SciELO - Scientific Electronic Library Online

vol.43 issue2Genetic characterization of rabies virus isolated from bovines and equines between 2007 and 2008, in the States of São Paulo and Minas GeraisAnalysis on the food source of Panstrongylus megistus (Hemiptera, Reduviidae, Triatominae) and its present importance as a vector for Trypanosoma cruzi, in the State of Minas Gerais author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand




Related links


Revista da Sociedade Brasileira de Medicina Tropical

Print version ISSN 0037-8682

Rev. Soc. Bras. Med. Trop. vol.43 no.2 Uberaba Mar./Apr. 2010 



Extended-spectrum β-lactamase-producing Salmonella enterica serovar Oranienburg (CTX-M-2 group) in a pediatric hospital in Tucumán, Argentina


Salmonella enterica serovar Oranienburg produtora de β-lactamase de espectro extendido (grupo CTX-M-2) em um hospital pediátrico de Tucumán, Argentina



María Angela JureI; Olga AuletI; Ana TrejoII; Marta CastilloI

IInstituto de Microbiología "Dr. Luis C Verna". Facultat de Bioquímica, Química, Farmacia y Biotecnología. Universidad Nacional de Tucumán. San Miguel de Tucumán, Argentina
IILaboratorio de Bacteriología, Hospital del Niño Jesús. San Miguel de Tucumán, Argentina

Address to




INTRODUCTION: Salmonella sp infections have been reported over recent years in hospitals in Argentina and other countries due to multiresistant strains. The aim of this study was to characterize the extended-spectrum β-lactamases in third-generation cephalosporin-resistant strains of Salmonella enterica serovar Oranienburg.
METHODS: We studied 60 strains isolated from children with gastroenteritis and/or extraintestinal complications. The antibiotic susceptibility patterns of the isolates were analyzed and the
β-lactamases were characterized using phenotyping and genotyping methods.
RESULTS: All the strains were resistant to ampicillin, cefotaxime, cefepime and aztreonam and partially susceptible to ceftazidime, thus corresponding well with the resistance phenotype conferred by CTX-M-type
β-lactamases. An isoelectric point enzyme (pI = 7.9) was detected in all of the strains, and this was confirmed by PCR as a member of the CTX-M-2 group.
CONCLUSIONS: This is the first report of Salmonella enterica serovar Oranienburg producing
β-lactamases of the CTX-M-2 group in a pediatric hospital in Tucumán, Argentina.

Key-words: Salmonella enterica serovar Oranienburg. Extended Spectrum β-lactamases.


INTRODUÇÃO: Em recentes anos foram informadas infecções por Salmonella sp em hospitais da Argentina e outros países devido as cepas multiresistentes. O objetivo deste estudo era caracterizar as β-lactamasas de espectro extendido em cepas de Salmonella enterica serovar Oranienburg resistentes às cefalosporinas de terceira geração.
MÉTODOS: Nós estudamos 60 cepas obtidas de pacientes com gastroenterites e com complicações extraintestinais. Os padrões de susceptibilidade antibiotica foram estudados em os isolamentos, as
β-lactamasas foram caracterizadas por métodos fenotípicos e genotípicos.
RESULTADOS: Todas as cepas eram resistentes a ampicillin, cefotaxime, cefepime e aztreonam e parcialmente suscetível a ceftazidime que corresponde bem com o fenótipo de resistência conferido por as
β-lactamasas tipo CTX-M. Na totalidade das cepas, se detectou uma enzima de ponto isoelétrico (pI) 7,9, confirmada por PCR como pertencente ao grupo CTX-M2.
CONCLUSÕES: Este é o primeiro reporte de Salmonella enterica serovar Oranienburg produtora de
β-lactamasa grupo CTX-M2 em um hospital pediátrico de Tucuman, Argentina.

Palavras-chaves: Salmonella enterica serovariedade Oranienburg. β-lactamasas de espectro extendido.




Nosocomial non-typhoid Salmonella infections have been reported over recent years in many geographic areas, including countries with high public health standards. Although Salmonella sp are not typical members of hospital microflora, several outbreaks due to multiresistant isolates have been reported in hospitals from Argentina, as well as in other countries1,2. Although antibiotic therapy is not usually recommended for treating patients with Salmonella gastroenteritis, invasive complications such as meningitis, sepsis and bacteremia require it3.

From 1969 to 1985, the most prevalent Salmonella serovar in hospitals in different cities in Argentina was Salmonella serovar Typhimurium, followed by serovar Oranienburg. Salmonella enterica serovar Enteritidis emerged in 1986 and has been mainly involved in food-poisoning outbreaks4.

Salmonella strains resistant to extended-spectrum cephalosporins (ESCs) have been reported since the late 1980s and the number of strain types has been increasing ever since5. The major resistance mechanism identified involved an extended-spectrum β-lactamase (ESBL) that was able to hydrolyze monobactams and oxyimino cephalosporins (such as cefotaxime and ceftazidime) but not cephamycins6,7.

CTX-M β-lactamases (cefotaximases) are a relatively novel family of plasmid-mediated ESC and have been classified as Ambler class A. These enzymes generally possess higher levels of hydrolytic activity against cefotaxime than against ceftazidime, and are inhibited by clavulanic acid, sulbactam and tazobactam. They also provided resistance to cefepime. On the basis of their amino acid sequences, CTX-M enzymes have been classified into five mayor phylogenetic branches (groups 1, 2, 8, 9 and 25)7. This group of enzymes is one of the most frequently encountered ESBL types in Salmonella sp5.

Resistance to ESC was detected first in Salmonella serovar Typhimurium and later in Salmonella serovars Infantis and Agona4.

Only a few cases of major outbreaks associated with serovar Oranienburg have been reported over the last 35 years, but this serovar has been consistently observed in isolated cases of food poisoning. Thus, it is placed among the 15 most frequently reported Salmonella serovars from human sources, according to the Centers for Disease Control and Prevention, Atlanta, GA, USA (CDC)8.

The aims of this study were to serotype and biotype ESC-resistant Salmonella sp, investigate extended-spectrum β-lactamases in these strains and characterize these enzymes phenotypically and genotypically.



Between June 2005 and May 2006, we studied 60 Salmonella sp strains isolated from children hospitalized in five rooms at the Niño Jesús Hospital. Fifty isolates were of gastrointestinal origin and ten were extraintestinal (blood, puncture material and urine). The children's ages ranged from one to thirty-six months.


Serotyping of Salmonella sp isolates was carried out by means of slide agglutination with commercial antisera (Sanofi Pasteur Diagnostics, Paris, France), using the Kauffmann-White scheme9.

Antimicrobial susceptibility testing

Antibiotic susceptibility was tested on the population of Salmonella enterica serovar Oranienburg. The antibiotic susceptibility test was performed using the disk diffusion method (Kirby Bauer). The antibiotics tested were: ampicillin, cephalothin, cefotaxime, cefepime, ceftazidime, aztreonam, imipenem, ciprofloxacin, trimethoprim plus sulfamethoxazole, gentamicin, amikacin, chloramphenicol, amoxicillin plus clavulanic acid and piperacillin plus tazobactam. Interpretation of inhibition zones was performed in accordance with the Clinical Standards Institute criteria (CLSI), and quality control was performed using the Escherichia coli ATCC 25922, E. coli ATCC 35218 and Klebsiella pneumoniae ATCC 700603 reference strains. Screening for ESBL was performed in accordance with CLSI recommendations using the double-disk synergy test with amoxicillin-clavulanic acid versus cefotaxime and ceftazidime disks with distances of 15mm from edge to edge. Cefotaxime disks versus cefotaxime-clavulanic and ceftazidime disks versus ceftazidime-clavulanic were used to confirm ESBL production10.

Preparation of crude extracts of β-lactamase and isoelectric focusing

The isoelectric focusing procedure was performed as described previously11. Bacteria were harvested from a 20-h brain heart infusion broth culture by centrifugation, and the pellet was resuspended in 1ml of phosphate buffer (0.05M pH 7). The enzymes were released by means of two cycles of freezing (-70°C) and thawing (room temperature) and by sonication for 5min in a sonicator in ice-cold water. Isoelectric focusing was performed on an ampholine polyacrylamide gel (pH 3.0 to 10.0; Pharmacia, Uppsala, Sweden). β-lactamase activity was detected using preparations of the chromogen nitrocefin from the standard strain K. pneumoniae 1803 (clinically isolated), which is known to harbor Per-2, and CTX-M2 was used as a standard.

PCR amplification for blaCTX-M2 group

For amplification of complete structural genes highly related to the CTX-M2 enzyme (blaCTX-M2), the following primers (Gibco BRL) were used: blaCTX-M2: 5´CGGAATTCATGATGACTCAGAGCATTCG3´ (forward), 5´GCTCTAGATTATTGCATCAGAAACCGTG3´ (reverse). The reactions were performed in a Biometra DNA thermal cycler (trio-thermoblock) in 50ul mixtures containing 2.5U of Taq polymerase (Promega, Madison, WI, USA) and 1x buffer consisting of 10mM Tris-HCl (pH 8.3), 1.5mM MgCl2, 50mM KCl, 0.01μg of gelatin and each oligonucleotide at a concentration of 50 pmoles. Thirty-five cycles were performed for each reaction, with the following temperature profile for each cycle: 94°C for 1min, 55°C for 1min, and 72°C for 1min. The gels were then stained with ethidium bromide and photographed under UV light12, 13.




The 60 Salmonella sp isolates were serotyped as Salmonella enteritidis serovar Oranienburg.

Antimicrobial susceptibility testing

Antimicrobial susceptibility was determined for all 60 ESBL-producing strains. All the isolates displayed coresistance to gentamicin and netilmicin.

The β-lactam susceptibility phenotype was determined for all the Salmonella ESBL - producing strains. These strains were resistant to ampicillin, cephalothin, cefoxitin, cefotaxime, cefepime, aztreonam and cefpodoxime. They appeared to be partially susceptible to ceftazidime, and were susceptible to imipenem and cefoxitin. The activity of piperacillin was partially restored by means of inhibitors such as tazobactam. The synergy between cefotaxime and clavulanic acid confirmed that an ESBL was produced (Figure 1). The higher levels of resistance to cefotaxime versus ceftazidime corresponded well with the resistance phenotype conferred by the CTX-M-type ESBLs in Salmonella spp. The strains were susceptible to ciprofloxacin, amikacin, trimethoprim plus sulfamethoxazole and chloramphenicol.



Isoelectric focusing

This revealed that a β-lactamase with isoelectric point of 7.9 was produced in all isolates, which confirmed that one of the CTX-M family might be responsible for the phenotype observed (Figure 2).



PCR amplification for blaCTX-M2 group genes

A 896-bp amplicon was obtained when using primers directed against the blaCTX-M2 group genes in all Salmonella enterica serovar Oranienburg isolates (Figure 3).



The 60 Salmonella enterica serovar Oranienburg isolates were identical They presented a resistance phenotype conferred by the CTX-M-type ESBLs and a β-lactamase with isoelectric point of 7.9. All the isolates were positive for blaCTX-M2 group genes.



Salmonella enterica serovar Oranienburg is frequently isolated from children with gastroenteritis. This is the first time that extended-spectrum β-lactamases in strains isolated in our hospital have been characterized phenotypically and genotypically.

There have been scattered reports involving serovar Oranienburg from many parts of the world, including the Maldives14, Norway15 and the United States16.

The genus Salmonella is not commonly regarded as hospital flora and extended-spectrum-β-lactamase (ESBL) production with multiple antibiotic resistance is rarely associated with this organism. Constant antibiotic pressure can select multidrug resistance and ESBL-producing bacteria, thereby enabling their transmission among hospitalized patients17. In Argentina, CTX-M-2 emerged in August 1990 and appeared in a multiresistant strain of Salmonella typhimurium18. Several CTX-M-like enzymes from all over the world have been described. In 2004, Liebana et al reported CTX-M-15 that was characterized in 2002 from a pediatric patient infected with S. enterica serotype Infantis in Honduras19. The first cefotaximase-producing strain (CTX-M-3) was reported in a non-clinical S. enterica serovar Senftenberg in Japan in 200420. Also in 2004, a nosocomial outbreak of pediatric gastroenteritis in Korea was caused by CTX-M-14-type ESBL-producing strains of S. enterica serovar London21. Bonnet, in 2004 reported S. enterica serovar Typhimurium strains harboring distinct CTX-M-37. A large outbreak of Salmonella gastroenteritis that involved 4,000 children in Latvia in 1990 was associated with a S. typhimurium strain producing CTX-M-β-lactamases22. In Barcelona, Spain, CTX-M-9 was reported in S. enterica serovar Virchow23. In Ireland, CTX-M-15 and CTX-M-14 were reported24. Orman et al clearly showed that, in Argentina, the emergence of resistance to ESC in the genus Salmonella was due to acquisition of the blaCTX-M2 genes4. Our results demonstrated the presence of CTX-M-2 group enzymes in our Salmonella enterica serovar Oranienburg strains. This event could be related to the widespread use of cefotaxime and ceftriaxone rather than ceftazidime in our hospitals, among other factors.

Several serovars of ESBL-producing Salmonella spp were reported: in Argentina due to Salmonella enterica serovar Infantis25, in Poland due to Salmonella enterica serovar Oranienburg26, in Russia due to Salmonella enterica serovar Typhimurium27 and in Honduras due to Salmonella enterica serovar Infantis19.

The β-lactam susceptibility phenotype was determined for all the Salmonella enterica serovar Oranienburg ESBL-producing strains. These strains were resistant to ampicillin, cefotaxime, cefepime and aztreonam. They appeared to be partially susceptible to ceftazidime and were susceptible to imipenem and cefoxitin. These results corresponded well with the resistance phenotype conferred by the CTX-M type ESBLs in Salmonella sp. These strains were susceptible to ciprofloxacin, amikacin, trimethoprim plus sulfamethoxazole and chloramphenicol. All the isolates displayed coresistance to gentamicin and netilmicin. Similar data were found by Yong et al, in a pediatric hospital in Korea22 and by Orman et al, in Argentina between 1993 and 19984.

The isoelectric focusing made it possible to ascertain the pI of the proteins. Many ESBLs have the same pI, and therefore it is useful to compare it with the sensitivity phenotype, in order to gain knowledge about the ESBL type for subsequent analysis or molecular study. Our results demonstrated the presence of an enzyme with pI 7.9 coincident with Saka et al, in Cordoba, Argentina28.

The number of infected patients with ESBL-producing strains is increasing5. Asymptomatic carriers may be a source of dissemination of these microorganisms and are involved in their persistence and dissemination29.

This is the first report of Salmonella enterica serovar Oranienburg producing the CTX-M-2 group in a pediatric hospital in Tucumán, Argentina. From our study, we consider that the implied transmission route in the five affected rooms was probably horizontal.



The authors declare that there is no conflict of interest.



This work was supported by Consejo de Investigaciones de la Universidad Nacional de Tucumán (CIUNT).



1. Maiorini E, López EL, Morrow AL, Ramirez F, Procopio A, Furmanski S, et al. Multiply resistant nontyphoidal Salmonella gastroenteritis in children. Pediatr Infect Dis J 1993; 12:139-145.         [ Links ]

2. Cordano AM, Virgilio R. Evolution of drug resistance in Salmonella panama isolates in Chile. Antimicrob Agents Chemother 1996; 40:336-341.         [ Links ]

3. Merino L, Ruiz J, Alonso M, Vila J. Resistencia antimicrobiana y epidemiología molecular en cepas de Salmonella enterica serovar Enteritidis aisladas en las provincias de Chaco y Corrientes (Argentina). Comunicaciones científicas y tecnológicas. Universidad Nacional del Nordeste 2005; Resumen: M-020.         [ Links ]

4. Orman B, Piñeiro S, Arduino S, Galas M, Melano R, Caffer I, et al. Evolution of Multiresistance in Nontyphoid Salmonella Serovars from 1984 to 1998 in Argentina. Antimicrob Agents Chemother 2002; 46: 3963-3970.         [ Links ]

5. Bertrand S, Weill FX, Cloeckaert A, Vrints M, Mairiaux E, Praud K. Collard Clonal emergence of extended spectrum β-Lactamase (CTX-M-2) producing Salmonella enterica Serovar Virchow isolates with reduced susceptibilities to Ciprofloxacin among Poultry and humans in Belgium and France (2000 to 2003). J Clin Microbiol 2006; 44:2897-2903.         [ Links ]

6. Miriagou V, Filip R, Coman G, Tzouvelekis L. Expanded-Spectrum Cephalosporin-Resistant Salmonella Strains in Romania. J Clin Microbiol 2002; 40: 4334-4336.         [ Links ]

7. Bonnet R. Growing group of extended-spectrum β-lactamases the CTX-M enzymes. Antimicrob Agents Chemother 2004; 48: 1-14.         [ Links ]

8. Olsen SJ, Bishop FW, Brenner TH, Roels T, Bean R, Tauxe V, et al. The changing epidemiology of Salmonella trends in serotypes isolated from humans in the United States, 1987-1997. J Infect Dis 2001; 183: 753-761.         [ Links ]

9. Kauffman F. Serologic diagnosis of Salmonella species. Munksgaard, Copenhagen, Denmark, 1972        [ Links ]

10. Clinical and Laboratory Standards Institute/NCCLS. Performance standards for antimicrobial susceptibility tests. M100-S16, sixteenth informational supplement, CLSI, Wayne, PA; 2006.         [ Links ]

11. Matthew M, Harris AM. Identification of β-lactamases by analytical isoelectric focusing: correlation with bacterial taxonomy. J Gen Appl Microbiol 1976; 94: 55-67.         [ Links ]

12. Bauernfeind A, Stempliger I, Jungwirth R, Ernst S, Casellas JM. Sequences of β-lactamase genes encoding CTX-M-1 (MEN-1) and CTX-M-2 and relationship of their amino acid sequences with those of other β-lactamases. Antimicrob Agents Chemother 1996; 40:509-513.         [ Links ]

13. Petroni A, Corso A, Melano R, Cacace ML, Bru AM, Rossi A, et al. Plasmidic Extended-Spectrum β-lactamases in Vibrio cholerae O1 El Tor Isolates in Argentina. Antimicrob Agents Chemother 2002; 46:1462-1468.         [ Links ]

14. Aggarwal R, Chowdhuri R. Simultaneous isolation of Salmonella Stanley and Salmonella Oranienburg from an outbreak of food poisoning at Maldives island. Indian J Med Res 1983; 77: 602-604.         [ Links ]

15. Gustavsen S, Breen O. Investigation of an outbreak of Salmonella Oranienburg infection in Norway, caused by contaminated black pepper. Am J Epidemiol 1984; 119: 806-812.         [ Links ]

16. Helderg CW, Korlath JA, Aoust KE, White WL, Schell MR, Osterholm MT. A multistate outbreak of Salmonella Javiana and Salmonella Oranienburg infections due to consuption of contaminated cheese J Am Med Assoc 1992; 268: 3203-3207.         [ Links ]

17. Rossi A, Tokumoto M, Couto A, Di Bella A, Alstchuler M, Gómez N, et al. Survey of the levels of antimicrobial resistance in Argentina WHONET program 1991-1994. Int J Antimicrob Agents 1985; 6: 103-110.         [ Links ]

18. Rasmussen JW, Hoiby N. Cefotaximases (CTX-M-ases) an expanding family of extended-spectrum β-lactamases. Can J Microbiol 2004; 50: 137-165.         [ Links ]

19. Liébana E, Batchelor M, Torres C, Briñas L, Lagos L, Abdalhamid B, et al. Pediatric Infection due to Multiresistant Salmonella enterica Serotype Infantis in Honduras. J Clin Microbiol 2004; 42: 4885-4888.         [ Links ]

20. Ahmed AM, Nakano H, Shimamoto T. The first characterization of extended-spectrum β-lactamase producing Salmonella in Japan. J Antimicrob Chemother 2004; 57:283-284.         [ Links ]

21. Yong D, Lim YS, Yum JH, Lee H, Lee K, Kim C, et al. Nosocomial Outbreak of Pediatric Gastroenteritis Caused by CTX-M-14-Type Extended-Spectrum β-Lactamase-Producing Strains of Salmonella enterica Serovar London. Pediatr Infect Dis J 2005; 43:3519-3521.         [ Links ]

22. Tzouvelekis LS, Tzelepi E, Tassios PT, Legakis NJ. CTX-M-Type β-lactamases: an emerging group of extended-spectrum enzymes. Int J Antimicrob Agents 2000; 14:137-142.         [ Links ]

23. Simarro E, Navarro F, Ruiz J, Miró E, Gómez J, Mirelis B. Salmonella enterica serovar Virchow with CTX-M-like β-lactamase in Spain. J Clin Microbiol 2000; 38: 4676-4678.         [ Links ]

24. Morris D, Whelan M, Corbett-Feeney G, Cormican M, Hawkey P, Li X D. First report of extended-spectrum β-lactamase-producing Salmonella enterica isolates in Ireland. Antimicrob Agents Chemother 2006; 50:1608-1609.         [ Links ]

25. Di Conza J, Ayala P, Power M, Mollerach M, Gutkind G. Novel Class 1 integron (InS21) carrying bla CTX-M2 in Salmonella enterica serovar Infantis. Antimicrob Agents Chemother 2000; 46:2257-2261.         [ Links ]

26. Gierczynski R, Szych J, Cieslik A, Rastawicki W, Jagielski M. The occurrence of the first two CTX-M-3 and TEM-1 producing isolates of Salmonella enterica serovar Oranienburg in Poland. Int J Antimicrob Agents 2003; 21: 497-499.         [ Links ]

27. Edelstein M, Pimkin M, Dmitrachenko T, Semenov V, Kozlova N, Gladin D, et al. Multiple outbreaks of nosocomial salmonellosis in Russia and Belarus caused by a single clone of Salmonella enterica serovar Typhimurium producing an extended-spectrum β-lactamase. Antimicrob Agents Chemother 2004; 48: 2808-2815.         [ Links ]

28. Saka HA, Egea M, Culasso C, Rollan R, Avaro A, Carvajal L. β-lactamasas de espectro extendido en Klebsiella pneumoniae aisladas en el Hospital de Niños de Córdoba, Argentina. Rev Argent Microbiol 2003; 35:1-7.         [ Links ]

29. Wadula J, Von Gottberg A, Kilner D, Cohen C, Khoosal M, Keddy K, et al. Nosocomial Outbreak of Extended-Spectrum β-lactamase- Producing Salmonella Isangi in Pediatric Wards. Pediatr Infect Dis J 2006; 25:843-844.         [ Links ]



Address to:
Dr. Marta Cecilia de Castillo
Av. Juan B. Justo 1192, San Miguel de Tucumán
Tucumán, 4000, Argentina
Phone: 54 0381 424-7752 int 7013/0381 421-7450

Received in 22/09/2009
Accepted in 05/03/2010

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License