SciELO - Scientific Electronic Library Online

 
vol.41 issue3First finding of Lutzomyia longipalpis (Lutz & Neiva, 1912) in the urban area of Uberlândia, MG, concomitant with the first reported autochthonous case of human visceral leishmaniasisPopulation dynamics of Aedes aegypti (L) in an urban area with high incidence of dengue author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Article

Indicators

Related links

Share


Revista da Sociedade Brasileira de Medicina Tropical

Print version ISSN 0037-8682

Rev. Soc. Bras. Med. Trop. vol.41 no.3 Uberaba May/June 2008

http://dx.doi.org/10.1590/S0037-86822008000300017 

COMUNICAÇÃO COMUNICATION

 

Ocorrência de cepas de Pseudomonas aeruginosa multirresistentes produtoras de metalo-β-lactamase blaSPM-1 em amostras clínicas

 

Occurrence of multiresistant strains of Pseudomonas aeruginosa producing metallo-β-lactamase blaSPM-1in clinical samples

 

 

Tiago GräfI; Daiane Bopp FuentefriaI; Gertrudes CorçãoII

IMicrobiologia Agrícola e do Ambiente, Universidade Federal do Rio Grande do Sul, Rio Grande, RS
IIDepartamento de Microbiologia, Universidade Federal do Rio Grande do Sul, Rio Grande, RS

Endereço para correspondência

 

 


RESUMO

Este estudo avaliou a ocorrência de genes para metalo β-lactamases em isolados clínicos de Pseudomonas aeruginosa do Hospital São Vicente de Paulo, RS. Os genes foram pesquisados por PCR e o perfil de susceptibilidade foi avaliado por disco-difusão. Foram analisadas 46 cepas, sendo que cinco apresentaram o gene blaSPM-1.

Palavras-chaves: Metalo β-lactamases. Pseudomonas aeruginosa. Multirresistência. Carbapenemases.


ABSTRACT

This study analyzed the occurrence of metallo-β-lactamase genes in clinical samples of Pseudomonas aeruginosa from the Hospital São Vicente de Paulo, RS. The genes were analysed by PCR and the susceptibility profiles were studied by diffusion-disk. Forty six strains were analyzed and five strains were positive for blaSPM-1 gene.

Key-words: Metallo β-lactamases. Pseudomonas aeruginosa. Multiresistance. Carbapenemases.


 

 

A Pseudomonas aeruginosa, um dos principais patógenos causadores de infecções hospitalares, pode apresentar mecanismos de resistência intrínsecos e adquiridos. A síntese de metalo-β-lactamases (MBLs) é o mecanismo de maior relevância na atualidade. Cepas produtoras de MBLs emergiram devido ao freqüente uso de carbapenêmicos, quando estes eram os únicos antibióticos eficazes contra outras β-lactamases7. As metalo-β-lactamases são capazes de hidrolisar quase todos agentes β-lactâmicos, com exceção dos monobactâmicos, como aztreonam2 11. O primeiro relato de cepas de Pseudomonas aeruginosa produtoras de MBLs ocorreu no Japão em 1991, desde então Europa, Ásia e América passaram também a registrar tais ocorrências5. No Brasil, o gene prevalente é o blaSPM-1, isolado originalmente em São Paulo6. O objetivo deste estudo foi verificar presença de genes de MBLs em isolados clínicos de Pseudomonas aeruginosa do Hospital São Vicente de Paulo, Passo Fundo, RS, Brasil.

Os isolados clínicos de Pseudomonas aeruginosa foram obtidos no HSVP no período de janeiro a abril de 2007. Os isolados foram identificados por provas bioquímicas clássicas pelo Laboratório de Análises Clínicas do HSVP. A identificação foi confirmada pela amplificação do 16S rDNA10. A susceptibilidade dos isolados foi avaliada pela metodologia de disco-difusão, de acordo com o Clinical Laboratory Standards Institutitute3. A cepa de Pseudomonas aeruginosa ATCC 27853 foi utilizada como controle. Os isolados foram considerados multirresistentes quando apresentaram resistência a pelo menos quatro classes diferentes de antimicrobianos. A triagem fenotípica da produção de MBLs foi realizada pelo teste de aproximação de discos utilizando como substratos imipenem e ceftazidima e, como inibidores, o EDTA e o ácido 2-mercaptopropiônico (2MPA)1 9. Os isolados com triagem positiva para produção de metalo-β-lactamases ou com susceptibilidade reduzida aos carbapenêmicos foram submetidos à reação da polimerase em cadeia (PCR) para pesquisa dos genes blaIMP, blaVIM, e blaSPM-1. Os oligonucleotídeos iniciadores utilizados foram: blaIMPF(5'AAAGATACTGAAAAGTTAGT3'), blaIMPR(5'TCYCCAAYTTCACTRTGACT3'), blaVIMF(5'GTGGCAACGTACGCATCACC3'), blaVIMR(5'ACGAAGTCTAGACCGCCC3'), blaSPM-1F(5'TCG GATCATGTCGACTTGCC3') e blaSPM-1R(5'CCTTCGCTTCAGATCCTCGT3').

Foram obtidas 46 cepas de Pseudomonas aeruginosa. Dentre estas, 17 (37%) apresentaram fenótipo de multirresistência. A triagem fenotípica para a produção de MBLs mostrou 37 cepas com resultados positivos, as quais foram submetidas à reação de PCR para pesquisa dos genes bla. Cinco cepas de Pseudomonas aeruginosa apresentaram o gene blaSPM-1. Essas cepas positivas representaram 35% e 36% das cepas multirresistentes e das cepas resistentes a carbapenêmicos, respectivamente. Todas as cepas com o gene blaSPM-1 mostraram fenótipo de multirresistência, sendo sensíveis apenas à polimixina B e ao aztreonam (Tabela 1). Dos cinco isolados de Pseudomonas aeruginosa com o gene blaSPM-1, quatro foram oriundos do Centro de Tratamento Intensivo (CTI), de amostras de escarro e urina.

 

 

O presente estudo demonstrou que 10,8% das cepas de Pseudomonas aeruginosa analisadas apresentaram o gene blaSPM-1. Esta relação é maior se considerarmos a presença de tal gene entre as cepas multirresistentes (35%) ou resistentes aos carbapenêmicos (36%). Mesmo assim pode-se concluir que a ocorrência dessas cepas no HSVP é menor que em outras instituições do estado e do país. Gaspareto cols4 estudaram Pseudomonas aeruginosa produtoras de MBLs em hospitais de Porto Alegre durante um período de dois anos e encontraram índices superiores a 70%, entre cepas resistentes a carbapenêmicos. O presente estudo foi realizado num período limitado de quatro meses que, em conjunto com o número de isolados analisados pode ter contribuído para estes resultados.

Sader cols8 analisaram isolados de Pseudomonas aeruginosa de pacientes com bacteremia do Complexo Hospitalar São Paulo (São Paulo, SP, Brasil), e encontraram 19,7% de cepas com os genes para MBLs, o que representou 43,9% dos isolados multirresistentes. Quanto à caracterização dos genes bla, demonstraram que 55,6% apresentaram o gene blaSPM, 30,6% o gene blaVIM e 8,3% o gene blaIMP. Gaspareto cols4 estudaram a ocorrência dos genes blaIMP, blaVIM, e blaSPM-1 em cepas de Pseudomonas aeruginosa resistentes aos carbapenêmicos em hospitais universitários na cidade de Porto Alegre, no Rio Grande do Sul, durante o período de 1998/1999 e 2003/2004. No Hospital São Lucas (HSL), 84,6% das cepas de Pseudomonas aeruginosa resistentes aos carbapenêmicos apresentaram genes para MBLs; no Complexo Hospitalar Santa Casa (CHSC), 72,7%; e no Hospital de Clínicas de Porto Alegre (HCPA), 100%. No Complexo Hospitalar Santa Casa, 67% de isolados com o gene blaSPM e 8,3% de isolados com o gene blaIMP. No Hospital São Lucas, identificaram 82% de isolados de Pseudomonas aeruginosa com o gene blaSPM e, no Hospital de Clínicas de Porto Alegre, os genes blaSPM e blaIMP foram encontrados em 35,7% e 21,4% dos isolados de Pseudomonas aeruginosa, respectivamente. Em nenhum dos hospitais estudados por Gaspareto cols4 foram encontradas cepas positivas para o gene blaVIM. No presente estudo, 10,8% (n=5) dos isolados foram positivos para o gene blaSPM-1. A tendência nacional de maior freqüência do gene blaSPM-1 foi observada também entre os isolados de Pseudomonas aeruginosa do Hospital São Vicente de Paulo.

Atualmente, é preocupante o aumento do número de isolados de Pseudomonas aeruginosa com genes bla em unidades de tratamento intensivo (CTIs)7. Os fatores de risco de infecções nosocomiais neste ambiente incluem a exposição a práticas altamente invasivas, como ventilação mecânica, cateteres urinários, cateteres intra-arteriais e intravenosos e, também o uso inadequado de antimicrobianos12. No presente estudo, dos cinco isolados de Pseudomonas aeruginosa portadores de genes blaSPM-1, três eram de amostras de urina e um de amostra de escarro de pacientes de CTI e um de amostra de escarro de paciente internados em postos de enfermaria (Tabela 1).

O presente estudo forneceu resultados sobre a presença de Pseudomonas aeruginosa multirresistentes e com o gene blaSPM-1 em amostras clínicas do Hospital São Vicente de Paulo, Passo Fundo, RS. Estudos desta natureza ainda não haviam sido realizados neste local e contribuem com dados epidemiológicos para esta região. Entretanto, análises mais aprofundadas deverão revelar a relação de clonalidade entre os isolados do presente estudo e outros isolados da região sul do Brasil.

 

AGRADECIMENTOS

Ao Laboratório de Análises Clínicas e à Comissão de Controle de Infecção Hospitalar do Hospital São Vicente de Paulo por fornecerem as cepas de Pseudomonas aeruginosa. À Dra Ana Cristina Gales (Laboratório Alerta e Laboratório Especial de Microbiologia Clínica, Divisão de Doenças Infecciosas, Universidade Federal de São Paulo) e ao Dr Mark A. Toleman (Department of Pathology and Microbiology, University of Bristol, UK) por cederem as cepas utilizadas como controles positivos neste estudo.

 

REFERÊNCIAS

1. Arakawa Y, Shibata N, Shibayama K, Kurokawa H, Yagi T, Fujiwara H, Goto M. Convenient Test for Screening Metallo-β-Lactamase-Producing Gram-Negative Bacteria by using Thiol Compounds. Journal of Clinical Microbiology 38: 40-43, 2000.         [ Links ]

2. Castanheira M, Toleman MA, Jones RN, Schmidt FJ, Walsh TR. Molecular characterization of a β-Lactamase Gene, blaGIM-1, Encoding a New Subclass of Metallo-β-lactamase. Antimicrobial Agents Chemotherapy 48: 4654-4661, 2004.         [ Links ]

3. Clinical and Laboratory Standards Institute. M100-S17. Performance standards for antimicrobial susceptibility testing; 16th informational supplement. Clinical and Laboratory Standards Institute, Wayne, PA, 2007.         [ Links ]

4. Gaspareto PB, Martins AF, Zavascki AP, Barth AL. Occurrence of blaSPM-1 and blaIMP-1 genes of metalo-β-lactamases in clinical isolates of Pseudomonas aeruginosa from three universitary hospitals in the city of Porto Alegre, Brazil. Brazilian Journal of Microbiology 38: 108-109, 2007.         [ Links ]

5. Lauretti L, Riccio ML, Mazzariol A, Cornaglia G, Amicosante G, Fontana R, Rossolini GM. Cloning and characterization of blaVIM, a new integron-borne metallo-β-lactamse gene from a Pseudomonas aeruginosa clinical isolate. Antimicrobial Agents and Chemotherapy 43: 1584-1590, 1999.         [ Links ]

6. Lee K, Lim YS, Young D, Yum JH, Chong Y. Evaluation of the Hodge Test and the Imipenem-EDTA Double-Disk Synergy Test for Differentiating Metallo-β-Lactamase-Producing Isolates of Pseudomonas spp. and Acinetobacter spp. Journal of Clinical Microbiology 41: 4623-4629, 2003.         [ Links ]

7. Loureiro MM, Moraes BA, Mendonça VLF, Quadra MRR, Pinheiro GS, Asensi MD. Pseudomonas aeruginosa: Study of antibiotic resistance and molecular typing in hospital infection cases in a neonatal intensive care unit from Rio de Janeiro city, Brazil. Memórias do Instituto Oswaldo Cruz 97: 387-394, 2002.         [ Links ]

8. Sader HS, Castanheira M, Mendes RE, Toleman M, Walsh TR, Jones RN. Dissemination ans diversity of metallo-β-lactamases in Latin America: report from the SENTRY antimicrobial surveillance program. International of Journal of Antimicrobiology Agents 25: 57-61, 2004.         [ Links ]

9. Sader HS, Reis AO, Silbert S, Gales AC. IMPs, VIMs and SPMs: the diversity of metallo-β-lactamases produced by carbapenem-resistant Pseudomonas aeruginosa in a Brazilian hospital. Clinical Microbiology and Infection 11: 73-76, 2004.         [ Links ]

10. Spilker T, Coenye T, Vandame P, Lipuma JJ. PCR-Based Assay for Differentiation of Pseudomonas aeruginosa from Other Pseudomonas Species Recovered from Cystic Fibrosis Patients. Journal of Clinical Microbiology 42: 2074-2079, 2004.         [ Links ]

11. Toleman MA, Simm AM, Murphy TA, Gales AC, Biedenbach DJ, Jones RN, Walsh TR. Molecular characterization of SPM-1, a novel metallo-beta-lactamase isolated in Latin America: report from the SENTRY antimicrobial surveillance programme. Journal of Antimicrobial Chemotherapy 37: 673-679, 1996.         [ Links ]

 

 

Endereço para correspondência:
Drª Gertrudes Corção
Deptº de Microbiologia/ICBS/UFRGS
Rua Sarmento Leite 500, Cidade Baixa
90050-170 Porto Alegre, RS
Telefax: 55 51 3308-4111
e-mail: corcao@ufrgs.br

Recebido para publicação em: 29/11/2007
Aceito em: 26/06/2008
Apoio financeiro: CAPES-PROF e BIC/PROPESQ - UFRGS