SciELO - Scientific Electronic Library Online

vol.109 número7Comparative serology techniques for the diagnosis of Trypanosoma cruzi infection in a rural population from the state of Querétaro, MexicoComplete genome sequence of a clinical Bordetella pertussis isolate from Brazil índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados




Links relacionados


Memórias do Instituto Oswaldo Cruz

versão impressa ISSN 0074-0276

Mem. Inst. Oswaldo Cruz vol.109 no.7 Rio de Janeiro nov. 2014  Epub 14-Out-2014 

Letter to the Editor

Community-acquired invasive liver abscess syndrome caused by a K1 serotype Klebsiella pneumoniae isolate in Brazil: a case report of hypervirulent ST23

Rosane L Coutinho1  + 

Marina F Visconde2 

Fernanda J Descio1 

Adriana G Nicoletti2 

Flavia CL Pinto1 

Ana Carolina R da Silva2 

Fernanda Rodrigues-Costa2 

Ana C Gales2 

Guilherme HC Furtado1 

1Grupo de Racionalização do Uso de Antimicrobianos, Departamento de Medicina, Universidade Federal de São Paulo, São Paulo, SP, Brasil

2Laboratório Alerta, Divisão de Doenças Infecciosas, Departamento de Medicina, Universidade Federal de São Paulo, São Paulo, SP, Brasil

Hypervirulent Klebsiella pneumoniae (hvKP) strains can cause invasive liver abscess syndrome, which is characterised by liver abscess with extrahepatic complications including central nervous system involvement, necrotising fasciitis or endophthalmitis (Siu et al. 2012). hvKP was first reported in Taiwan in 1985 and, since then, infections caused by hvKP have been described in several parts of the world, with many cases reported in Southeast Asia (Li et al. 2014). In the Americas, invasive liver abscess syndrome has been reported in the United States of America, Canada and Argentina (Siu et al. 2012). However, this strain has not been previously reported in Brazil. Recently, a 57-year-old woman with diabetes mellitus was admitted to the emergency department with a history of fever, nausea, vomiting and mental confusion for five days. On the day of admission, she was comatose, icteric and had a poor general appearance. Her temperature was 37.8°C and her blood pressure, pulse and respiratory rate were 110/60 mmHg, 96 beats/min and 48 breaths/min, respectively. Respiratory and cardiovascular auscultations were normal; however, a neurological examination revealed neck rigidity. Bacterial meningitis was suspected and ceftriaxone 2 g IV q12 h was empirically prescribed after performing a diagnostic lumbar puncture. Her cerebrospinal fluid (CSF) was xanthochromic and showed glucose 0.0 mg/dL, protein 485 mg/dL and 8,640 cells/mm3 (8,121 neutrophils/mm3 and 259 lymphocytes/mm3). Direct examination of her CSF revealed Gram-negative bacilli. At admission, she also had the following altered laboratory tests: glycaemia (264 mg/dL), serum creatinine (2.95 mg/dL), blood urea nitrogen (152 mg/dL), alkaline phosphatase (177 mg/dL), gamma-glutamyl transferase (138 mg/dL), alanine transaminase (50 mg/dL), aspartate transaminase (36 mg/dL), total bilirubin (0.59 mg/dL), indirect bilirubin (0.18 mg/dL), direct bilirubin (0.41 mg/dL) and international normalised ratio (1.19). Brain and multiple liver abscesses (segments IV, V and VIII) were detected through brain and abdominal computed tomography scans. K. pneumoniae grew on blood (A58300) and CSF (A58301) cultures and both isolates were susceptible to all antimicrobials tested using a BDPhoenix Automated System. The isolates were then submitted to the Alerta Laboratory, Federal University of São Paulo for further characterisation. After surgical drainage of the brain abscess and percutaneous drainage of the liver abscess, the patient’s clinical condition deteriorated; ceftriaxone was replaced by meropenem 2 g IV q8 h four days later. Eight days after admission, the patient developed ventilator-associated pneumonia and K. pneumoniae (also susceptible to all antibiotics tested) and multidrug-resistant Acinetobacter baumannii were isolated from semiquantitative tracheal aspirate cultures. Polymyxin B 1.125.000 UI IV q12 h was added to the meropenem. Fifteen days later, multidrug-resistant A. baumannii bacteraemia was detected despite the use of broad antimicrobial therapy; thus, ampicillin-sulbactam 3 g IV q6 h was added to the antimicrobial regimen. At 45 days after admission, the patient died due to septic shock and A. baumannii was again recovered from blood culture. The patient had no previous history of cholelithiasis, liver cirrhosis, malignancies or steroid or chemotherapy use. In addition, the patient had no history of international travel or known contact with Asian individuals.

At Alerta Laboratory, the identification and antimicrobial susceptibility profile of the K. pneumoniae strains were confirmed by MALDI-TOF and the agar dilution method. The minimum inhibitory concentration (MIC) results were typically interpreted according to the CLSI (2013); however, The European Committee on Antimicrobial Susceptibility Testing (Breakpoint tables for interpretation of MICs and zone diameters, v.4.0) were used for determining the MIC of polymyxin B. Both isolates showed susceptibility to all antimicrobials tested: amoxicillin-clavulanate (MIC ≤ 4/2 µg/mL), ceftazidime (MIC ≤ 0.25 µg/mL), cefepime (MIC ≤ 0.25 µg/mL), meropenem (MIC ≤ 0.06 µg/mL), imipenem (MIC ≤ 0.06 µg/mL), ertapenem (MIC ≤ 0.06 µg/mL), ciprofloxacin (MIC ≤ 0.06 µg/mL), amikacin (MIC 2 µg/mL), tigecycline (MIC 0.25 µg/mL), fosfomycin (MIC 16 µg/mL), piperacillin/tazobactam (MIC 4 µg/mL) and polymyxin B (MIC ≤ 0.125 µg/mL). The genetic similarity of the strains was evaluated by pulsed field gel electrophoresis (PFGE) and multilocus sequence typing techniques, as previously described (Tenover et al. 1995, Diancourt et al. 2005). Both strains exhibited identical PFGE patterns and were found to belong to ST23 (Tenover et al. 1995). Genomic DNA was extracted from both isolates (QIAamp DNA Mini Kit, Qiagen®) and virulence-encoding genes were detected by polymerase chain reaction (PCR) followed by DNA sequencing (Table). Both strains presented a hypermucoviscosity phenotype and possessed magA, rmpA, kfu and aerobactin genes. MagA is a mucoviscosity-associated gene that is related to the extensive production of a polysaccharide capsule and increased resistance to phagocytes. The rmpA gene increases capsular polysaccharide biosynthesis and mucoviscosity. The kfu gene encodes an iron-uptake system that is associated with a hypermucoviscosity phenotype and increased virulence (Ma et al. 2005, Hsu et al. 2011).


Factors evaluated Target gene Sequence (5’-3’) Annealing temperature (°C) Amplicom (pb) References
Mucoviscosity-associated gene A maga-F CCGATGGTTGGGTTAGCTTT 60 801 This paper
Regulator of mucoid phenotype rmpa-F AGTTAACTGGACTACCTCTGTTTC 60 543 This paper
Iron acquisition system kfu-F ATAGTAGGCGAGCACCGAGA 60 520 Yu et al. (2008)
Aerobactin Aero_1-F GCATAGGCGGATACGAACAT 60 556 Yu et al. (2008)
Aerobactin Aero_2-F CTGTCGGCATCGGTTTTATT 60 531 Yu et al. (2008)
Thermotolerance phenotype clpk-F GTTGTGCGACGACCATTACC 60 557 This paper

As described in this case report, the patient had the classical clinical and microbiological characteristics of community-acquired hvKP: liver abscess with metastatic infections (bacteraemia and meningitis) caused by K. pneumoniae displaying a hypermucoviscosity phenotype and belonging to capsular serotypes K1 and ST23, with the presence of the magA and rmpA genes (Chung et al. 2012, Siu et al. 2012). In addition, the patient was diabetic, a risk factor reported by Siu et al. (2012). This clinical case report is important for increasing awareness among Brazilian clinicians with regard to the fact that hvKP ST23 is already circulating in our region and causing serious infections in patients without any previous history of international travel to Asia.


Chung DR, Park MH, Kim SH, Ko KS, Kang CI, Peck KR, Song JH 2012. Prevalence and molecular characterization of serotype K1 Klebsiella pneumoniae strains from various clinical specimen sources in 11 Asian countries. J Infect 64: 622-625. [ Links ]

CLSI - Clinical and Laboratory Standard Institute 2013. Performance standards for antimicrobial susceptibility testing, Approved Standard M100-S23. Available from: file:///C:/Users/Cliente/Downloads/CLSI%202013%20M100-S23.pdf. [ Links ]

Diancourt L, Passet V, Verhoef J, Grimont PA, Brisse S 2005. Multilocus sequence typing of Klebsiella pneumoniae nosocomial isolates. J Clin Microbiol 43: 4178-4182. [ Links ]

Hsu CR, Lin TL, Chen YC, Chou HC, Wang JT 2011. The role of Klebsiella pneumoniae rmpA in capsular polysaccharide synthesis and virulence revisited. Microbiology 157: 3446-3457. [ Links ]

Li W, Sun G, Yu Y, Ning L, Chen M, Jin R, Jiao Y, Wu H 2014. Increasing occurrence of antimicrobial-resistant hypervirulent (hypermucoviscuous) Klebsiella pneumoniae isolates in China. Clin Infect Dis 58: 225-232. [ Links ]

Ma LC, Fang CT, Lee CZ, Shun CT, Wang JT 2005. Genomic heterogeneity in Klebsiella pneumoniae strains is associated with primary pyogenic liver abscess and metastatic infection. J Infect Dis 192: 117-128. [ Links ]

Siu LK, Yeh KM, Lin JC, Fung CP, Chang FY 2012. Klebsiella pneumoniae liver abscess: a new invasive syndrome. Lancet Infect Dis 12: 881-887. [ Links ]

Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, Swaminathan B 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 33: 2233-2239. [ Links ]

Yu WL, Ko WC, Cheng KC, Lee CC, Lai CC, Chuang YC 2008. Comparison of prevalence of virulence factors for Klebsiella pneumoniae liver abscesses between isolates with capsular K1/K2 and non-K1/K2 serotypes. Diagn Micr Infec Dis 62: 1-6. [ Links ]

Received: June 4, 2014; Accepted: September 8, 2014

+ Corresponding author:

RLC and MFV contributed equally to this work.

Creative Commons License This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License, which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.