SciELO - Scientific Electronic Library Online

 
vol.43 issue3Ecology of Anopheles (Nyssorhynchus) darlingi Root in the installation area of a hydroelectric scheme on the border between the States of Mato Grosso do Sul and São PauloNRAMP1 gene polymorphisms in individuals with leprosy reactions attended at two reference centers in Recife, northeastern Brazil author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Article

Indicators

Related links

Share


Revista da Sociedade Brasileira de Medicina Tropical

Print version ISSN 0037-8682

Rev. Soc. Bras. Med. Trop. vol.43 no.3 Uberaba May/June 2010

http://dx.doi.org/10.1590/S0037-86822010000300013 

ARTIGO ARTICLE

 

Avaliação molecular de norovírus em pacientes com gastroenterite aguda

 

Molecular evaluation of norovírus in patients with acute gastroenteritis

 

 

Sofia Georgiadis; Diogo André Pilger; Fabiana Pereira; Vlademir Vicente Cantarelli

Setor de Biologia Molecular, Laboratório Weinmann, Porto Alegre, RS

Endereço para correspondência

 

 


RESUMO

INTRODUÇÃO: O norovírus foi recentemente identificado como o principal causador de surtos de gastroenterite aguda de origem não bacteriana em todo o mundo e está envolvido em episódios de origem alimentar. Neste estudo, foram avaliados pacientes com sintomas de gastroenterite aguda pelo período de um ano, a fim de se avaliar duas metodologias na identificação do NoV - a reação em cadeia por polimerase convencional e em tempo real -, incidência, sazonalidade e genótipo predominante.
MÉTODOS: Após a extração do RNA, 50 amostras foram analisadas pela metodologia de PCR convencional e 365 amostras foram analisadas pela metodologia de PCR em tempo real. Todas as amostras que apresentaram resultado positivo pelas duas metodologias ou discordante foram sequenciadas, ao todo, 13 amostras foram sequenciadas.
RESULTADOS: Das 50 amostras testadas pelas duas metodologias, 7 apresentaram resultado positivo pelo método convencional e 15 pelo método da PCR em tempo real. Do total de 365 amostras testadas pela metodologia de PCR, em tempo real, 48 foram positivas. Em relação às amostras sequenciadas, todas mostraram ser NoV do genogrupo II. Em relação à distribuição da incidência de amostras, positivas para NoV, ao longo do ano, pôde ser observada uma frequência de casos positivos maior na primavera, chegando a 29,7% em novembro.
CONCLUSÕES: Observamos que o PCR em tempo real é o método mais sensível para a identificação do Nov, que a incidência do NoV é de 13,2% e o genogrupo II prevalece na população avaliada, sendo a primavera o período de maior taxa de infecção.

Palavras-chaves: Norovírus. Gastroenterite aguda. Caliciviridae. Surtos alimentares.


ABSTRACT

INTRODUCTION: Norovírus was recently identified as the main cause of outbreaks of acute gastroenteritis of non-bacterial origin worldwide and it is involved in episodes of foodborne origin. In this study, patients with symptoms of acute gastroenteritis were evaluated over a one-year period, in order to evaluate two methods for identifying norovírus (real-time and conventional polymerase chain reaction), along with its incidence, seasonality and predominant genotype.
METHODS: After RNA extraction, 50 samples were analyzed using conventional PCR and 365 were analyzed using real-time PCR. All the samples that presented positive results using both methods or discordant results were sequenced. In all, 13 samples were sequenced.
RESULTS: Out of the 50 samples tested using both methods, seven presented a positive result from the conventional method and 15 from real-time PCR. Out of the total of 365 samples tested using real-time PCR, 48 were positive. All of the sequenced samples were shown to present norovírus of genogroup II. Regarding the distribution of norovírus-positive sample incidence over the course of the year, higher frequency of positive cases was observed during the southern hemisphere spring, reaching 29.7% in November.
CONCLUSIONS: We observed that real-time PCR was more sensitive for identifying norovírus. The incidence of norovírus was 13.2% and genogroup II predominated among the population evaluated, with the greatest infection rate in the southern hemisphere spring.

Key-words: Norovírus. Acute gastroenteritis. Caliciviridae. Foodborne illness outbreaks.


 

 

INTRODUÇÃO

O norovírus é o principal causador de surtos de gastroenterite aguda de origem não bacteriana em todo o mundo, sendo responsável por mais de 95% dos casos nos Estados Unidos e Europa1,2. Está geralmente envolvido em surtos de origem alimentar. Outras formas de transmissão são fecal-oral e aerossol. O NoV permanece estável no ambiente por longos períodos e a dose necessária para causar infecção é baixa, o que facilita o aparecimento dos episódios. A facilidade de transmissão do NoV e a falta do diagnóstico torna o controle dos surtos muito difícil3-5.

O NoV, membro da família Caliciviridae, é vírus RNA não-envelopado, de fita simples, polaridade positiva e que apresentam tamanho de 7,5 a 7,7kb. O genoma possui 3 regiões codificadoras: a primeira codifica uma grande poliproteína que, após a tradução, é clivada em proteínas não estruturais enquanto a segunda e a terceira codificam proteínas do capsídeo viral. Devido a diferenças nas sequências gênicas da RNA polimerase, e de proteínas do capsídeo, o NoV é dividido em cinco genogrupos. Os genogrupos I e II contêm a maioria das cepas que infectam os humanos, sendo o genogrupo II de maior incidência6-8.

O diagnóstico para NoV é baseado na detecção do vírus em amostras de fezes por microscopia eletrônica, métodos imunoenzimáticos ou reação em cadeia por polimerase (PCR). A microscopia eletrônica apresenta como vantagem a identificação de infecções mistas, mas é pouco sensível e poucos laboratórios dispõem dos equipamentos necessários. O teste ELISA é de execução simples e rápida, mas perde em sensibilidade para a reação em cadeia da polimerase. Dentre os citados, o PCR tem se mostrado o mais sensível e específico, além de ser de rápida execução7,9-11.

O presente estudo tem como objetivo estimar a incidência dos NoV em fezes de pacientes com sintomas de gastroenterite aguda pelo período de um ano, verificar a qual genogrupo pertencem e comparar as metodologias de PCR convencional e em tempo real para a detecção dos mesmos.

 

MÉTODOS

Amostras

Entre outubro de 2006 e outubro de 2007, foram avaliadas 365 amostras de fezes de pacientes com sintomas de gastroenterite aguda que haviam sido enviadas para o teste de rotavirus ao Laboratório Weinmann Ltda, localizado na Cidade de Porto Alegre, RS. As amostras foram armazenadas na forma de suspensão (0,1mL de fezes em 1mL de tampão fosfato pH 7,2), a temperaturas inferiores a -18°C, até serem testadas para NoV.

Extração

As suspensões foram descongeladas à temperatura ambiente, homogeneizadas e centrifugadas a 1.000g, por 3 minutos. O RNA viral foi extraído a partir do sobrenadante, utilizando-se o kit Illutra RNAspin Mini Isolation (General Eletric Healthcare®) ou o QIAamp UltraSens Virus Kit (QIAGEN®), segundo as instruções dos fabricantes. Após a extração, as amostras foram congeladas a temperaturas inferiores a -18°C.

PCR convencional (heminested)

Cinquenta amostras foram analisadas pela metodologia 1, composta por duas reações e baseada no trabalho de Yuen e cols5.

Reação 1: transcrição reversa e PCR 1

Nesta reação, foi utilizado o kit Superscript One-step RT-PCR System (Gibco®) e RNA ou controles positivo e negativo (10μL), num volume total de 40μL. Os primers utilizados foram NV4562 (5'GATGC(A/G/T)GATTACACAGC(A/C/T)TGGG3') (senso) e NV5366 (5'CATCATCATTTAC(A/G)AATTCGG3') (antissenso) para o grupo I e NV4611 (5'C(A/T)GCAGC(A/C)CT(A/G/T)GAAATCATGG3') (senso) e NV5296 (5'CCA(C/T)CTGAACATTG(A/G)CTCTTG3') (antissenso) para o grupo II, específicos para o gene da RNA polimerase.

Como controle positivo, foi utilizado RNA de uma amostra que apresentou resultado positivo para norovírus do grupo II pelas duas metodologias testadas, tendo sido também confirmada por reação de sequenciamento. Como controle negativo, utilizou-se água de injeção ultrapura (Aster®).

As condições de reação foram 50°C por 30 minutos; 94°C por 2 minutos e 35 ciclos de 94°C por 30 segundos, 50°C por 30 segundos e 72°C por 30 segundos; mais um passo adicional de 5 minutos a 72°C.

Os fragmentos produzidos pelos primers NV4562 e NV5366 apresentam tamanho de 805pb, enquanto que os produzidos pelos primers NV4611 e NV5296, 686pb.

Reação 2: PCR 2

Utilizou-se o kit Qiagen Taq DNA polymerase (Qiagen®) mais o produto da reação anterior (2μL), totalizando volume final de 40μL. Os primers utilizados foram NV 4562 e NV 5298 (5'ATCCAGCGGAACATGGCCTGCC3') (antisenso) para o grupo I e NV 4692 (5'GTGTG(A/G)T(G/T)GATGTGGGTGACTTC3') (senso) e NV5296 para o grupo II.

As condições de reação foram 94°C por 5 minutos seguidos de 25 ciclos de 94°C por 30 segundos, 50°C por 30 segundos e 72°C por 30 segundos. Uma etapa adicional de 5 minutos a 72°C foi programada. O termociclador utilizado nas duas reações foi o Peltier Thermal Cycler 200 (MJ Research®).

Os fragmentos resultantes da segunda reação apresentam tamanho de 737pb (genogrupo I) e 605pb (genogrupo II). A identificação e classificação do NoV foram realizadas através da visualização dos fragmentos de DNA de tamanho específico em gel de agarose 1,5%, após eletroforese (25 minutos, 200V).

PCR em tempo real

Trezentos e sessenta e cinco amostras foram analisadas pela metodologia 2, também composta por duas reações e baseada no trabalho de Beuret e cols12, com modificações.

Reação 1: transcrição reversa

Nesta reação, foram utilizados 0,5μL de primer randômico 15ng/μL (Invitrogen®), 0,5μL de dNTP 10μM (Invitrogen®), 100U da enzima Superscript III RT (Invitrogen®), 2,0μL de tampão concentrado da enzima, 0,5μL de DTT 0,1M, 10U de RNAse out (Invitrogen®), 5μL de RNA ou dos controles positivos e negativo e água tratada DEPC (Invitrogen®) em quantidade suficiente para o volume final de 10μL. Os controles positivo e negativo utilizados na segunda metodologia foram os mesmos que os utilizados na primeira.

As condições de reação foram 25°C por 10 minutos, 50°C por 60 minutos e 85°C por 5 minutos. Termociclador utilizado: Peltier Thermal Cycler 200 (MJ Research®).

Reação 2: PCR em tempo real

Os reagentes utilizados para a reação foram o Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen®), 10μL; BSA (albumina de soro bovino, Invitrogen®) 1mg/mL, 1μL; primers específicos para os genogrupos I e II 10mM (Invitrogen®), 1μL; cDNA ou controles, 2μL e água de injeção (Aster®), 6μL.

A amplificação do cDNA foi feita utilizando-se os primers BN11 (5'ATGTTCCGYTGGATGC3') (senso) e BN12 (5'CGTCCTTAGACGCCATCA3') (antisenso), específicos para o genogrupo I e os primers BN21 (5'TCAGGTGGATGAGGTTCTCAGA3') (senso) e BN22 (5'CGACGCCATCWTCATTCACA3') (antissenso), específicos para o genogrupo II, todos localizados na região da RNA polimerase. Todas as amostras foram testadas utilizando-se os dois pares de primers na mesma reação e as que apresentaram resultado positivo também foram testadas utilizando-se os dois pares de primers separadamente. As amostras positivas para NoV foram identificadas pela temperatura de melting característica, que foi de 82,7 + 2ºC. As condições de reação foram 50°C por 2 minutos, 95°C por 2 minutos, 38 ciclos de 96°C por 2 segundos, 60°C por 5 segundos e 72°C por 8 segundos, seguido de do melting a partir de 66°C. O equipamento utilizado foi Light Cycler 1.5 (Roche®).

Sequenciamento

Todas as amostras que apresentaram resultado positivo pelas duas metodologias ou discordante foram sequenciadas. Ao todo, 13 amostras foram sequenciadas.

O amplicon proveniente da PCR convencional foi primeiramente purificado utilizando-se o AccuPrep PCR Purification Kit (Bioneer®), segundo as instruções do fabricante.

Para a reação de sequenciamento, os reagentes e quantidades utilizadas foram: BigDye terminator Mix (Applied Biosystem®), 1μL; tampão do BigDye terminator Mix, 2μL; primer (Invitrogen®) 4pM, 1μL; água de injeção (Aster®), 4μL e do produto de PCR purificado, 2μL. O primer utilizado nesta ração foi o NV 5296, para as amostras provenientes da PCR convencional e o BN 21 para as amostras provenientes da PCR em tempo real. As condições da reação foram: 96°C por 10 segundos, 50°C por 5 segundos e 60°C por 4 minutos. Termociclador utilizado: Peltier Thermal Cycler 200 (MJ Research®).

Depois da reação de sequenciamento, as amostras foram novamente purificadas, utilizando-se isopropanol 75% e etanol 70%. Depois de secos em termobloco (95°C), os sequenciados foram resuspendidas em 6μL de uma mistura de formamida e Loading Buffer (Applied Biosystem®) (5:1), colocadas no termobloco a 97-100°C por 2 minutos e levadas imediatamente ao gelo, ficando prontas para serem aplicadas no gel de sequenciamento (poliacrilamida). O equipamento utilizado para o sequenciamento foi ABI Prism 377 PE (Biosystems®). As sequências obtidas foram analisadas utilizando-se o banco de dados do National Center of Biotechnology Information (www.ncbi.nlm.nih.gov).

 

RESULTADOS

Das 365 amostras, 50 foram testadas pelas metodologias de PCR convencional (heminested) e em tempo real. Destas, 7 apresentaram resultado positivo pelo método convencional e 15 pelo método da PCR em tempo real. Do total de 365 amostras, testadas pela metodologia de PCR, em tempo real, 48 (13,2%) foram positivas (Figura 1).

Em relação às amostras sequenciadas, todas mostraram ser NoV do genogrupo II (97 a 100% de homologia). A variação encontrada para a temperatura de melting dos genogrupos I e II foi de 82,7 + 2ºC.

Das 48 amostras positivas pelo PCR em tempo real, 7 não apresentaram resultado positivo quando testadas com os dois pares de primers separadamente. Ambas foram sequenciadas, comprovando ser positivas para norovírus do grupo II (Figura 2).

 

 

A distribuição da incidência de amostras positivas para NoV ao longo do ano deu-se conforme demonstrado na Figura 2, onde pôde ser observada uma frequência de casos positivos maior na primavera, chegando a 29,7% em novembro.

 

DISCUSSÃO

Das 365 amostras, 50 foram testadas pela metodologia de PCR convencional (heminested) e em tempo real. Destas, 7 apresentaram resultado positivo pelo método convencional e 15 pelo método da PCR, em tempo real, evidenciando a maior sensibilidade da segunda. O PCR em tempo real mostrou ser menos trabalhoso e mais rápido que a convencional, utiliza aproximadamente 3,5 horas para a análise, enquanto a PCR convencional requer aproximadamente 6 horas. Esta diferença no tempo necessário para a obtenção dos resultados permite que medidas sejam tomadas a tempo de se prevenir surtos nos casos positivos, além de possibilitar ao paciente um tratamento adequado em tempo clinicamente relevante. Além disso, a PCR em tempo real é menos suscetível à contaminação, pois utiliza sistema de reação fechado onde ocorre a amplificação e detecção simultânea da sequência alvo, enquanto na PCR convencional o material amplificado ainda é aplicado em gel, possibilitando contaminação das amostras.

Do total de 365 amostras testadas, pela metodologia de PCR, em tempo real, 48 (13,2%) foram positivas. Este resultado está de acordo com dados previamente publicados que relacionam a presença de NoV e casos de gastroenterite aguda, embora não se saiba ao certo qual a incidência dos casos, pois muitos não são reportados6.

Em relação às amostras sequenciadas, todas mostraram ser NoV do genogrupo II (97 a 100% de homologia), demonstrando a prevalência deste genogrupo na população estudada.

Como em nenhuma amostra foi detectado NoV do grupo I e nenhum controle positivo para este genogrupo conseguido para teste, plasmídeos contendo a sequência de DNA da região amplificada pelos primers específicos para este genogrupo utilizados na segunda metodologia foram testados, a fim de garantir-se o correto funcionamento dos primers. A temperatura de melting encontrada para o genogrupo I foi a mesma que a para o genogrupo II (82,7 + 2ºC). Portanto, o método não é capaz de diferenciar os genótipos. Um teste que utilize a primeira metodologia e um controle positivo para o genogrupo I ainda deve ser feito para que possamos garantir a validade desta metodologia para o genogrupo I.

A diferença na variação encontrada entre as temperaturas de melting determinada para os genogrupos I e II, neste estudo, 82,7 + 2ºC, e as determinadas por Beuret e cols12, 85,5 a 86,5°C para o genogrupo II e 81,7 a 83,7°C para o genogrupo I, pode ser explicada pelo fato de neste estudo ter sido utilizado o Platinum SYBR Green qPCR SuperMix-UDG®, que contém dUTP em vez do dTTP, o que ocasiona uma diminuição na temperatura de melting.

Das 48 amostras positivas pelo PCR, em tempo real, 7 não apresentaram resultado positivo quando testadas com os dois pares de primers separadamente. Ambas foram sequenciadas, comprovando ser positivas para norovírus do grupo II. A discordância entre estes resultados demonstra uma perda da sensibilidade da PCR em tempo real para testar-se o genogrupo II quando utilizamos os pares de primers separadamente. No trabalho de Beuret e cols, esta perda de sensibilidade também foi observada.

Estudos que avaliem a sensibilidade dos dois métodos são necessários.

A distribuição da incidência de amostras positivas para NoV, ao longo do ano, deu-se conforme demonstrado na Figura 2, onde pôde ser observada uma frequência de casos positivos maior na primavera, chegando a 29,7% em novembro, embora a maior incidência de casos positivos fosse esperada para os meses de inverno. Resultados como este já haviam sido publicados13. Também devemos considerar que a maioria dos estudos, avaliando a sazonalidade das infecções por NoV, até o momento, foi feita na Europa e EUA, onde o frio é mais rigoroso, o que exige o confinamento da população e propicia os surtos. No Brasil, o frio não é tão intenso, permitindo que as pessoas frequentem espaços mais arejados, diminuindo o número de casos no inverno. Entretanto, no Brasil, as condições de higiene precárias da população em geral ocasionam a ocorrência destes surtos ao longo de todo o ano.

Concluindo, Este estudo demonstra as vantagens da utilização da PCR em tempo real em relação a PCR convencional. A PCR em tempo real demonstrou ser mais rápida e sensível que a convencional, além de estar menos sujeita a contaminações. Estudos avaliando a sensibilidade dos dois métodos são necessários, além de um teste que garanta a detecção do NoV do grupo I, pela metodologia de PCR convencional.

Através deste estudo, também, se pôde observar a prevalência do genogrupo II na população analisada. A sazonalidade das infecções causadas por NoV, verificada com a maior incidência na primavera, não está de acordo com o esperado, apesar deste fato já ter sido observado em outros estudos.

 

CONFLITO DE INTERESSE

Os autores declaram não haver nenhum tipo de conflito de interesse no desenvolvimento do estudo.

 

SUPORTE FINANCEIRO

Laboratório Weinmann.

 

REFERÊNCIAS

1. Asanaka M, Atmar RL, Ruvolo V, Crawford SE, Neill FH, Estes MK. Replication and packing of Norwalk vírus RNA in cultured mammalian cells. Proce Nat Acad Sciences 2005; 102:10327-10332.         [ Links ]

2. Guerrant RL, Hughes JM, Lima NL, Crane J. Diarrhea in developed and developing countries: magnitude, special settings, and etiologies. Rev Infec Dis 1990; 12:41-50.         [ Links ]

3. Gallimore CI, Barreiros MAB, Brown DWG, Nascimento JP, Leite JPG. Norovíruses associated with acute gastroenteritis in a children's day care facility in Rio de Janeiro, Brazil. Braz J Med Biol Res 2004; 37:321-326.         [ Links ]

4. Richards GP, Watson MA, Fankhauser RL, Monroe RL, Stephan S. Genogroup I and II Norovíruses detected in stool samples by real time reverse transcription - PCR using highly degenerate universal primers. Appl Environ Microbiol 2004; 70:7179-7184.         [ Links ]

5. Yuen LKW, Catton MG, Cox BJ, Wright PJ, Marshall JA. Heminested multiplex reverse transcription-PCR for detection and differentiation of Norwalk-like virus genogroups 1 and 2 in fecal samples. J Clin Microbiol 2001; 39:2690-2694.         [ Links ]

6. Castilho JG, Munford V, Resque HR, Fagundes-Neto U, Vinjé J, Rácz ML. Genetic diversity of Norovírus among children with gastroenteritis in São Paulo state, Brazil. J Clin Microbiol 2006; 44:3947-3953.         [ Links ]

7. Pang X, Lee B, Chui L, Preiksaitis JK, Monroe SS. Evaluation and validation of real-time reverse transcription-PCR assay using the Light Cycler system for detection and quantitation of Norovírus. J Clin Microbiol 2004; 42:4679-4685.         [ Links ]

8. Soares CC, Santos N, Beard RS, Albuquerque MCM, Maranhão AG, Rocha LN, et al. Norovírus detection and genotyping for children with gastroenteritis, Brazil. Eme Infec Dis 2007; 13:1244-1246.         [ Links ]

9. Atmar RL, Estes MK. Diagnosis of noncultivatable gastroenteritis viruses, the human Caliciviruses. Clin Microbiol Rev 2001; 14:15-37.         [ Links ]

10. Fallowfield B. Reducing the impact of norovírus outbreaks. Clin Laborat Internat 2007; 31: 25-27.         [ Links ]

11. Rabenau HF, Stürmer M, Buxbaum S, Walczok A, Preiser W, Doerr HW. Laboratory diagnosis of Norovírus: which method is the best? Intervirol 2003; 46:232-238.         [ Links ]

12. Beuret C. Simultaneous detection of enteric viruses by multiplex real-time RT-PCR. J Virol Methods 2004; 115:1-8.         [ Links ]

13. Lopman BA, Reacher M, Gallimore C, Adak GK, Gray JJ, Brown DW. A summertime peak of "winter vomiting disease": Surveillance of norovíruses in England and Wales, 1995 to 2002. BMC Public Health 2003; 3:13-17.         [ Links ]

 

 

Endereço para correspondência:
Dra Sofia Georgiadis
Laboratório Weinmann Setor de Biologia Molecular
Rua Ramiro Barcelos 910
90035-001 Porto Alegre, RS
Tel: 55 51 3314 3850 Fax: 55 51 33117813
e-mail: sofia_g77@hotmail.com

Recebido para publicação em 28/10/2009
Aceito em 06/04/2010