Memórias do Instituto Oswaldo Cruz
Print version ISSN 0074-0276
Mem. Inst. Oswaldo Cruz vol.101 suppl.1 Rio de Janeiro Oct. 2006
http://dx.doi.org/10.1590/S0074-02762006000900027
A bacterial artificial chromosome library for Biomphalaria glabrata, intermediate snail host of Schistosoma mansoni
Coen M AdemaI,1; Mei-Zhong LuoII; Ben HaneltI; Lynn A Hertel; Jennifer J MarshallI; Si-Ming ZhangI; Randall J DeJongI,2; Hye-Ran KimII; David KudrnaII; Rod A WingII; Cari SoderlundIII; Matty KnightIV; Fred A LewisIV; Roberta Lima CaldeiraV; Liana K Jannotti-PassosV; Omar dos Santos CarvalhoV; Eric S LokerI
IDepartment of Biology, University of New Mexico, Albuquerque, NM, US
IIArizona Genomics Institute, Department of Plant Sciences
IIIArizona Genomics Computational Laboratory, BIO5 Institute, University of Arizona, Tucson, US
IVBiomedical Research Institute, Rockville, MD, US
VLaboratório de Helmintoses Intestinais, Centro de Pesquisas René-Rachou-Fiocruz, Belo Horizonte, MG, Brasil
ABSTRACT
To provide a novel resource for analysis of the genome of Biomphalaria glabrata, members of the international Biomphalaria glabrata Genome Initiative (biology.unm.edu/biomphalaria-genome.html), working with the Arizona Genomics Institute (AGI) and supported by the National Human Genome Research Institute (NHGRI), produced a high quality bacterial artificial chromosome (BAC) library. The BB02 strain B. glabrata, a field isolate (Belo Horizonte, Minas Gerais, Brasil) that is susceptible to several strains of Schistosoma mansoni, was selfed for two generations to reduce haplotype diversity in the offspring. High molecular weight DNA was isolated from ovotestes of 40 snails, partially digested with HindIII, and ligated into pAGIBAC1 vector. The resulting B. glabrata BAC library (BG_BBa) consists of 61824 clones (136.3 kb average insert size) and provides 9.05 ´ coverage of the 931 Mb genome. Probing with single/low copy number genes from B. glabrata and fingerprinting of selected BAC clones indicated that the BAC library sufficiently represents the gene complement. BAC end sequence data (514 reads, 299860 nt) indicated that the genome of B. glabrata contains ~ 63% AT, and disclosed several novel genes, transposable elements, and groups of high frequency sequence elements. This BG_BBa BAC library, available from AGI at cost to the research community, gains in relevance because BB02 strain B. glabrata is targeted whole genome sequencing by NHGRI.
Key words: genomics - gene discovery - fingerprinting - schistosomiasis - medical malacology
The application of molecular approaches continues to contribute novel insights into the biology, including genomics of molluscs (Zhang et al. 2004, Mitta et al. 2005). To date, several mitochondrial genomes of molluscs have been sequenced (DeJong et al. 2004, Mizi et al. 2005), but the nuclear genome of a representative of the Phylum Mollusca remains to be fully characterized. In fact, lophotrochozoan protostomes of which mollusca represent the largest group (Rouse 1999), are underrepresented among the animals from which the current assembly of fully sequenced genomes has been obtained. Thus, genomic data from a mollusc will help fill a gap in the information on the evolutionary history of animal life (Collins et al. 2003).
Molluscs are a highly diverse group that includes some of the largest, longest living, and most intelligent invertebrates. Genome information will instruct on several remarkable properties of molluscs such as shell formation (biomineralization; Milet et al. 2004), the evolution of body asymmetry (Schilthuizen & Davison 2005), and hermaphrodism (Paraense & Corrêa 1988). Molluscs are also being used to study pharmo-toxicology (Terlau & Olivera 2004); neuroendocrinology (Altelaar et al. 2005); parthenogenesis (Jokela et al. 2003); and the molecular basis of behavior and learning (Williamson & Chrachri 2004, Zhurov et al. 2005). Molluscs serve as bioindicators for monitoring of the environment (Zhao et al. 2005), and (snails especially) are useful for understanding how natural selection operates (Vermeij 2002). Furthermore, molluscs are economically important as a major source of food, can destroy crops, colonize and impact new habitats as invasive species (Pointier et al. 2005), and transmit medically important pathogens.
The latter applies to the freshwater gastropod Biomphalaria glabrata (Planorbidae, Basommatophora). This snail serves as one of the most important intermediate hosts for a widespread pathogen of humans, the digenetic trematode Schistosoma mansoni (Paraense & Corrêa 1963, Morgan et al. 2001). This parasite causes intestinal schistosomiasis, a debilitating disease that afflicts over 50 million humans (Chitsulo et al. 2004). To a large extent, the geographic distribution of B. glabrata defines the distribution of S. mansoni in the Neotropics (Paraense 1986, DeJong et al. 2003). Genetic determinants affect the susceptibility of B. glabrata for S. mansoni (Lewis et al. 2001), and heterogeneity in genetic composition of B. glabrata on smaller scales may further influence the transmission patterns of schistosomiasis (Theron & Coustau 2005). More comprehensive genome sequence data for B. glabrata would enable novel investigative approaches to study determinants of transmission, especially in light of an advancing genome project for S. mansoni (Loverde et al. 2004).
B. glabrata also hosts a variety of other digenetic trematodes and has been adopted as the most commonly used model host to study the basic biology of digenean-snail interactions (Lie 1982, Adema & Loker 1997, Vergote et al. 2005). As one example, B. glabrata has been found to produce after exposure to digeneans a unique family of hemolymph molecules termed FREPs (fibrinogen-related proteins). FREPs consist of a juxtaposition of fibrinogen and immunoglobulin superfamily domains, and have proven to be remarkably diverse in their composition. B. glabrata thus serves as a new model system to examine the nature and diversity of non-self recognition molecules produced by invertebrates (Zhang et al. 2004).
Information on the genome of B. glabrata will also have relevance for several other Biomphalaria species and for yet other species of molluscs which serve as hosts for schistosomes and for a number of other trematode, and some nematode, infectious agents. Besides schistosomiasis, diseases such as fascioliasis, clonorchiasis, and paragonimiasis represent only a few of the snail transmitted diseases with worldwide medical and economic impact (Lockyer et al. 2004a).
In 2001, an international consortium, "the Biomphalaria glabrata genome initiative" was founded to develop genome-type projects for this particular pulmonate gastropod species (http://biology.unm.edu/biomphalaria-genome/index.html). Members of this consortium have contributed several gene discovery projects (Jones et al. 2001, Miller et al. 2001, Schneider & Zelck 2001, Raghavan et al. 2003, Lockyer et al. 2004b, Nowak et al. 2004, Jung et al. 2005, Mitta et al. 2005), the full-length sequence of the mitochondrial genome of B. glabrata (DeJong et al. 2004), and an estimate of 931 Mb for the size of the nuclear genome of B. glabrata (Gregory 2003).
A novel resource for genomic studies became available when the National Human Genome Research Institute (NHGRI) awarded a white paper application (http://www.genome.gov/Pages/Research/Sequencing/ BACLibrary/ BgBACprops.pdf) for funding of the production a high quality bacterial artificial chromosome (BAC) library for B. glabrata (http://www.genome.gov/page.cfm ?pageID=10001852). Such a library provides access to large regions of the genome of B. glabrata, in an experimentally manageable fashion. Significantly, the NHGRI support guaranteed high quality standards for the finished library, and also made the BAC library publicly available at cost to the research community. The actual development of the BAC library was a collaboration between the Arizona Genomics Institute (AGI; part of the National Institutes of Health BAC Resource Network) and members of B. glabrata genome initiative. The genomic DNA from a recent B. glabrata field isolate from a schistosomiasis endemic area in Brazil, shown to be susceptible to S. mansoni, was used to ensure that the BAC library provides data that are relevant in the context of parasite-snail compatibility. This report describes the B. glabrata strain used, and both the production and characterization of the BAC library. Lastly, analysis of sequence data obtained provides first glimpses into the genomic make-up of B. glabrata.
MATERIALS AND METHODS
Snails, species identification and susceptibility for schistosome infection - B. glabrata snails were collected from a small stream in an endemic site for transmission of S. mansoni, in the south east of Brazil, Barreiro, Minas Gerais, (19ºS 59 min/44ºW 02 min). Offspring of these snails are maintained as a laboratory strain designated as BB02 (Biomphalaria from Belo Horizonte, Minas Gerais, Brazil 2002).
The species identity of BB02 snails was determined by PCR-RFLP. The ITS1-5.8S-ITS2 sequence region was PCR amplified from DNA of individual snails using primers (all primers are shown 5' -3' ) ETTS2: TAA CAA GGT TTC CGT A GG TGA A and ETTS1: TGC TTA AGT TCA GCG GGT. The amplicons were digested with DdeI and restrictions patterns obtained from BB02 snails were compared to the characteristic banding pattern specific for B. glabrata (Vidigal et al. 1998). Also sequences from the 16SrDNA and ND1 genes of one BB02 snail were amplified by PCR, using primer pairs 16Sar: CGC CTG TTT ATC AAA AAC AT - 16Sbr: CCG GTC TGA ACT CAG ATC ACG T (Palumbi et al. 1996) and SNDF1F2: CGR AAA GGA CCT AAY AGT TGG - SND1R4: ART CRA ATG GYG CHC GAT TAG, respectively. (R=A/G Y=C/T H= A/C/T). The sequences from these amplicons were obtained by direct sequencing and analyzed relative to previously generated phylogenies of Biomphalaria isolates, all according to DeJong et al. (2003). The sequences of 16S rDNA and NADH dehydrogenase 1 were deposited in GenBank under accession numbers AY737280 and AY737281, respectively.
Members of the F1 generation derived from field collected snails were tested for susceptibility to two different S. mansoni strains (LE, SJ) at the Section of Molluscs Rearing at the Centro de Pesquisas René-Rachou in Belo Horizonte, Brazil. Groups of 50 juvenile snails (3-6 mm) were exposed individually to 10 miracidia. The parasite-susceptible BB01 strain of B. glabrata(maintained over 10 years in the laboratory in Brazil) was used as a control for miracidial infectivity. At 4 weeks post exposure, snails were exposed to artificial light for 30 min and the shedding of cercariae was recorded. Non-shedding snails were dissected to check for developing sporocysts. BB02 B. glabrata were similarly tested for susceptibility to the NMRI strain of S. mansoni at the Biomedical Research Institute (MD, US).
Preparation of HMW genomic DNA from BB02 B. glabrata - Initial comparisons disclosed that relative to whole body or the digestive gland, the ovotestis of B. glabrata was optimal for generation of monocellular suspensions as required to obtain high molecular weight DNA (Luo & Wing 2003). However, the DNA yield from a single snail was insufficient to generate a BAC library. B. glabrata is a simultaneous hermaphrodite and offspring were generated by selfing to minimize haplotype diversity. One newly hatched BB02 snail (< 3 mm shell diameter) was kept in isolation to generate F1 progeny by self-fertilization (sF1). A selfed F2 generation (sF2) derived from the sF1 was similarly obtained.
High molecular weight (HMW) genomic DNA was isolated from forty sF2 snails (10-12 mm shell diameter). Following cleaning and removal of shells, live snails were kept briefly in ½199 medium (physiological buffer for snail cells; medium 199 (Sigma) diluted 1:1 [v/v] with distilled water) until all snails were processed. From 4 snails at a time, the ovotestes were dissected and pooled in 800 µl of ½199 in 1.7 ml Eppendorf tubes on ice. All the following manipulations were performed gently to minimize damage to cells and mechanical shearing of DNA. The tissues were disrupted with 3 strokes of a polypropylene pellet pestle (Kontes). The resulting cell suspensions were pooled in a 50 ml Falcon tube on ice. No sediment was evident after 1 h. Cells were pelleted (400 g, 5 min at 4ºC) and the cleared supernatant fluid was reduced to 600 µl. The cells were resuspended uniformly by tapping the side of the tube and incubated for 3 min at 42C. Then, 600 µl of 1% Seakem agarose (FMC) in ½199, (pre-warmed to 42ºC) was mixed with the cells using minimal agitation. The monocellular cell suspension in agarose was transferred (using a cut-off, wide bore pipette tip) into disposable CHEF plug moulds (Bio-Rad) to obtain plugs with uniform cell numbers embedded in an agarose matrix, and placed on ice for 20 min. The 13 resulting plugs were transferred to 50 ml NDS (0.5 M EDTA, 10 mM Tris, 1% w/v N-lauroyl sarcosine, pH 9.5 (NaOH), supplemented with 1 mg/ml proteinase K (Invitrogen) and incubated overnight at 50ºC in a rotary hybridization oven. This treatment lysed the cells while the agarose matrix protected high molecular weight genomic DNA from mechanical shearing. The medium was replaced by NDS and again incubated overnight at 50ºC with rotation. DNA quality and susceptibility to HindIII digestion were evaluated by contour-clamped homogeneous electric field (CHEF) gel electrophoresis.
Generation of the BG_BBa BAC library - The methods of Luo and Wing (2003) were used to produce the BAC library. Briefly, following testing to determine optimal conditions, HMW DNA embedded in plugs was partially digested with HindIII. Following separation on CHEF gels twice, DNA fragments in the 150-300 kilobase (kb) range were eluted and ligated into pAGIBAC1. This BAC vector carries a resistance marker for chloramphenicol and incorporates a high signal for blue/white screening of non-insert transformants. The resulting constructs were introduced into DH10B-T1 phage resistant Escherichia coli cells by electroporation and plated on LB containing 12.5 µg/ml chloramphenicol and 80 µg/ml X-gal, 100 µg/ml IPTG for blue/white screening. Guided by video recognition of successful transformants, clones were picked and gridded into 384 well plates by a Q-bot (Genetix). Clones were stored as glycerol cultures at 80ºC. Also, the clones from the BAC library were inoculated on four 22.5 ´ 22.5 cm Hybond N+ filters (Amersham) in high density, double spots and 4 ´ 4 patterns with a Q-bot (Genetix). The resulting filters a, b, c each contained 18432 clones in duplicate in six fields, the last filter (d) held 6528 clones in the same layout. The membranes were placed on LB agar plates containing 12.5 µg/ml chloramphenicol and incubated overnight to obtain colonies of 1 to 2 mm diameter. The membranes were placed (colony side up) on absorbent filter paper (Whatman Cat. No. 3030 700) soaked in the following solutions: (1) solution 1 (0.5 N NaOH, 1.5 M NaCl) for 7 min; (2) solution 2 (1.5 M NaCl, 0.5 M Tris-HCl, pH 8.0), 7 min; (3) air dry for more than 1 h; (4) solution 3 (0.4 N NaOH), 20 min; (4) solution 4 (5X SSPE), 7 min, and air dried overnight. The complete library (as frozen stocks), high density filters, and individual clones are available at cost from AGI. Protocols for screening of high density BAC library filters and address determination of positive signals are publicly available from AGI (www.genome. arizona.edu).
Isolation and sequencing of BAC DNA - At AGI, BAC DNA was isolated from 1.2 ml 2 ´ YT (Fisher) overnight cultures using alkaline lysis (96-well format) with a Quadra 96 Model 320 (Tomtec). Both ends of BAC inserts were sequenced using T7: TAA TAC GAC TCA CTA TAG GG as ''forward'' primer and BES_HR: CACT CAT TAG GCA CCC CA as the ''reverse'' primer. Cycle sequencing (BigDye Terminator v 3.1, Applied Biosystems) was performed using PTC-200 thermal cyclers (MJ Research) in 384-well format applying 150 cycles of 10 s at 95ºC, 5 s at 55ºC, and 2.5 min at 60ºC. Extension products were purified by CleanSeq magnetic beads (Agencourt). Samples were eluted into 20 µl of ddH20 and separated on ABI 3730xl capillary sequencers with default conditions. Sequence data were collected by data collection software (Applied Biosystems), and transferred to a UNIX workstation. Sequences were base-called using the program Phred (Ewing & Green 1998, Ewing et al. 1998); vector and low-quality (Phred value <16) sequences were removed using the program Lucy (Chou & Holmes 2001). The methods applied at UNM included Montage BAC96 (Millipore) and Perfectprep BAC 96 (Eppendorf) for isolation of BACs. BAC ends were sequenced (Big Dye v. 3.1, ABI), also with T7 and BES_HR primers, using Biometra T-gradient thermal cyclers in 96 well format. The temperature profile was 1 min at 94ºC, 100 cycles of 30 s at 94ºC, 1 min at 55ºC, 1 min at 72ºC, and 7 min at 72ºC. Following cleanup (Montage SEQ96; Millipore), extension products were read on an ABI 3700. Sequencher (GC codes) was used to remove vector sequences and edit chromatograms by eye.
Quality control of the BAC library - To estimate the average insert size of the BAC library, BACs were extracted from 361 randomly selected clones at AGI. The DNA was digested to completion with NotI (3 h/37ºC) and separated on 1% CHEF gels to determine the size of the insert DNA. These data were applied to calculate the estimated coverage of the genome of B. glabrata by the BAC library. Absence of insert DNA was monitored to determine the proportion of empty vector in the BAC library.
The non-redundancy of BAC inserts was tested by sequencing (AGI) both termini of a random set of 192 clones. The clones were arbitrarily selected from wells A01, A02, A03 from plates 1-32, and well B23 from plates 1-96 in which the library is stored.
The representation of the genome of B. glabrata in the BAC library was investigated by screening the BAC library for sequences representing low- or single copy genes of B. glabrata (UNM). The probe sequences were selected from the literature, or chosen arbitrarily (see Table II). The probes were amplified by PCR from genomic or cDNA templates, labeled with 32P a dCTP (Perkin Elmer) by random priming (Prime-it RT, Stratagene), and used as hybridization probes to screen filters that contained spotted BAC clones. The initial screening of high density filters representing the whole library (as available from AGI) was performed with two sets of five pooled probes (see http://www.genome.arizona.edu/information/protocols /index.html). The filters were prehybridized at 65ºC for at least 4 h with hybridization buffer (0.5 M sodium phosphate pH 7.2, 7% SDS, 1 mM EDTA, 10 µg/ml sheared salmon DNA). After an exchange with fresh buffer, pre-hybridization was continued for 2 h. The probes were added and hybridized (>18 h, 65ºC). The filters were washed sequentially with 2X SSC, 1X, and 0.1X SSC (all containing 0.1% SDS), 2 times each (20 min, 65ºC), then autoradiography was performed. Positive clones were identified and obtained from AGI as bacterial stab cultures. These clones were used to manually prepare macroarrays (96 well format) applying similar methods as described above for the high density filters. The macroarrays were screened with individual probes to determine which clones contained specific target sequence. The BAC clones were also end-sequenced.
Contig alignment of BACs by fingerprinting - The BACs from clones that strongly hybridized the low- or single copy probes were subjected to the fingerprinting methods described by Luo et al. (2003). The resulting digestion patterns were compared for similarities to identify and contiguously align (partially) overlapping BACs using FPC software for the contig assembly (Soderlund et al. 2000). Also see http://www.genome.arizona.edu/BAC_special_projects/
Computational analysis and annotation of BAC end sequences - A contig analysis of the BAC end sequences was performed using Sequencher (GC codes). The clustering criteria were arbitrarily set at 98% identity over 100 nucleotides. The AT content was calculated for all non-redundant (sequence contigs were used instead of individual cluster mates) BAC end sequence data combined. BLAST searches were used to investigate the likelihood that BAC inserts were of snail origin, as well as to uncover similarities between BAC end sequences and the protein and nucleotide databases of GenBank, with special consideration of sequence entries from B. glabrata. E-values < 10-4 were considered significant. Discrepancies in sequence similarities between genomic and cDNA sequences were analyzed for the presence of non-coding sequences, including introns. Repetitive sequences were identified by direct inspection of sequence data and by analysis of results from BLAST searches. The BAC end sequence data were submitted as genome survey sequences (GSS) to GenBank under accession numbers CZ547921-CZ548269; DX360039-DX360203.
RESULTS
Characteristics of the BB02 strain of B. glabrata - Snails of the field isolate collected in September 2002, morphologically consistent with being B. glabrata, were identified as the species B. glabrata by PCR-RFLP (Fig. 1). Additionally, the 16S rDNA (GenBank accession AY737280) and NADH dehydrogenase 1 (ND1; accession AY737281) sequences from one BB02 snail were each 99% identical to previously characterized sequences from other B. glabrata isolates. Phylogenetic analysis based on these sequences placed the BB02 strain within the "B1" Brazilian clade of B. glabrata that was designated by DeJong et al. (2003). Bootstrap support was 85-98%, depending on the use of distance, maximum parsimony, or maximum likelihood methods. Phylogenetic trees are not shown; they were essentially identical to those presented in DeJong et al. (2003).

BB02 snails proved highly susceptible to three different strains of S. mansoni. At 4 weeks following experimental exposure, 89.6% or more of the snails harbored viable parasite infections (Table I).
Generation of the BG_BBa BAC library - The genomic DNA sample form 40 twice-selfed BB02 snails yielded sufficient quantity of HMW DNA (Fig. 2). The cloning of fragments ranging from 150-300 kb (partial HindIII digest) allowed isolation of 61,824 transformants, which were distributed over 161 plates with 384 wells. The BAC library was designated BG_BBa ("BG" is the first letter of genus and species, the "B" is for BB02 strain, the second "B" designates BAC library, "a" is the first library made).

Properties of the BG_BBa BAC library - The average insert size observed from clones of the BG_BBa library was 136.3 kb (n=361). The distribution of different insert size categories is shown in Fig. 3. Over 90% (or 328) of the BACs had an insert size greater than 100 kb. No empty clones (vector without insert) were recorded. The BG_BBa library consists of 61824 clones with an average insert of 136.3 kb. This provides a 9.05-fold coverage of the genome of B. glabrata based on a size estimate of 931 Mb (Gregory 2003). The sequencing of BAC ends of 192 clones yielded 349 reads totaling 242270 nucleotides (nt; designated the AGI set). Contig analysis indicated that all of the sequences obtained from this random sample were unique. Some BAC inserts (1.4% of the total) shared highly similar sequences at one terminal end, but differed from each other on the other side of the insert. These BACs were BG_BBa0012A03 and BG_BBa0064N23 (GenBank accessions of the sequence reads from the termini are CZ548214 and CZ548008, respectively) displaying 12 differences over 770 nt; and BG_BBa0023A03 (CZ548090), BG_BBa0095B23 (CZ548268), BG_BBa0024B23 (CZ548158) that shared a 464 nt sequence (6 differences) that was highly similar to a transposable element (GenBank XP_791680).
All 10 low- or single copy probes hybridized with clones on the high density filters representing the complete BAC library. Verification of putative positives by colony hybridization (using macroarrays) identified some false positives but also confirmed the representation of each target sequence in the BAC library (see Table II).
Contig alignment of BACs by fingerprinting - Analysis of the multiple restriction patterns of 55 BAC clones provided data that were sorted into 13 contigs. Two of these contigs (numbers 2 and 8) combined BACs that had hybridized different probe sequences. In total, 11 different contigs provided alignment of BACs that had each hybridized with the same probe sequence. These assemblies revealed the relative position of several BAC clones within the genome of B. glabrata (Fig. 4, for all contigs see http://www.genome. arizona.edu/cgi-bin/ BAC specialproj).

Analysis of sequence data from BAC ends - The end sequencing of the BAC clones used for macroarrays yielded another 165 sequence reads totaling 62402 nt (designated as the UNM set). These BACs were not chosen randomly; rather they were selected based on the first screening of high density filters with 2 different pools of 5 probes representing single- or low copy sequences as described above. Nevertheless, the majority of BAC end sequences recovered from this group was unique. In some cases, multiple clones had identical insert sequence from at least one of their termini; these were DX360154-DX360158 and DX360097- DX360114 (both BACs of the latter combination reacted with the FREP13 probe). Two sequence reads from BACs that bound the myoglobin probe (DX360049, DX360199) combined into a 639 nt contig, consistent with the grouping of these BAC inserts in "contig 5" resulting from the fingerprinting approach.
All the BAC end sequences are considered to derive from the nuclear genome of the snail because a direct sequence comparison showed no similarities with the mitochondrial genome of B. glabrata (NC_005439; DeJong et al. 2004). Thus, the base usage determined from these BAC end sequences (Table III) indicated that the nuclear genome of B. glabrata has an AT content of just over 63%.
BLAST analysis showed that the majority (430 or 83.7%) of the 514 BAC end sequences were novel; they did not display significant similarity with previously known sequences. However, several putative gene sequences were identified that had not been recorded previously from B. glabrata. Sequences from five BAC ends most resembled previous entries derived from B. glabrata (summarized in Table IV). Two segments of the contig of BAC end sequences DX360049 and DX360199 showed BLAST similarities to glyceraldehyde-3-phosphate dehydrogenase in a way that also revealed intron-exon structure, with splice sites that display the general GT-AG consensus (Fig. 5).
Several types of sequence repeats were observed directly from the BAC-derived sequences. These included simple dinucleotide microsatellites (e.g a string of TA repeats in DX360102), but also more complex sequence repeats such as CZ548151 that showed 18 almost exact repeats of "ACCCTGGTATGCCTTAGTGCTTGTATTGG". Furthermore, BLAST results indicated the presence of various transposable elements in 50 BAC end reads (9.7% of the total).
Remarkably, the genomic sequence collected here also contained an enigmatic type of high frequency sequence elements (HFSE). Stretches of between about 60 and 250 nucleotides embedded within almost 12% of the BAC end sequences showed significant similarity to (non protein-encoding) intron sequences of two separate kinds of B. glabrata genes for which full-length sequences have been provided previously; myoglobin and several fibrinogen-related protein genes (FREP2.1; FREP3.1; FREP4; FREP6, FREP7.1, FREP13.1). Thus similarities were detected only at nucleotide level (BLASTN), not at the deduced aminoacid level (BLASTX). A comparison disclosed that parts of the introns of myoglobin and FREPs share regions with considerable sequence similarities. These particular sequence regions generated a surprisingly high number of significant BLAST hits when compared against genomic and cDNA sequences of B. glabrata (Fig. 6). BLAST analysis showed that the different HFSE do not share significant similarities with known sequences from other organisms, either at nucleotide or deduced amino acid levels.
DISCUSSION
The development of genomic projects for B. glabrata will inform on the biology of molluscs in general. But of course, such an effort must also be considered in light of schistosomiasis. The medical importance of a better understanding of snail-parasite interactions and the possibility of gaining novel insights into the transmission of schistosomiasis by B. glabrata was part of the motivation for NHGRI to support the production of a high quality BAC library. Importantly, the NHGRI support also makes the library available at cost to the research community as a resource for the research community to enable advanced level study as a complement to ongoing research into the biology of B. glabrata, both in the laboratory and in the field.
Before generating the BAC library, it was of paramount importance to confirm that snails collected from the field were indeed B. glabrata. Two independent methods, PCR-RFLP analysis of nuclear sequences (Vidigal et al. 1998) and phylogenetic analysis of sequence segments from mitochondrial genes (DeJong et al. 2003) each confirmed that BB02 snails were B. glabrata. Likewise, different research groups tested and confirmed that BB02 B. glabrata is susceptible to infection by various strains of S. mansoni. Several research groups in the US, the UK and in Brazil now maintain the BB02 snails. This also minimizes the risk of accidental loss of the strain.
The isolation of sufficient amounts of good quality, HMW DNA from B. glabrata proved to be a challenge. Routine methods for DNA extraction from whole snail bodies yielded DNA fragments < 50 kb, too low for generation of large inserts in a BAC library. The methods of Luo and Wing (2003), originally developed for plant tissues, did produce HWM DNA > 800 kb, but only from the ovotestis of B. glabrata and not in adequate amounts from a single snail. The additional snails needed were generated by selfing. This is possible because B. glabrata is a simultaneous hermaphrodite that can self fertilize (producing both male and female gametes) to produce offspring. Although this does not equate to cloning snails, the haplotype diversity of selfed progeny is thus lowered compared to that of outcrossing snails.
Once produced, the BG_BBa BAC library was found to exceed the quality standards set by NHGRI. At an average size of 136.3 kb, inserts of snail-derived sequence are large enough to accommodate several genes in genomic sequence context, even when considering the 16 kb size of FREP7.1 (AY028462) the largest sequence containing a full-length gene from B. glabrata, characterized to date. Non-transformed clones were not observed and the proportion of empty vectors (no insert) is considered negligible. Furthermore, the quality control showed that the inserts are diverse in size and sequence content. At the same time, each of 10 low copy number gene sequences of B. glabrata was present. The recovery of HSP70-encoding sequence (DX360157) confirmed the integrity of the library and showed that genes can be screened for and recovered for additional analysis. The contig assembly based on fingerprinting further demonstrated the consistency of retrieving relevant, related sequences in the genome context from the BAC library. The apparent diversity of BACs (failure to form a single contig) recovered after screening with the myoglobin sequence must be considered against a rapid increase of (hemo)globin-like EST sequences in GenBank (85 entries in February 2006). Myoglobin may be a low copy sequence, but the abundance of now available information suggests a high likelihood for cross-reactivity with sequences from other genes.
Already, the BAC library has provided new information on the B. glabrata genome. The BAC end sequence data not only identified several genes, but as shown in Fig. 5, also provided information regarding intron-exon structure of genes. The latter is relevant since most B. glabrata genes are only characterized from cDNA. The large amount of BAC end sequence data indicated that the genome of B. glabrata has a 63% AT content. This is higher than previously estimated, based on the reported 54% AT content for the related B. alexandrina (Nabih & El Ansary 1980). However, it is not as high as the 74.6% AT content of the mitochondrial genome of B. glabrata (DeJong et al.2003).
The sequence data provided an indication of abundance of mobile elements: these occurred in 9.7% of the BAC ends characterized. This sampling is incomplete, but 9.7% is low compared to the genome of S. mansoni that may consist of 50% mobile elements (Laha et al. 2005). Another surprise were the groups of HFSEs, embedded within BAC end sequences, introns of myoglobin and FREP genes and shared with cDNA sequences (Fig. 6). Perhaps HFSEs are a peculiarity of the genome of B. glabrata, possibly these are transcriptionally active regions that function in regulation of gene expression (e.g. Claverie 2005, Mattick 2005). Likely, elucidation of the origin and function of these will benefit from continued genome level investigations of B. glabrata.
In conclusion, a high quality BAC library for B. glabrata is now available. This helps to keep pace with similar research developments for S. mansoni such that this parasite-snail interaction can be analyzed at the genomics level. Because the current full genome sequencing project also employs the BB02 strain B. glabrata (http://genome.wustl.edu/genome.cgi?GENOME=Biomphalaria %20glabrata), the usefulness of the BG_BBa BAC library as a research resource will continue to increase by making the B. glabrata genome accessible to study snail biology in novel ways.
ACKNOWLEDGMENTS
Ulrike Zelck (Tûbingen University, Germany) provided helpful discussion for selection of low copy genes. At the University of Arizona, Chris Mueller, Kristi Collura, Nick Sisneros, Marina Wissotski, Dan Smart, David Campos and Kiran Rao provided excellent technical assistance. At the University of New Mexico, George Rosenberg assisted with sequencing of BACs, technical support was provided by the Molecular Biology Facility, which is supported by NIH grant number 1P20RR18754 from the Institute Development Development Award (IDeA) Program of the National Center for Research Resources.
REFERENCES
Adema CM 2002. Comparative study of cytoplasmic actin DNA sequences from six species of Planorbidae (Gastropoda: Basommatophora). J Molluscan Stud 68: 17-23. [ Links ]
Adema CM, Loker ES 1997. Specificity and immunobiology of larval digenean-snail associations. In B Fried, TK Graczyk (eds), Advances in Trematode Biology, CRC Press, Boca Raton, FL, p. 230-263. [ Links ]
Altelaar AF, van Minnen J, Jimenez CR, Heeren RM, Piersma SR 2005. Direct molecular imaging of Lymnaea stagnalis nervous tissue at subcellular spatial resolution by mass spectrometry. Anal Chem 77: 735-741. [ Links ]
Chou HH, Holmes MH 2001. DNA sequence quality trimming and vector removal. Bioinformatics 17: 1093-1104. [ Links ]
Claverie J-M 2005 Fewer Genes, More Noncoding RNA. Science 309: 1529-1530. [ Links ]
Collins FS, Green ED, Guttmacher AE, Guyer MS 2003. A vision for the future of genomics research. Nature 422: 835-847. [ Links ]
Chitsulo L, Loverde R, Engels D, Barakat R, Colley D, Cioli D, Engels D, Feldmeier H, Loverde P, Olds GR, Ourna J, Rabello A, Savioli L, Traore M, Vennerwald B 2005. Schistosomiasis. Nat Rev Microbiol 2: 12-13. [ Links ]
DeJong RJ, Emery AM, Adema CM 2004. The mitochondrial genome of Biomphalaria glabrata (Gastropoda: Basom-matophora), intermediate host of Schistosoma mansoni. J Parasitol 90: 991-997. [ Links ]
DeJong RJ, Morgan JAT, Wilson WD, Al-Jaser MH, Appleton CC, Coulibaly G, D'andrea PS, Doenhoff MJ, Haas W, Idris MA, Magalhães LA, Moné H, Mouahid G, Mubila L, Pointier J-P, Webster JP, Zanotti-Magalhães EM, Paraense WL, Mkoji GM, Loker ES 2003. Phylogeography of Biomphalaria glabrata and B. pfeifferi, important intermediate hosts of Schistosoma mansoni in the New and Old World tropics. Mol Ecol 12: 3041-3056. [ Links ]
Ewing B, Green P 1998.Base-calling of automated sequencer traces using Phred: II. Error probabilities. Genome Res 8: 186-194. [ Links ]
Ewing B, Hillier L, Wendl MC, Green P 1998. Base-calling of automated sequencer traces using Phred: I. Accuracy assessment. Genome Res 8: 175-185. [ Links ]
Gregory TR 2003. Genome size estimates for two important freshwater molluscs, the zebra mussel (Dreissena polymorpha) and the schistosomiasis vector snail (Biomphalaria glabrata). Genomics 46: 841-844. [ Links ]
Jokela J, Lively CM, Dybdahl MF, Fox JA 2003. Genetic variation in sexual and clonal lineages of a freshwater snail. Biol J Linn Soc Lond 79: 165-181. [ Links ]
Jones CS, Lockyer AE, Rollinson D, Noble LR 2001. Molecular approaches in the study of Biomphalaria glabrata - Schistosoma mansoni interactions: linkage analysis and gene expression profiling. Parasitology 123 (Suppl. S): S181-S196. [ Links ]
Jung Y, Nowak TS, Zhang S-M, Hertel LA, Loker ES, Adema CM 2005 Manganese superoxide dismutase from Biomphalaria glabrata. J Invertebr Pathol 90: 59-63. [ Links ]
Laha T, Kewgrai N, Loukas A, Brindley PJ 2005 Characterization of SR3 reveals abundance of non-LTR retrotransposons of the RTE clade in the genome of the human blood fluke, Schistosoma mansoni. BMC Genomics 6: 154. [ Links ]
Laursen JR, di Liu H, Wu XJ, Yoshino TP 1997 Heat-shock response in a molluscan cell line: characterization of the response and cloning of an inducible HSP70 cDNA. J Invertebr Pathol 70: 226-233. [ Links ]
Lewis FA, Patterson CN, Knight M, Richards CS 2001. The relationship between Schistosoma mansoni and Biomphalaria glabrata: genetic and molecular approaches. Parasitology 123 (Suppl. S): S169-S179. [ Links ]
Lie KJ 1982. Survival of Schistosoma mansoni and other trematode larvae in the snail Biomphalaria glabrata - a discussion of the interference theory. Trop Geogr Med 34: 111-122. [ Links ]
Lockyer AE, Jones CS, Noble LR, Rollinson D 2004a Trematodes and snails: an intimate association. Can J Zool 82: 251-269. [ Links ]
Lockyer AE, Noble LR, Rollinson D, Jones CS 2004b. Schistosoma mansoni: resistant specific infection-induced gene expression in Biomphalaria glabrata identified by fluorescent-based differential display. Exp Parasitol 107: 97-104. [ Links ]
LoVerde PT, Hirai H, Merrick JM, Lee NH, El-Sayed N 2004. Schistosoma mansoni genome project: an update. Parasitol Int 53: 183-192. [ Links ]
Luo M, Wing RA 2003. An improved method for plant BAC library construction. In E Grotewold, Plant Functional Genomics: Methods and Protocols, Humana Press, Totowa, NJ, p. 3-19. [ Links ]
Luo M, Thomas C, You FM, Hsiao J, Ouyang S, Buell CR, Malandro M, McGuire PE, Anderson OD, Dvorak J 2003. High-throughput fingerprinting of bacterial artificial chromosomes using the snapshot labeling kit and sizing of restriction fragments by capillary electrophoresis. Genomics 82: 378-389. [ Links ]
Mattick JS 2005. The Functional Genomics of Noncoding RNA. Science 309: 1527-1528. [ Links ]
Milet C, Berland S, Lamghari M, Mouries L, Jolly C, Borzeix S, Doumenc D, Lopez E, 2004. Conservation of signal molecules involved in biomineralisation control in calcifying matrices of bone and shell Source. C R Palevol 3: 493-501. [ Links ]
Miller AN, Raghavan N, FitzGerald PC, Lewis FA, Knight M 2001. Differential gene expression in haemocytes of the snail Biomphalaria glabrata: effects of Schistosoma mansoni infection. Int J Parasitol 31: 687-696. [ Links ]
Mitta G, Galinier R, Tisseyre P, Allienne JF, Girerd-Chambaz Y, Guillou F, Bouchut A, Coustau C 2005. Gene discovery and expression analysis of immune-relevant genes from Biomphalaria glabrata hemocytes. Dev Comp Immunol 29: 393-407. [ Links ]
Mizi A, Zouros E, Moschonas N, Rodakis GC 2005. The complete maternal and paternal mitochondrial genomes of the Mediterranean mussel Mytilus galloprovincialis: implications for the doubly uniparental inheritance mode of mtDNA. Mol Biol Evol 22: 952-967. [ Links ]
Morgan JAT, DeJong RJ, Snyder SD, Mkoji GM, Loker ES 2001. Schistosoma mansoni and Biomphalaria: past history and future trends. Parasitology 123 (Suppl. S): S211-S228. [ Links ]
Nabih I, El Ansary A 1980. Genetic-studies on fresh-water snails specific intermediate hosts for schistosomiasis .2. Isolation and base composition determination of deoxyribonucleic-acid. Cell Mol Biol 26: 455-458. [ Links ]
Nowak TS, Woodards AC, Jung Y, Adema CM, Loker ES 2004. Identification of transcripts generated during the response of resistant Biomphalaria glabrata to Schistosoma mansoni infection using suppression subtractive hybridization. J Parasitol 90: 1034-1040. [ Links ]
Paraense WL 1986. Distribuição dos caramujos no Brasil. In FA Reis, I Faria, N Katz (eds), Modernos Conhecimentos sobre Esquistossomose Mansônica, Suplemento dos Anais 1983/84, vol. 14, Academia Mineira de Medicina, Belo Hori-zonte, p. 117-128. [ Links ]
Paraense WL, Corrêa L 1963. Variation in susceptibility of populations of Australorbis glabratus to a strain of Schistosoma mansoni. Rev Inst Med Trop Sã Paulo 5: 15-22. [ Links ]
Paraense WL, Corrêa LR 1988. Self-fertilization in the freshwater snails Helisoma duryi and Helisoma trivolvis. Mem Inst Oswaldo Cruz 83: 405-410. [ Links ]
Pointier JP, David P, Jarne P 2005. Biological invasions: the case of planorbid snails. J Helminthol 79: 249-256. [ Links ]
Raghavan N, Miller AN, Gardner M, FitzGerald PC, Kerlavage AR, Johnston DA, Lewis FA, Knight M 2003. Comparative gene analysis of Biomphalaria glabrata hemocytes pre- and post-exposure to miracidia of Schistosoma mansoni. Mol Biochem Parasitol 126: 181-191. [ Links ]
Rouse GW 1999. Trochophore concepts: ciliary bands and the evolution of larvae in spiralian metazoa. Biol J Linn Soc Lond 66: 411-464. [ Links ]
Schilthuizen M, Davison A 2005. The convoluted evolution of snail chirality. Naturwissenschaften 92: 504-515. [ Links ]
Schneider O, Zelck UE 2001. Differential display analysis of hemocytes from schistosome-resistant and schistosome-susceptible intermediate hosts. Parasitol Res 87: 489-491. [ Links ]
Soderlund C, Humphrey S, Dunhum A, French L 2000. Contigs built with fingerprints, markers and FPC V4.7. Genome Res 10: 1772-1787. [ Links ]
Terlau H, Olivera BM 2004. Conus venoms: A rich source of novel ion channel-targeted peptides. Physiol Rev 84:41-68. [ Links ]
Theron A, Coustau C 2005. Are Biomphalaria snails resistant to Schistosoma mansoni? J Helminthol 79: 187-191. [ Links ]
Vergote D, Bouchut A, Sautiere PE, Roger E, Galinier R, Rognon A, Coustau C, Salzet M, Mitta G 2005. Characterisation of proteins differentially present in the plasma of Biomphalaria glabrata susceptible or resistant to Echinostoma caproni. Int J Parasitol 35: 215-224. [ Links ]
Vermeij GJ 2002. Characters in context: molluscan shells and the forces that mold them. Paleobiology 28: 41-54. [ Links ]
Vidigal TH, Spatz L, Nunes DN, Simpson AJ, Carvalho OS, Dias Neto E 1998. Biomphalaria spp: identification of the intermediate snail hosts of Schistosoma mansoni by polymerase chain reaction amplification and restriction enzyme digestion of the ribosomal RNA gene intergenic spacer. Exp Parasitol 89: 180-187. [ Links ]
Williamson R, Chrachri A 2004. Cephalopod neural networks. Neurosignals 13: 87-98. [ Links ]
Zhao X, Zheng M, Liang L, Zhang Q, Wang Y, Jiang G 2005. Assessment of PCBs and PCDD/Fs along the Chinese Bohai Sea coastline using mollusks as bioindicators. Arch Environ Contam Toxicol 49: 178-185. [ Links ]
Zhang S-M, Loker ES 2004. Representation of an immune responsive gene family encoding fibrinogen-related proteins in the freshwater mollusc Biomphalaria glabrata, an intermediate host for Schistosoma mansoni. Gene 341: 255-266. [ Links ]
Zhang S-M, Adema CM, Kepler TB, Loker ES 2004. Diversification of Ig superfamily genes in an invertebrate. Science 305: 251-254 [ Links ]
Zhurov Y, Proekt A, Weiss KR, Brezina V 2005. Changes of internal state are expressed in coherent shifts of neuromuscular activity in Aplysia feeding behavior. J Neurosci 25: 1268-1280. [ Links ]
Received 25 May 2006
Accepted 26 June 2006
Financial support: the production and distribution of the BG_BBa BAC library at AGI was supported by the funding from the National Human Genome Research Institute under the BAC Library Production program (grant 5U01HG002525; RAW). Parts of this study were supported by NIH grants AI024340 (ESL), AI052363 (CMA), and Fiocruz
Deceased 2 April 2005
1 Corresponding author: coenadem@unm.edu.
2 Present address: Laboratory of Malaria and Vector Research, NIAID/NIH, Twinbrook III, Room 2E-20 MSC 8132 Bethesda, MD 20892, US











Curriculum ScienTI
uBio 