Uses condom
 Yes 92 (30.5) 17 (18.5) 1.0 p=0.224a
 No 210 (69.5) 30 (14.3) 0.8 0.45 – 1.33
Contraceptive method
 Condom 59 (19.5) 11 (18.6) 1.0 p=0.818b
 Hormonal contraceptive 153 (50.7) 23 (15) 0.8 0.41 – 1.55
 None 48 (15.9) 8 (16.7) 0.9 0.39 – 2.04
 Other methods 42 (13.9) 5 (11.9) 0.6 0.24 – 1.70
Had STD before
 No 242 (80.1) 33 (13.6) 1.0 p=0.053a
 Yes 60 (19.9) 14 (23.3) 1.7 0.98 - 2.99
Knows about herpes
 Yes 167 (55.3) 30 (18.0) 1.0 p=0.131a
 No 135 (44.7) 17 (12.6) 0.7 0.40 – 1.22
Knows about STD (HSV, Chlamydia, HPV)
 Yes 200 (66.2) 33 (16.5) 1.0 p=0.326a
 No 102 (33.8) 14 (13.7) 0.8 0.47 - 1.48
Previous knowledge about Pap smear
 Yes 278 (92.1) 45 (16.2) 1.0 p=0.244a
 No 24 (7.9) 2 (8.3) 0.5 0.13 – 1.99
Had Pap smear before
 Yes 241 (79.8) 38 (15.8) 1.0 p=0.512a
 No 61 (20.2) 9 (14.8) 0.9 0.48 – 1.83
 Normal 276 (91.4) 41 (15.1) 1.0 p=0.279a
 Altered 12 (4) 3 (25) 1.7 0.60 – 4.60
Sample unit origin
 UBS 158 (52.3) 17 (10.8) 1.0 p=0.012a
 HU 144 (47.7) 30 (20.8) 1.9 1.12 – 3.36
Patient category
 Pregnant 96 (31.8) 10 (10.4) 1.0 p=0.011b
 HIV pregnant 24 (7.9) 8 (33.3) 6.4 3.34 – 12.28
 Gynecological 162 (53.6) 23 (14.2) 1.4 0.68 – 2.74
 HIV gynecological 20 (6.6) 6 (30) 2.9 1.18 – 7.01
 No 258 (85.4) 33 (12.8) 1.0 p=0.001b
 Yes 44 (14.6) 14 (31.8) 2.5 1.45 – 4.26
 Equal or lower than 249 15 (37.5) 5 (33.3) 1.0 0.42 – 2.60 p=0.599a
 Higher than 350 25 (62.5) 8 (32.0) 1.0
Viral load
 Undetectable VL 17 (42.5) 7 (41.2) 1.0 p=0.252a
 With VL 23 (57.5) 6 (26.1) 0.6 0.26 – 1.55
 No 247 (81.8) 39 (15.8) 1.0 p=0.502a
 Yes 55 (18.2) 8 (14.5) 0.9 0.46 – 1.86

aFisher's exact test;

bChi-square test.

Table 2 also shows that 18.6% of women reported using contraceptive methods. However, contraceptive use showed no statistically significant association with prevention of HSV-2 infection. STDs were reported by 23.3% of the patients, and this group was more likely to have an HSV-2 infection (p = .053).

For the Pap smear, 276 (91.4%) patients had normal results, 12 (4%) had a low to moderate degree of intraepithelial changes, and for 14 (4.6%) the results of the Pap smear could not be located. Knowledge of Pap smear and the presence of lesions in this examination were not correlated with a higher risk of HSV-2 infection (Table 2).

Of the 302 patients, 158 had been seen at Basic Health Units (BHU) and 144 at UH-FURG outpatient clinics. HSV-2 prevalence in these groups was 10.8% and 20.8%, respectively. There was a significant difference in HSV prevalence between recruiting locations, with confidence interval (95%CI): 1.12-3.36 and p = .012. There was a significant difference between HIV-positive and HIV-negative women. HIV-positive women were more likely to be infected by HSV-2 (p = .001). However, neither viral load nor the CD4 count of HIV-infected women was correlated with this infection by HSV-2 (Table 2).

Multivariate analysis showed that the only variable correlated with a risk of HSV-2 infection was the presence of HIV, with 95%CI: 1.42-6.33 and p = .04 (Table 3).

Table 3 Multivariate analysis of risk factors associated with HSV-2 infection in women in southern Brazil 

Variables/Category Prevalence ratio CI95% pa
 ≤ 20 years 1.0 p=0.188
 21-30 years 1.1 0.20 - 1.70
 31-40 years 1 0.43 - 2.35
 ≥ 41 years 1.5 0.65 - 3.42
 UBS 1.0 p=0.145
 HU 1.76 0.82 - 3.76
 No 1.0 p=0.041
 Yes 3.0 1.42 - 6.33


The prevalence of HSV-2 found in this study using the PCR technique was 15.6%. A literature review on data for the prevalence of HSV-2 using PCR in Brazil found no earlier publications. However, similar data can be found in the international literature, showing that the incidence of HSV-2 is still high. A study of women from Gambia, West Africa, found an HSV-2 infection rate of 15%2. Similar data were reported by the CDC at the National STD Conference in 2010, showing an HSV-2 prevalence of 16.2%, a rate that can reach up to 48% in black women. In a study of pregnant women conducted at Washington University, HSV-2 DNA was detected in 207 of the 716 women included, with a 28.9% rate and 25.7 to 32.3% standard deviation13. However, in a study performed in six cities in the USA on endocervical secretion, HSV-2 DNA was found in 7% of the samples3. Although this finding is lower than others reported in the literature, this study might have used a different population sampling or DNA extraction technique.

Among demographic variables, only education, with four or fewer years of school was associated with HSV-2 acquisition (p = .032), suggesting that patients with less education have little knowledge of the means of transmission and identification of lesions. Other studies showed that black and Hispanic women, lower education level, and low per capita family income are risk factors for HSV-2 infection9. Patient skin-color difference was not significant in our study.

Many risk factors have been described in HSV-2 acquisition. Among them are early sexual relations, previous history of STDs, and multiple sexual partners,8 9 20 29. In the present study, patients who reported having had any STDs were more likely to have HSV-2 infection (p = .053). In terms of STDs, there was a 31.8% HSV-2 DNA prevalence in HIV-positive women, whereas the rate found in the group of HIV-negative women was 12.8% (p = .001). A study using the molecular biology technique to detect HSV-2 in HIV-positive women showed a 37% prevalence rate of this infection in this group10. A study using a seroepidemiological survey of HSV-2 performed in Brazil on 100 HIV-positive patients showed a prevalence rate of 73% in this population17.

In addition to a higher HSV-2 prevalence found in HIV-positive women, there was also a high rate of HIV-positive pregnant women with herpetic infections (33.3%). According to BROWN et al. (2003)6, viral excretion is the strongest risk factor for HSV transmission from the mother to the newborn at birth. A study conducted by PATTERSON et al. (2011)22 showed that pregnant women co-infected with HSV-2/HIV are more likely to transmit HSV at birth than are HIV-negative pregnant women. This finding draws attention to a little-studied situation in Brazil, namely, the risk of vertical transmission of HSV-2 in asymptomatic HIV-positive pregnant women. Therefore, women infected by HSV-2 should be tested for HIV and adopt prevention strategies, such as using a condom.

Several studies have associated HSV-2 infection with a higher risk of developing cervical carcinoma, and HSV-2 infection has been considered a cofactor of this disease1 11 12 24 27. Molecular evidence shows a possible synergism between HPV and HSV-2 in the etiology of cervical cancer; HSV-2 infection could support the persistence of HPV infection, increasing the risk of cervical lesions caused by this virus1. The results of this study showed that 95.8% of the patients had a normal Pap smear and only 4.2% had a low- to high-degree intraepithelial lesion. HSV-2 prevalence was 15.1% in women with normal Pap smear and 25% in women with altered Pap smear. Although the herpetic infection rate was higher in the second group, it was not associated with a significant risk of acquiring this infection. In addition, when HSV-2 prevalence was assessed in relation to HPV, women with HPV had an HSV-2 rate of 14.5%, whereas in the HPV-negative group the rate was 15.8%. Therefore, this study found no association between HSV/HPV co-infection nor a higher risk of intraepithelial lesions in the HSV-2-positive group.

Another hypothesis investigated in this study was the possibility of a higher herpetic infection rate among women seen in a tertiary health center (UH-FURG) in relation to women seen in a primary center (BHU). HSV-2 prevalence among UH women was 20.8%, whereas it was 10.8% at BHUs. Therefore, women seen at the tertiary health center showed a higher risk of being HSV-2-positive (p = .012). This finding suggests that the population seen at the UH has behavioral, clinical and/or gynecological characteristics that differ from the population seen at the BHUs, showing that the former group requires more attention, follow-up and information regarding STDs.

In this study, we observed that HIV-positive patients had a higher prevalence of infection with HSV-2. Therefore, the herpes infection can be a gateway to HIV, and conversely, HIV can be a risk factor for acquisition of herpes14 16 17 22 25. Although no study patient had a genital ulcer present at the time of collection, they could have had these injuries at some point in their lives. STD presence increases the risk of HIV infection, especially when genital ulcers are present8 9 20 29. In addition, herpetic infection is more recurrent, more extensive, and has more serious symptoms in HIV-positive patients, and may also influence the clinical worsening of these patients. Thus, more attention should be given to herpetic infection in HIV-positive patients. It is extremely important to prevent such infections using awareness campaigns, such as education regarding use of a condom and risk behaviors for virus acquisition, and more attention from health professionals in patients with typical lesions or recurrent genital symptoms. An HSV-2 diagnosis should be requested, preventing future virus transmission and controlling both infections.


To the Obstetrics and Gynecological Service at the Teaching Hospital (UH-FURG) and to the Basic Health Units for permission to conduct this study.


1. Al-Daraji WI, Smith JH. Infection and cervical neoplasia: facts and fiction. Int J Clin Exp Pathol. 2009;2:48-64. [ Links ]

2. Aryee EAN, Bailey RL, Natividad-Sancho A, Kaye S, Holland MJ. Detection, quantification and genotyping of Herpes Simplex Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey. Virol J. 2005;2:61. [ Links ]

3. Aumakhan B, Hardick A, Quinn TC, Laeyendencker O, Gange SJ, Beyrer C, et al. Genital herpes evaluation by quantitative TaqMan PCR: correlating single detection and quantity of HSV-2 DNA in cervicovaginal lavage fluids with cross-sectional and longitudinal clinical data. Virol J. 2010;7:328. [ Links ]

4. Aurelius E, Johansson B, Skoldenberg B, Staland A, Forsgren M. Rapid diagnosis of herpes simplex encephalitis by nested polymerase chain reaction assay of cerebrospinal fluid. Lancet. 1991;337:189-92. [ Links ]

5. Barnabas RV, Celum C. Infectious co-factors in HIV-1 transmission herpes simplex virus type-2 and HIV-1: new insights and interventions. Curr HIV Res. 2012;10:228-37. [ Links ]

6. Brown ZA, Wald A, Morrow A, Selke S, Zeh J, Corey L. Effect of serologic status and cesarean delivery on transmission rates of herpes simplex virus from mother to infant. JAMA. 2003;289:203-9. [ Links ]

7. Celum C, Wald A, Hughes J, Sanchez J, Reid S, Delany-Moretlwe S, et al. Effect of aciclovir on HIV-1 acquisition in herpes simplex virus type 2 seropositive women and men who have sex with men: a randomized, double blind, placebo-controlled trial. Lancet. 2008;371(9630):2109-19. [ Links ]

8. Centers for Disease Control and Prevention (CDC). Analysis of National Herpes Prevalence. 22 April 2010. [Cited 2012 May 26]. Available from: <> [ Links ]

9. Centers for Disease Control and Prevention (CDC). Seroprevalence of herpes simplex virus type 2 among persons aged 14-49 years - United States, 2005-2008. MMWR Morb Mortal Wkly Rep. 2010;59(15):456-9. [ Links ]

10. Clemens SA, Farhat CK. Soroprevalência de anticorpos contra vírus herpes simples 1-2 no Brasil. Rev Saúde Pública. 2010;44:726-34. [ Links ]

11. Farivar TN, Johari P, Shafei S, Najafipour R. Lack of association between herpes simplex virus type 2 infection and cervical cancer--Taq Man realtime PCR assay findings. Asian Pac J Cancer Prev. 2012;13:339-42. [ Links ]

12. Galloway DA, McDougall JK. The oncogenic potential of herpes simplex viruses: evidence for a ‘hit-and-run’ mechanism. Nature. 1983;302:21-4. [ Links ]

13. Gardella C, Huang ML, Wald A, Margaret A, Selke S, Morrow R, et al. Rapid polymerase chain reaction assay to detect herpes simplex virus in the genital tract of women in labor. Obstet Gynecol. 2010;115:1209-16. [ Links ]

14. Garnett GP, Dubin G, Slaoui M, Darcis T. The potential epidemiological impact of a genital herpes vaccine for women. Sex Transm Infect. 2004;80:24-9. [ Links ]

15. Glasier A, Gülmezoglu M, Schmid GP, Moreno CG, Van Look PF. Sexual and reproductive health: a matter of life and death. Lancet. 2006;368(9547):1595-607. [ Links ]

16. Homans J, Christensen S, Stiller T, Wang CH, Mack W, Anastos K, et al. Permissive and protective factors associated with presence, level, and longitudinal pattern of cervicovaginal HIV shedding. J Acquir Immune Defic Synd. 2012;60:99-110. [ Links ]

17. Le Goff J, Weiss HA, Gresenguet G, Nzambi K, Frost E, Hayes RJ, et al. Cervicovaginal HIV-1 and herpes simplex virus type 2 shedding during genital ulcer disease episodes. Aids. 2007;21:1569-78. [ Links ]

18. Manos MM, Ting Y, Wright DK, Lewis AI, Broker TR, Wolinsky SM. The use of polymerase chain reaction amplification for the detection of genital human papillomaviruses. Cancer Cells. 1989;7:209-14. [ Links ]

19. Mertz GJ, Rosenthal SL, Stanberry LR. Is herpes simplex virus type 1 (HSV-1) now more common than HSV-2 in first episodes of genital herpes? Sex Transm Dis. 2003;30:801-2. [ Links ]

20. Ministério da Saúde. Brasil. Doenças infecciosas e parasitárias / Guia de bolso. 8a ed. Brasília-DF; 2010. 444 p. [ Links ]

21. Nagot N, Ouedraogo A, Konate I, Weiss HA, Foulongne V, Defer MC, et al. Roles of clinical and subclinical reactivated herpes simplex virus type 2 infection and human immunodeficiency virus type 1 (HIV-1)-induced immunosuppression on genital and plasma HIV-1 levels. J Infect Dis. 2008;198:241-9. [ Links ]

22. Patterson J, Hitti J, Selke S, Huang ML, Watts DH, Brown Z, et al. Genital HSV detection among HIV-1-Infected pregnant women in labor. Inf Dis Obstet Gynecol. 2011;2011:1-4. (Article ID 157680). [ Links ]

23. Pereira VS, Moizeis RN, Fernandes TA, Araújo JM, Meissner RV, Fernandes JV. Herpes simplex virus type 1 is the main cause of genital herpes in women of Natal, Brazil. Eur J Obstet Gynecol Reprod Biol. 2012;161:190-3. [ Links ]

24. Rawls WE, Tompkins WA, Figueroa ME, Melnick JL. Herpesvirus type 2: association with carcinoma of the cervix. Science. 1968;161(3847):1255-6. [ Links ]

25. Reinheimer C, Doerr HW. Prevalence of herpes simplex virus type 2 in different risk groups: thirty years after the onset of HIV. Intervirology. 2012;55:395-400. [ Links ]

26. Schmutzhard J, Merete Riedel H, Zweygberg Wirgart B, Grillne L. Detection of herpes simplex virus type 1, herpes simplex virus type 2 and varicella-zoster virus in skin lesions. Comparison of real-time PCR, nested PCR and virus isolation. J Clin Virol. 2004;29:120-6. [ Links ]

27. Smith JS, Herrero R, Bosetti C, Muñoz N, Bosch FX, Eluf-Neto J, et al. Herpes simplex virus-2 as a human papillomavirus cofactor in the etiology of invasive cervical cancer. J Natl Cancer Inst. 2002;94:1604-13. [ Links ]

28. Van Den Brule AJC, Snijders PJF, Gordijn RLJ, Bleker OP, Meijer CJLM, Walboomers JMM. General primer-mediated polymerase chain reaction permits the detection of sequenced and still unsequenced human papillomavirus genotypes in cervical scrapes and carcinomas. Int J Cancer. 1990;45:644-9. [ Links ]

29. WHO. World Health Organization 2010. Sexually transmitted diseases – herpes simplex type 2. [Cited 2012 May20]. Available from: <> [ Links ]

Received: June 11, 2012; Accepted: February 5, 2013

Correspondence to: Thaís Duquia Moraes Caldeira. Laboratório de Biologia Molecular, FAMED/FURG. R. Visconde de Paranaguá 102, 96200-190 Rio Grande, RS, Brazil. E-mail:

Creative Commons License This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License, which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.