Abstract
BACKGROUND
Dengue is a disease caused by dengue virus (DENV-1 through -4). Among the four serotypes, DENV-4 remains the least studied. Acute kidney injury is a potential complication of dengue generally associated with severe dengue infection.
OBJECTIVES
The goal of this study was to investigate the alterations caused by experimental dengue infection in the kidney of adult BALB/c mice.
METHODS
In this study, BALB/c mice were infected through the intravenous route with a DENV-4 strain, isolated from a human patient. The kidneys of the mice were procured and subject to histopathological and ultrastructural analysis.
FINDINGS
The presence of the viral antigen was confirmed through immunohistochemistry. Analysis of tissue sections revealed the presence of inflammatory cell infiltrate throughout the parenchyma. Glomerular enlargement was a common find. Necrosis of tubular cells and haemorrhage were also observed. Analysis of the kidney on a transmission electron microscope allowed a closer look into the necrotic tubular cells, which presented nuclei with condensed chromatin, and loss of cytoplasm.
MAIN CONCLUSIONS
Even though the kidney is probably not a primary target of dengue infection in mice, the inoculation of the virus in the blood appears to damage the renal tissue through local inflammation.
Key words:
DENV-4; BALB/c mice; kidney; histopathology; ultrastructure
Dengue is a tropical febrile disease transmitted by mosquitoes of the Aedes genus and caused by each of the four serotypes of the dengue virus (DENV-1,-2,-3 and-4).11. Martina BE, Koraka P, Osterhaus AD. Dengue virus pathogenesis: an integrated view. Clin Microbiol Rev. 2009; 22(4): 564-81. According to the World Health Organization (WHO), over 390 million infections occur every year, with 3.9 billion people living in areas with risk of transmission. The four serotypes circulate simultaneously in many countries, and, as of 2010, Brazil is listed among these countries, due to the reintroduction of DENV-4.22. WHO - World Health Organization. Dengue and severe dengue [homepage on the Internet]. [updated 2022 January 10; cited 2022 August 7]. Available from: https://www.who.int/news-room/fact-sheets/detail/dengue-and-severe-dengue.
https://www.who.int/news-room/fact-sheet...
,33. Temporão JG, Penna GO, Carmo EH, Coelho GE, Azevedo RSS, Nunes MRT, et al. Dengue virus serotype 4, Roraima State, Brazil. Emerg Infect Dis. 2011; 17(5): 938-40. While most cases of dengue remain mild or asymptomatic, one in twenty cases evolve to what is called severe dengue (SD), a condition closely associated with intense haemorrhage, plasma leakage and multiple organ impairment.44. Guzman MG, Gubler DJ, Izquierdo A, Martinez E, Halstead SB. Dengue infection. Nat Rev Dis Primers. 2016; 2: 16055.,55. CDC - Centers for Disease Control and Prevention. Dengue: symptoms and treatment. [updated 2021 September 20; cited 2022 August 28]. Available from: https://www.cdc.gov/dengue/symptoms/index.html.
https://www.cdc.gov/dengue/symptoms/inde...
Even though the liver is the most commonly affected organ,66. Póvoa TF, Alves AM, Oliveira CA, Nuovo GJ, Chagas VL, Paes MV. The pathology of severe dengue in multiple organs of human fatal cases: histopathology, ultrastructure and virus replication. PLoS One. 2014; 9(4): e83386.,77. Fernando S, Wijewickrama A, Gomes L, Punchihewa CT, Madusanka SD, Dissanayake H, et al. Patterns and causes of liver involvement in acute dengue infection. BMC Infect Dis. 2016; 16: 319. DENV has been shown to infect a wide range of biological tissues, such as the lungs,88. Cunha MDP, Duarte-Neto AN, Pour SZ, Hajjar LA, Frassetto FP, Dolhnikoff M, et al. Systemic dengue infection associated with a new dengue virus type 2 introduction in Brazil - a case report. BMC Infect Dis. 2021; 21(1): 311. the heart,99. Mansanguan C, Hanboonkunupakarn B, Muangnoicharoen S, Huntrup A, Poolcharoen A, Mansanguan S, et al. Cardiac evaluation in adults with dengue virus infection by serial echocardiography. BMC Infect Dis. 2021; 21(1): 940. the brain1010. Pandeya A, Upadhyay D, Oli B, Parajuli M, Silwal N, Shrestha A, et al. Dengue encephalitis featuring "double-doughnut" sign - A case report. Ann Med Surg (Lond). 2022; 78: 103939. and even the kidneys,1111. Arif A, Razzaque MRA, Kogut LM, Tebha SS, Shahid F, Essar MY. Expanded dengue syndrome presented with rhabdomyolysis, compartment syndrome, and acute kidney injury: a case report. Medicine (Baltimore). 2022; 101(7): e28865. among others.
Thus far, the alterations caused by DENV infection in the kidney remain largely unexplored, despite reports of signs and symptoms such as proteinuria, haematuria, glomerulonephritis, nephrotic syndrome and elevation of serum creatinine levels.1212. Lombardi R, Yu L, Younes-Ibrahim M, Schor N, Burdmann EA. Epidemiology of acute kidney injury in Latin America. Semin Nephrol. 2008; 28(4): 320-29.,1313. Oliveira JF, Burdmann EA. Dengue-associated acute kidney injury. Clin Kidney J. 2015; 8(6): 681-5.,1414. Begum F, Das S, Mukherjee D, Mal S, Ray U. Insight into the tropism of dengue virus in humans. Viruses. 2019; 11(12): 1136. More severe manifestations, such as acute kidney injury (AKI), rhabdomyolysis, glomerulonephritis, haemolytic uremic syndrome, and acute renal failure, are often associated to lethal cases of SD.1111. Arif A, Razzaque MRA, Kogut LM, Tebha SS, Shahid F, Essar MY. Expanded dengue syndrome presented with rhabdomyolysis, compartment syndrome, and acute kidney injury: a case report. Medicine (Baltimore). 2022; 101(7): e28865.,1515. Mehra N, Patel A, Abraham G, Reddy YN, Reddy YN. Acute kidney injury in dengue fever using Acute Kidney Injury Network criteria: incidence and risk factors. Trop Doct. 2012; 42(3): 160-2.,1616. Bignardi PR, Pinto GR, Boscarioli MLN, Lima RAA, Delfino VDA. Acute kidney injury associated with dengue virus infection: a review. J Bras Nefrol. 2022; 44(2): 232-7. Histopathological alterations described in renal tissue include congestion of the glomerular capillary, focal haemorrhage, oedema, inflammatory cell infiltration, hydropic degeneration, formation of micro abscesses, thrombus formation in the glomeruli, glomerular congestion and acute necrosis of proximal and distal tubules.66. Póvoa TF, Alves AM, Oliveira CA, Nuovo GJ, Chagas VL, Paes MV. The pathology of severe dengue in multiple organs of human fatal cases: histopathology, ultrastructure and virus replication. PLoS One. 2014; 9(4): e83386.,1717. Limonta D, Falcón V, Torres G, Capó V, Menéndez I, Rosario D, et al. Dengue virus identification by transmission electron microscopy and molecular methods in fatal dengue hemorrhagic fever. Infection. 2012; 40(6): 689-94.
18. Repizo LP, Malheiros DM, Yu L, Barros RT, Burdmann EA. Biopsy proven acute tubular necrosis due to rhabdomyolysis in a dengue fever patient: a case report and review of literature. Rev Inst Med Trop São Paulo. 2014; 56(1): 85-8.
19. Pagliari C, Quaresma JÁS, Kanashiro-Galo L, de Carvalho LV, Vitoria WO, da Silva WL, et al. Human kidney damage in fatal dengue hemorrhagic fever results of glomeruli injury mainly induced by IL17. J Clin Virol. 2016; 75: 16-20.
20. Ahsan J, Ahmad SQ, Rafi T. Postmortem findings in fatal dengue haemorrhagic fever. J Coll Physicians Surg Pak. 2018; 28(6): S137-9.
21. Nunes PCG, Rioja LDS, Coelho JMCO, Salomão NG, Rabelo K, José CC, et al. Renal injury in DENV-4 fatal cases: viremia, immune response and cytokine profile. Pathogens. 2019; 8(4): 223.-2222. Cunha MS, Coletti TM, Guerra JM, Ponce CC, Fernandes NCCA, Résio RA, et al. A fatal case of dengue hemorrhagic fever associated with dengue virus 4 (DENV-4) in Brazil: genomic and histopathological findings. Braz J Microbiol. 2022. 53(3): 1305-12. On an ultrastructural level, these necrotic tubular cells were shown to be undergoing pyknosis, with dilated endoplasmic reticulum.66. Póvoa TF, Alves AM, Oliveira CA, Nuovo GJ, Chagas VL, Paes MV. The pathology of severe dengue in multiple organs of human fatal cases: histopathology, ultrastructure and virus replication. PLoS One. 2014; 9(4): e83386. DENV like particles have already been directly observed in the kidney through transmission electron microscopy, suggesting viral infection.1717. Limonta D, Falcón V, Torres G, Capó V, Menéndez I, Rosario D, et al. Dengue virus identification by transmission electron microscopy and molecular methods in fatal dengue hemorrhagic fever. Infection. 2012; 40(6): 689-94. Viral antigens have also been previously detected in the kidney, in tubular cells,2323. Jessie K, Fong MY, Devi S, Lam SK, Wong KT. Localization of dengue virus in naturally infected human tissues, by immunohistochemistry and in situ hybridization. J Infect Dis. 2004; 189(8): 1411-8. in inflammatory cells,2424. Basílio-de-Oliveira CA, Aguiar GR, Baldanza MS, Barth OM, Eyer-Silva WA, Paes MV. Pathologic study of a fatal case of dengue-3 virus infection in Rio de Janeiro, Brazil. Braz J Infect Dis. 2005; 9(4): 341-7. in glomerular endothelial cells, in mesangial cells,2121. Nunes PCG, Rioja LDS, Coelho JMCO, Salomão NG, Rabelo K, José CC, et al. Renal injury in DENV-4 fatal cases: viremia, immune response and cytokine profile. Pathogens. 2019; 8(4): 223.,2222. Cunha MS, Coletti TM, Guerra JM, Ponce CC, Fernandes NCCA, Résio RA, et al. A fatal case of dengue hemorrhagic fever associated with dengue virus 4 (DENV-4) in Brazil: genomic and histopathological findings. Braz J Microbiol. 2022. 53(3): 1305-12. in hematopoietic cells2525. Bhoopat L, Bhamarapravati N, Attasiri C, Yoksarn S, Chaiwun B, Khunamornpong S, et al. Immunohistochemical characterization of a new monoclonal antibody reactive with dengue virus-infected cells in frozen tissue using immunoperoxidase technique. Asian Pac J Allergy Immunol. 1996; 14(2): 107-13. and in circulating macrophages and monocytes.66. Póvoa TF, Alves AM, Oliveira CA, Nuovo GJ, Chagas VL, Paes MV. The pathology of severe dengue in multiple organs of human fatal cases: histopathology, ultrastructure and virus replication. PLoS One. 2014; 9(4): e83386. Additionally, the detection of DENV RNA through molecular technique has been reported in kidney.88. Cunha MDP, Duarte-Neto AN, Pour SZ, Hajjar LA, Frassetto FP, Dolhnikoff M, et al. Systemic dengue infection associated with a new dengue virus type 2 introduction in Brazil - a case report. BMC Infect Dis. 2021; 21(1): 311.
AKI is a renal manifestation of dengue that is often reported in the literature. This condition is characterised by a sudden decrease of kidney function, which can culminate in death.1212. Lombardi R, Yu L, Younes-Ibrahim M, Schor N, Burdmann EA. Epidemiology of acute kidney injury in Latin America. Semin Nephrol. 2008; 28(4): 320-29. The severity of dengue increases the risk of AKI, with it being reported in 11.8% of patients with dengue with warning signs and in 28.6% of patients with SD.2626. Ismail J, Sankar J. Acute kidney injury in dengue - Not unprecedented. Indian J Pediatr. 2020; 87(12): 993-4. Around 10 to 20% of patients presenting dengue-induced AKI may require dialysis following the resolution of the disease.2727. Mallhi TH, Sarriff A, Adnan AS, Khan YH, Hamzah AA, Jummaat F, et al. Dengue-induced Acute Kidney Injury (DAKI): a neglected and fatal complication of dengue viral infection - a systematic review. J Coll Physicians Surg Pak. 2015; 25(11): 828-34. Despite this, dengue-induced AKI remains a poorly explored manifestation.2828. Tansir G, Gupta C, Mehta S, Kumar P, Soneja M, Biswas A. Expanded dengue syndrome in secondary dengue infection: a case of biopsy proven rhabdomyolysis induced acute kidney injury with intracranial and intraorbital bleeds. Intractable Rare Dis Res. 2017; 6(4): 314-8.,2929. Diptyanusa A, Phumratanaprapin W. Predictors and outcomes of dengue-associated acute kidney injury. Am J Trop Med Hyg. 2021; 105(1): 24-30.,3030. Eswarappa M, Reddy SB, John MM, Suryadevara S, Madhyashatha RP. Renal manifestations of dengue viral infection. Saudi J Kidney Dis Transpl. 2019; 30(2): 394-400. The histopathology of AKI is characterised by proximal and distal tubule necrosis, with lumen dilation, loss of the brush border, simplification of the tubular lining epithelium, and loss of nuclei.3131. Gaut JP, Liapis H. Acute kidney injury pathology and pathophysiology: a retrospective review. Clin Kidney J. 2020; 14(2): 526-36. Although the mechanisms that lead to AKI are not yet fully understood, its appearance is hypothesised to be due to a series of factors, such as the direct cytopathic viral action, cytokine induced haemodynamical alterations, deposition of antigen-antibody immune complexes, rhabdomyolysis, haemolysis and acute glomerular injury.1313. Oliveira JF, Burdmann EA. Dengue-associated acute kidney injury. Clin Kidney J. 2015; 8(6): 681-5.,1616. Bignardi PR, Pinto GR, Boscarioli MLN, Lima RAA, Delfino VDA. Acute kidney injury associated with dengue virus infection: a review. J Bras Nefrol. 2022; 44(2): 232-7.,2727. Mallhi TH, Sarriff A, Adnan AS, Khan YH, Hamzah AA, Jummaat F, et al. Dengue-induced Acute Kidney Injury (DAKI): a neglected and fatal complication of dengue viral infection - a systematic review. J Coll Physicians Surg Pak. 2015; 25(11): 828-34.,3232. Lima EQ, Nogueira ML. Viral hemorrhagic fever-induced acute kidney injury. Semin Nephrol. 2008; 28(4): 409-15.
Over the years, the BALB/c mouse has proven itself to be a useful animal model for dengue infection studies, replicating many aspects of the disease as it manifests in human cases. These animals not only present immune response against DENV, but also manifest histopathological alterations in liver, lung, heart, kidney, brain, spleen and skeletal muscle.3333. Paes MV, Pinhão AT, Barreto DF, Costa SM, Oliveira MP, Nogueira AC, et al. Liver injury and viremia in mice infected with dengue-2 virus. Virology. 2005; 338(2): 236-46.
34. Barreto DF, Takiya CM, Schatzmayr HG, Nogueira RMR, Farias-Filho JC, Barth OM. Histopathological and ultrastructural aspects of mice lungs experimentally infected with dengue virus serotype 2. Mem Inst Oswaldo Cruz. 2007; 102(2): 175-82.
35. França RF, Zucoloto S, da Fonseca BA. A BALB/c mouse model shows that liver involvement in dengue disease is immune-mediated. Exp Mol Pathol. 2010; 89(3): 321-6.
36. Salomão NG, Rabelo K, Póvoa TF, Alves AMB, da Costa SM, Gonçalves AJS, et al. BALB/c mice infected with DENV-2 strain 66985 by the intravenous route display injury in the central nervous system. Sci Rep. 2018; 8(1): 9754.
37. Jácome FC, Teixeira AL, Coutinho DD, Costa AD, Caldas GC, Nunes MA, et al. Secondary dengue infection in immunocompetent murine model leads to heart tissue damage. Acta Virol. 2019; 63(3): 292-300.
38. Amorim JFS, Azevedo AS, Costa SM, Trindade GF, Basílio-de-Oliveira CA, Gonçalves AJS, et al. Dengue infection in mice inoculated by the intracerebral route: neuropathological effects and identification of target cells for virus replication. Sci Rep. 2019; 9(1): 17926.
39. Byrne AB, García AG, Brahamian JM, Mauri A, Ferretti A, Polack FP, et al. A murine model of dengue virus infection in suckling C57BL/6 and BALB/c mice. Animal Model Exp Med. 2020; 4(1): 16-26.
40. Rasinhas AC, Jácome FC, Caldas GC, de Almeida ALT, da Silva MAN, de Souza DDC, et al. Morphological aspects and viremia analysis of BALB/c murine model experimentally infected with dengue virus serotype 4. Viruses. 2021; 13(10): 1954.
41. Jácome FC, Caldas GC, Rasinhas AC, de Almeida ALT, de Souza DDC, Paulino AC, et al. Immunocompetent mice infected by two lineages of dengue virus type 2: observations on the pathology of the lung, heart and skeletal muscle. Microorganisms. 2021; 9(12): 2536.
42. Jácome FC, Caldas GC, Rasinhas AC, de Almeida ALT, de Souza DDC, Paulino AC, et al. Comparative analysis of liver involvement caused by two DENV-2 lineages using an immunocompetent murine model. Sci Rep. 2021; 11(1): 9723.-4343. Kangussu LM, Costa VV, Olivon VC, Queiroz-Junior CM, Gondim ANS, Melo MB, et al. Dengue virus infection induces inflammation and oxidative stress on the heart. Heart. 2022; 108(5): 388-96. Furthermore, currently, DENV-4 remains the least studied serotype of DENV, with most studies focusing on serotype 2.4040. Rasinhas AC, Jácome FC, Caldas GC, de Almeida ALT, da Silva MAN, de Souza DDC, et al. Morphological aspects and viremia analysis of BALB/c murine model experimentally infected with dengue virus serotype 4. Viruses. 2021; 13(10): 1954. Since DENV-4 is known to cause milder cases of dengue,4444. Balmaseda A, Hammond SN, Pérez L, Tellez Y, Saborío SI, Mercado JC, et al. Serotype-specific differences in clinical manifestations of dengue. Am J Trop Med Hyg. 2006; 74(3): 449-56. it is unclear whether the kidney is a target organ for infection. While few studies focus on the renal manifestations caused by dengue in BALB/c mice, alterations such as an increase in glomerular volume and in mesangial cellularity, inflammatory cell infiltration, peritubular congestion, tubular necrosis, loss of brush border microvilli, cytoplasmic loss, glomerular atrophy and focal haemorrhage have been previously reported.4545. Barreto DF, Takiya CM, Paes MV, Farias-Filho J, Pinhão AT, Alves AM, et al. Histopathological aspects of dengue-2 virus infected mice tissues and complementary virus isolation. J Submicrosc Cytol Pathol. 2004; 36(2): 121-30.,4646. Jácome FC, Caldas GC, Rasinhas AC, de Almeida ALT, de Souza DDC, Paulino AC, et al. Brazilian dengue virus type 2-associated renal involvement in a murine model: outcomes after infection by two lineages of the Asian/American genotype. Pathogens. 2021; 10(9): 1084. The viral antigen has also been successfully detected in DENV-infected mouse kidney, in tubular epithelial cells and in endothelial cells.4646. Jácome FC, Caldas GC, Rasinhas AC, de Almeida ALT, de Souza DDC, Paulino AC, et al. Brazilian dengue virus type 2-associated renal involvement in a murine model: outcomes after infection by two lineages of the Asian/American genotype. Pathogens. 2021; 10(9): 1084.
Given the scarcity of data on AKI in humans and the lack of histopathological studies on kidney, this study aims to investigate the renal manifestations of dengue in BALB/c mice infected with DENV-4.
MATERIALS AND METHODS
Ethics statement - All the procedures performed during the course of this study were in compliance with the principles and regulations stablished by the Brazilian College of Animal Experimentation and previously approved by the Animal Ethics Committee of Instituto Oswaldo Cruz (IOC), Fundação Oswaldo Cruz (Fiocruz), under protocol number L-023/2018.
Viral strain - The DENV-4 strain BR2972/2013, isolated from a patient’s serum, was used in this study. Serotype was identified by real time quantitative polymerase chain reaction (RT-PCR)4747. Johnson BW, Russell BJ, Lanciotti RS. Serotype-specific detection of dengue viruses in a fourplex real-time reverse transcriptase PCR assay. J Clin Microbiol. 2005; 43(10): 4977-83. and by isolation into Aedes albopictus cell line (C6/36 cells; accession number: CRL-1660),4848. Igarashi A. Isolation of a singh's Aedes albopictus cell clone sensitive to dengue and Chikungunya viruses. J Gen Virol. 1978; 40(3): 531-44. performed by the Laboratório de Flavivirus, Fiocruz. A sample was kindly provided for use in this study.
Viral stock production - The viral stock was prepared by inoculating the DENV-4 strain BR2972/2013 into 175 cm2 culture cell flasks containing Ae. albopictus C6/36 cells4848. Igarashi A. Isolation of a singh's Aedes albopictus cell clone sensitive to dengue and Chikungunya viruses. J Gen Virol. 1978; 40(3): 531-44. at a concentration of 5x105 cells/mL. Briefly, for virus propagation, Ae. albopictus C6/36 cells were grown in Leibovitz medium (L-15, Sigma-Aldrich Corporation , USA) with 10% foetal bovine serum (FBS) (Gibco, Thermo Fisher Scientific Inc., USA) in an incubator at 28ºC. Prior to virus inoculation, L-15 medium was replaced, 2% foetal bovine serum was added and 100 μL of the DENV-4 strain was inoculated and incubated at 28ºC for five days. The virus was harvested by transferring all the flask supernatant to a 15 mL centrifuge tube, centrifuging for 10 min at 4000 x g at 4ºC. Supernatant aliquots were stored at -70ºC for titration. After three cell passages, the strain presented a viral titre of 109 TCID50/mL, and was used for experimental infection. The viral titre was calculated using the Reed Muench method.4949. Reed LJ, Muench H. A simple method of estimating fifty per cent endpoints. Am J Epidemiol. 1938; 27(3): 493-7.
Study design - For this study, thirty mice were used. Fifteen kidney samples were subject to analysis through bright field microscopy, with ten mice being infected with DENV-4 and five mice uninfected, used as mock-infected control. Another fifteen were subject to transmission electron microscopy analysis, following the same aforementioned criteria of ten infected and five uninfected, with one kidney destined to ultrastructural analysis, and the remaining kidney for qRT-PCR analysis.
Experimental infection - For experimental infection with DENV-4, two months-old male BALB/c mice, provided by the Instituto de Ciência e Tecnologia em Biomodelos, at Fiocruz, Rio de Janeiro, Brazil, were used. During the experimentation period, the mice were housed in the vivarium of Hélio and Peggy Pereira Pavilion, IOC, Fiocruz (biosafety level 2), and separated in groups of five per cage. Mice were inoculated through the caudal vein with 100 μL of the DENV-4 strain diluted in L-15 medium, which presented a viral titre of 10000 TCID50/0.1 mL. For the negative control, mice were inoculated with 100 μL of centrifuged C6/36 cell culture supernatant in L-15 culture medium (Sigma-Aldrich Corporation, USA). All the mice were euthanised 72 h post infection. Euthanasia was performed using a lethal dose of ketamine (150 mg/kg), xylazine (10 mg/kg) and tramadol (10 mg/kg), administered through the intraperitoneal route. Once the anaesthetic effect set in, the mice were subject to cervical dislocation and the organs were harvested.
Bright field microscopy - Following the organ harvest, the collected kidneys were placed on a glass plate, and sectioned along the sagittal plane, in two equal halves. Afterwards, the samples were and stored in a histological cassette, and placed in a container containing Millonig’s buffered formalin. Subsequently, the tissue was dehydrated in baths of increasing concentrations of ethanol, clarified in xylene and embedded in paraffin. Tissue sections 5 µm thick were obtained using a using a Leica 2025 microtome (Leica, Germany) and stained with haematoxylin and eosin. Finally, the stained glass slides were analysed on a bright field microscope (AxioHome, Zeiss, Germany).
Histomorphometry - Glomeruli count and glomerular area were measured on kidney samples of BALB/c mice. Ten glass slides containing kidney histological sections stained with H&E (Five from mice infected with DENV-4 and five from uninfected mice, of the mock-infected control group) were analysed on a bright field microscope (AxioHome, Zeiss, Germany). For each glass slide, 20 images of random areas were captured at 200 magnification using a coupled camera. For each image, all glomeruli were counted and had their area quantified using the open-source image analysis software ImageJ.
Statistical analysis - A database on the glomeruli count and glomerular area of infected and uninfected mice was created in Microsoft Excel and the mean of the values was calculated. The resulting data was analysed using the GraphPad Prism software version 8.0.1 and the SPSS Statistics software version 25. The Shapiro-Wilk test (p > 0.05) was used to assess the normality of data. The Student’s t-test was performed since the data followed a normal distribution and all results of p ≤ 0.05 were considered statistically significant.
Immunohistochemistry - Following deparaffinisation and rehydration, the kidney samples underwent antigen retrieval, while submerged in EnVision Flex target retrieval solution, high pH (Dako, USA), inside a pressure cooker. Afterwards, a solution of hydrogen peroxidase in methanol was used, to block endogenous peroxidase. Samples were incubated with either anti-NS3 antibody produced in rabbit (1:200), provided by the Laboratório de Biotecnologia e Bioengenharia Estrutural, of the Universidade Federal do Rio de Janeiro or anti-flavivirus envelope protein antibody produced in mouse (1:200), provided by the Laboratório de Flavivirus, IOC, Fiocruz. Finally, samples were incubated with anti-rabbit antibody horseradish peroxidase conjugate (Advanced Biosystems, USA). Reaction was revealed with diaminobenzidine (Scytek, USA) as chromogen and sections were counterstained with Harris’s haematoxylin (Dako, USA). A reaction control was performed using only the secondary horseradish peroxidase-conjugated antibody.
Transmission electron microscopy - Kidney samples were fixated in 3% glutaraldehyde in sodium cacodylate buffer 0.2 M, pH 7.2, stored at 4ºC and processed as described by Barreto-Vieira.5050. Barreto-Vieira DF, Barth-Schatzmayr OM, Schatzmayr HG. Modelo animal experimental para o estudo da patogênese dos vírus dengue sorotipos 1 e 2. Manual de técnicas. 1st ed. Rio de Janeiro: Interciência; 2010. The resulting resin blocks were sliced in ultrathin sections 50-70 nm thick with a Reichert-Jung Ultracut E ultramicrotome (Leica, Germany) and placed on copper grids. These sections were then analysed on a Hitachi HT 7800 transmission electron microscope (Hitachi, Japan).
Real time quantitative RT-PCR - For molecular analysis, kidneys were washed with phosphate buffered saline and store at -80ºC. The samples were macerated in L-15 culture medium (Invitrogen, USA) and centrifuged for fifteen minutes at 10000 rpm at 4ºC. Extraction was performed with 140 µL of kidney macerate supernatant, with the QIAmp Viral RNA mini kit (Qiagen, Germany), following the protocol described by the manufacturer. Amplification was performed using the SuperScript III Platinum One-Step Quantitative RT-PCR kit (Invitrogen Corporation, USA) according to the kit’s instructions, using the primers DENJ-4R (5’TCCACCTGAGACTCCTTCCA3’) and DENJ-4F (5’TTGTCCTAATGATGCTGGTCG3’), and probe DENJ-4P (6-FAM 5’TTCCTACTCCTACGCATCGATTCCG3’ BHQ-1).4747. Johnson BW, Russell BJ, Lanciotti RS. Serotype-specific detection of dengue viruses in a fourplex real-time reverse transcriptase PCR assay. J Clin Microbiol. 2005; 43(10): 4977-83. Reaction was performed in a 7500 Real-Time PCR System (Applied Biosystems, USA).
RESULTS
Histopathological, histomorphometrical and ultrastructural alterations - Mice of the mock-infected control group showed no signs of kidney injury. The glomeruli presented a regular aspect, with normal sized cells and well-defined parietal and visceral layers. Tubular cells also presented no histopathological alterations. Renal tubules had a healthy appearance, with well-preserved lumen and brush border (Fig. 1A-B). Mice infected with DENV-4, on the other hand, showed a noticeable decrease of the area of the Bowman’s Space, due to an apparent increase in the glomerular cellularity (Fig. 1C), oftentimes making it impossible to distinguish the visceral and parietal layers. In some kidney sections where the Bowman’s space was preserved, erythrocytes were observed within, between the layers of the capsule (Fig. 1D). Clear vacuoles were seen in the cytoplasm of tubular cells, some causing the lateralisation of the nucleus (Fig. 1C). The presence of inflammatory infiltrate was discrete, but ubiquitous, represented by small but noticeable clusters of inflammatory cells in the tubular interstice (Fig. 1C-D). Capillary oedema was also observed, although not a common find (Fig. 1D). Distal and proximal convoluted tubules going through different stages of necrosis were present in the tissue (Fig. 1E). Small haemorrhagic foci were present throughout the kidney, both in the medullar and cortical regions (Fig. 1E-F). Larger haemorrhagic areas were present only in the kidney of a mouse that tested positive for DENV-4 envelope protein (Fig. 2A). Blood was present not only in the tubular interstice (Fig. 2B), but also in the lumen of the thin part of the loop of Henle (Fig. 2C-D). The frequency of each histopathological finding is depicted in Table.
histological sections of BALB/c mice kidney stained with H&E (A, B: uninfected mice; C-F: DENV-4 infected mice). (A, B) Glomerulus (Glo); distal convoluted tubule (DCT); proximal convoluted tubule (PCT); Bowman’s space (Bw); Macula densa (MD). (C) Glomerulus presenting reduced Bowman’s space (dashed outline); tubular cells containing cytoplasmic vacuoles (Vac); inflammatory infiltrate (Inf). (D) Areas of interstitial haemorrhage (Hem); capillary oedema (Edm); erythrocytes in the Bowman’s space (Ery) of the glomerulus (Glo); inflammatory infiltrate (Inf). (E, F) Areas of interstitial haemorrhage (Hem); tubular necrosis (Ne); glomerulus (Glo). Magnification: (A, C, D) 200x; (B, E, F) 400x.
histological sections of DENV-4 infected BALB/c mice kidney stained with H&E. (A, B) Areas of interstitial haemorrhage (Hem); collecting duct (CD). (C, D) Thin part of the loop of Henle containing blood (LoH); collecting duct (CD). Magnification: (A) 100x; (B, C, D) 200x.
Frequency of histopathological alterations observed in the kidneys of BALB/c mice infected with dengue virus type 4 (DENV-4)
A statistically significant (p = 0.0451) decrease in the glomerular count per analysed kidney was observed in DENV-4 infected mice (Fig. 3A). Glomerular area was also smaller in DENV-4 infected mice, although this alteration was not statistically significant (Fig. 3B).
glomeruli count per analysed area (A) and mean area occupied by glomeruli (B) of negative control (NC) and DENV-4 infected (INF) BALB/c mice. *: p < 0.05.
Upon ultrastructural inspection, uninfected kidneys showed no morphological alterations, both in the tubular and in the glomerular structure. Glomerular integrity was well preserved, with a clear distinction of the Bowman’s space and its layers. (Fig. 4A-B). Analysis of the kidneys of mice infected with DENV-4 offered a closer look into the necrotic process of the tubular cells, which presented intense loss of cytoplasm and condensation of the chromatin within the nucleus, characteristic of pyknosis (Fig. 4C, E). Loss of the microvilli that forms the brush border of the proximal convoluted tubule was also observed (Fig. 4C). Vacuoles of unknown origin, smaller than the other described during bright field microscopy analysis, and filled with a substance unlike water or lipids, were observed inside cells of the distal convoluted tubule, more commonly present in the apical region of necrotic cells (Fig. 4D). In the glomeruli, Bowman’s space was reduced, seemingly due to an expansion of the mesangial matrix of mesangial cells. Capillary lumen was also noticeably reduced (Fig. 4F). Inflammatory cells were identified circulating in renal the capillaries and in the tubular interstice, and consisted mostly of lymphocytes (Fig. 5A) and neutrophils (Fig. 5B).
electron micrographs of BALB/c mice kidney sections (A, B: uninfected mice; C-F: DENV-4 infected mice). (A) Proximal convoluted tubule (PCT); microvilli (MV) that form the brush border; nucleus (Nuc); distal convoluted tubule (DCT); mitochondrion (Mit); endothelial cell (EC) that forms the capillary (Cap); erythrocytes (Ery). (B) Podocytes (Pod) that surround the glomerular capillaries (Cap); mesangial cell (MC); visceral layer (VL) and parietal layer (PL) of the Bowman’s space (Bw); erythrocytes (Ery). (C) Cells of the distal convoluted tubule (DCT) presenting loss of cytoplasm (*); nucleus (Nuc); proximal convoluted tubule (PCT) showing loss of microvilli (MV). (D) Vacuoles (Vac) of indistinct origin in the cytoplasm of a distal tubular cell; nucleus (Nuc); mitochondrion (Mit). (E) Cells of the distal convoluted tubule (DCT) presenting loss of cytoplasm (*) and pyknotic nucleus (red dashed outline); nucleus (Nuc). (F) Reduced Bowman’s space (Bw); podocytes (Pod); mesangial cells (MC) presenting expanded mesangial matrix (red arrow); erythrocytes (Ery). Magnification: (A, C) 1.200x; (B, E, F) 1.500x; (D) 2.500x.
electron micrographs of DENV-4 infected BALB/c mice kidney sections. (A) Lymphocyte (Lym) circulating in a capillary (Cap); erythrocyte (Ery). (B) Neutrophil (Neu) circulating in the capillary; erythrocyte (Ery). (Cap). Magnification: (A) 6.000x (B) 2.000x.
Antigen and viral genome detection - No immunostaining was observed in mice of the control group (Fig. 6A-B). Reaction control also did not show any immunostaining. While the NS3 antigen was not detected in any of the tested kidneys, the envelope protein was detected in the cortical region, in cells of the proximal convoluted tubule (Fig. 6C), in its lumen (Fig. 6E) and in the endothelium of capillaries (Fig. 6D). In the medullar region, immunostaining was observed in cells of the loop of Henle (Fig. 6F). The envelope protein was detected in four out of eight (50%) tested kidney samples. DENV-4 viral RNA was not detected in any of the mice kidneys tested through qRT-PCR.
histological sections of BALB/c mice kidney counterstained with Harris Haematoxylin (A, B: uninfected mice; C-F: DENV-4 infected mice) (A, B) Kidney sections showing no peroxidase reactive cells; glomerulus (G). (C) Envelope protein reactive tubular cell (arrow). (D) Envelope protein reactive endothelium (arrow). (E) Envelope protein reactive lumen (arrow) of the proximal convoluted tubule (P). (F) Envelope protein reactive cells of the loop of Henle (arrow). Magnification: (A, B) 200x; (C, D, E, F) 400x.
DISCUSSION
Overall, the results described in this study are in line with what is seen in human cases of dengue presenting renal manifestations. Histopathological alterations observed fit the descriptions of dengue-induced AKI published in the related literature,1313. Oliveira JF, Burdmann EA. Dengue-associated acute kidney injury. Clin Kidney J. 2015; 8(6): 681-5.,1616. Bignardi PR, Pinto GR, Boscarioli MLN, Lima RAA, Delfino VDA. Acute kidney injury associated with dengue virus infection: a review. J Bras Nefrol. 2022; 44(2): 232-7. albeit milder, and non-lethal.
Vascular alterations induced by DENV seem to be the main cause for acute tubular necrosis, due to a decrease in renal perfusion, which in turn leads to ischemia.5151. Gurugama P, Jayarajah U, Wanigasuriya K, Wijewickrama A, Perera J, Seneviratne SL. Renal manifestations of dengue virus infections. J Clin Virol. 2018; 101: 1-6. Rhabdomyolysis, a muscular manifestation of DENV infection, while seemingly unrelated to kidney injury, also plays a large role in the development of acute tubular necrosis during dengue. This condition is characterised by the necrosis of skeletal muscle cells, resulting in the release of proteins in the circulation. One of these proteins, myoglobin, is known to deposit in the renal tubules, causing tubular injury and tubular obstruction.1111. Arif A, Razzaque MRA, Kogut LM, Tebha SS, Shahid F, Essar MY. Expanded dengue syndrome presented with rhabdomyolysis, compartment syndrome, and acute kidney injury: a case report. Medicine (Baltimore). 2022; 101(7): e28865.,2828. Tansir G, Gupta C, Mehta S, Kumar P, Soneja M, Biswas A. Expanded dengue syndrome in secondary dengue infection: a case of biopsy proven rhabdomyolysis induced acute kidney injury with intracranial and intraorbital bleeds. Intractable Rare Dis Res. 2017; 6(4): 314-8. The loss of microvilli described here could represent the initial stages of proximal convoluted tubule necrosis, characterised by loss of the brush border.3131. Gaut JP, Liapis H. Acute kidney injury pathology and pathophysiology: a retrospective review. Clin Kidney J. 2020; 14(2): 526-36. Even though some tubular cells appeared to be undergoing necrosis, the process did not seem widespread, and could perhaps be self-limited, reversible even, following the resolution of the disease. The vacuoles observed in tubular cells of the cortical region through bright field microscopy, though remarkable, are not completely unusual, at least in male mice. Even if these vacuoles were not perceived in mice of the control group, their appearance is said to be benign, and not a major histopathological find.5252. U.S. Department of Health and Human Services. National toxicology program. NTP nonneoplasic lesion atlas. [updated 2014 October 23; cited 2022 August 31]. Available from: https://ntp.niehs.nih.gov/nnl/urinary/kidney/rtvac/index.htm.
https://ntp.niehs.nih.gov/nnl/urinary/ki...
The smaller unidentified vacuoles, however, were only observed through transmission electron microscopy, and could be a direct result of the necrosis of the cells, since they were only seen in necrotic cells, in cellular regions suffering from loss of cytoplasm.
While Póvoa et al.66. Póvoa TF, Alves AM, Oliveira CA, Nuovo GJ, Chagas VL, Paes MV. The pathology of severe dengue in multiple organs of human fatal cases: histopathology, ultrastructure and virus replication. PLoS One. 2014; 9(4): e83386. did not detect the viral NS3 antigen in the kidney of human fatal cases of dengue, nor the presence of viral RNA, they did observe antigens hypothesised to be either the envelope or the membrane proteins in monocytes and macrophages. Jessie et al.2323. Jessie K, Fong MY, Devi S, Lam SK, Wong KT. Localization of dengue virus in naturally infected human tissues, by immunohistochemistry and in situ hybridization. J Infect Dis. 2004; 189(8): 1411-8. have also detected DENV antigens in tubular cell epithelium, with the absence of viral RNA in the renal tissue. Both authors suggest that this could be due to these different cell types reabsorbing the circulating immune complexes, with the same happening during yellow fever infection.2323. Jessie K, Fong MY, Devi S, Lam SK, Wong KT. Localization of dengue virus in naturally infected human tissues, by immunohistochemistry and in situ hybridization. J Infect Dis. 2004; 189(8): 1411-8. The deposition of immune complexes has been described in the glomeruli of BALB/c mice5353. Boonpucknavig S, Vuttiviroj O, Boonpucknavig V. Infection of young adult mice with dengue virus type 2. Trans R Soc Trop Med Hyg. 1981; 75(5): 647-53. and the presence of glomerular immune complex deposits has been associated to mesangial cell hypertrophy, observed through transmission electron microscopy.5454. Lizarraga KJ, Nayer A. Dengue-associated kidney disease. J Nephropathol. 2014; 3(2): 57-62. Wiwanitkit5555. Wiwanitkit V. Immune complex: does it have a role in pathogenesis of renal failure in dengue infection? Ren Fail. 2005; 27(6): 803-4. has suggested that, due to the size difference between the dengue virus-immunoglobulin immune complex and the glomerular capillary ― the latter being much larger than the former ― entrapment of the immune complex in the glomerulus should not easily happen, unless there is a significant narrowing of the glomerular diameter, due to lesion or infection.
In this study, although DENV RNA was not detected in kidney, the envelope protein was present in tubular cells and tubular lumen, cells of the loop of Henle and endothelium wall, suggesting that viral antigen reabsorption is likely to happen in the tubular pathway, should immune complexes end up being filtered by the glomerulus. Endothelial cells, on the other hand, are known to play a major role in the pathogenesis of dengue.5656. Lien TS, Sun DS, Wu CY, Chang HH. Exposure to dengue envelope protein domain III induces Nlrp3 inflammasome-dependent endothelial dysfunction and hemorrhage in mice. Front Immunol. 2021; 12: 617251. Some authors have previously suggested that the envelope protein is capable of modifying the vascular permeability of the endothelium, either directly, altering the morphology of endothelial cells,5757. Basu A, Jain P, Sarkar P, Gangodkar S, Deshpande D, Ganti K, et al. Dengue virus infection of SK Hep1 cells: inhibition of in vitro angiogenesis and altered cytomorphology by expressed viral envelope glycoprotein. FEMS Immunol Med Microbiol. 2011; 62(2): 140-7. or through the infection of monocytes, which, in turn, contribute to viral replication and production of nitric oxide and cytokines, and, consequently, to an increase in endothelial permeability.5858. Castillo JA, Naranjo JS, Rojas M, Castaño D, Velilla PA. Role of monocytes in the pathogenesis of dengue. Arch Immunol Ther Exp (Warsz). 2019; 67(1): 27-40. Cytokines and chemokines are also known to damage the tissue, being secreted by macrophages and T lymphocytes during the attempt to contain the viral infection.5959. Fink J, Gu F, Vasudevan SG. Role of T cells, cytokines and antibody in dengue fever and dengue haemorrhagic fever. Rev Med Virol. 2006; 16(4): 263-75.,6060. Srikiatkhachorn A, Mathew A, Rothman AL. Immune-mediated cytokine storm and its role in severe dengue. Semin Immunopathol. 2017; 39(5): 563-74. The cytokines IL-17 and IL-18, in particular, seem to be widely expressed in the kidney during severe cases of dengue.1919. Pagliari C, Quaresma JÁS, Kanashiro-Galo L, de Carvalho LV, Vitoria WO, da Silva WL, et al. Human kidney damage in fatal dengue hemorrhagic fever results of glomeruli injury mainly induced by IL17. J Clin Virol. 2016; 75: 16-20. In a recent study, Oliveira et al.6161. Oliveira LLS, Alves FAV, Rabelo K, Moragas LJ, Mohana-Borges R, de Carvalho JJ, et al. Immunopathology of renal tissue in fatal cases of dengue in children. Pathogens. 2022; 11(12): 1543. successfully detected the NS3 antigen in the kidney of fatal dengue cases in children. The presence of the viral antigen in mesangial and endothelial cells of the glomerulus, and in monocytes and macrophages, suggests that viral infection and replication can occur in the kidney in severe cases of dengue.6161. Oliveira LLS, Alves FAV, Rabelo K, Moragas LJ, Mohana-Borges R, de Carvalho JJ, et al. Immunopathology of renal tissue in fatal cases of dengue in children. Pathogens. 2022; 11(12): 1543.
Also described in this study was the increased size of the glomeruli, better observed through transmission electron microscopy. This alteration is the result of the expansion of the mesangial matrix of mesangial cells, leading not only to a decrease in the area of the Bowman’s space, through where the glomerular filtrate flows, but also to the compression of the glomerular capillaries, possibly diminishing filtration rates, and facilitating the entrapment of immune complexes. Although the virus was not detected in kidney, the envelope protein was present. This could be a result of the circulation of the virus in the blood. Like Jácome et al.,4646. Jácome FC, Caldas GC, Rasinhas AC, de Almeida ALT, de Souza DDC, Paulino AC, et al. Brazilian dengue virus type 2-associated renal involvement in a murine model: outcomes after infection by two lineages of the Asian/American genotype. Pathogens. 2021; 10(9): 1084. we also observed a decrease in glomeruli count in each analysed kidney, suggesting the possibility of glomerular atrophy. Curiously, histomorphometrical data showed an actual decrease in glomerular area. While these results conflict with what was seen during histopathological and ultrastructural analysis, they were not statistically significant. Alterations in the kidney function are also linked to glomerular injury, and are often reported during dengue. These are associated to several biochemical imbalances, such as the increase of blood urea nitrogen and blood creatinine levels, both in BALB/c mice and in humans.66. Póvoa TF, Alves AM, Oliveira CA, Nuovo GJ, Chagas VL, Paes MV. The pathology of severe dengue in multiple organs of human fatal cases: histopathology, ultrastructure and virus replication. PLoS One. 2014; 9(4): e83386.,2727. Mallhi TH, Sarriff A, Adnan AS, Khan YH, Hamzah AA, Jummaat F, et al. Dengue-induced Acute Kidney Injury (DAKI): a neglected and fatal complication of dengue viral infection - a systematic review. J Coll Physicians Surg Pak. 2015; 25(11): 828-34.,4141. Jácome FC, Caldas GC, Rasinhas AC, de Almeida ALT, de Souza DDC, Paulino AC, et al. Immunocompetent mice infected by two lineages of dengue virus type 2: observations on the pathology of the lung, heart and skeletal muscle. Microorganisms. 2021; 9(12): 2536.,6262. Laoprasopwattana K, Pruekprasert P, Dissaneewate P, Geater A, Vachvanichsanong P. Outcome of dengue hemorrhagic fever-caused acute kidney injury in Thai children. J Pediatr. 2010; 157(2): 303-9.
Haemorrhage and vascular leakage are hallmarks of dengue and SD, probably induced by cytokines. TNFα, IL6 and IL8 are known to alter the vascular permeability of capillaries, triggering cases of vascular leakage in dengue.6363. Imad HA, Phumratanaprapin W, Phonrat B, Chotivanich K, Charunwatthana P, Muangnoicharoen S, et al. Cytokine expression in dengue fever and dengue hemorrhagic fever patients with bleeding and severe hepatitis. Am J Trop Med Hyg. 2020; 102(5): 943-50. The reduced blood flow to the kidney likely leads to an ischemic process, and is the reason for the necrosis of tubular cells.66. Póvoa TF, Alves AM, Oliveira CA, Nuovo GJ, Chagas VL, Paes MV. The pathology of severe dengue in multiple organs of human fatal cases: histopathology, ultrastructure and virus replication. PLoS One. 2014; 9(4): e83386. The presence of blood in later portions of the nephron suggests alterations in the kidney filtering capabilities. Furthermore, the increase of vascular permeability induced by DENV infection could also alter the filtration process, facilitating the passage of blood through the glomerular endothelium and onto the renal tubules. The areas of haemorrhage seen in the tubular interstice also indicate the occurrence of these haemodynamic alterations, reinforced by the presence of the viral antigen in the endothelial wall. Although blood was never directly observed in the urine of mice upon clinical inspection, the possibility of microscopic haematuria remains.6464. Rajan M, Geminiganesan S, Sankaranarayanan S, Padmanaban R, Selvam MP. Renal manifestations in children with dengue fever hospitalized in pediatric intensive care unit. Indian J Pediatr. 2020; 87(12): 1014-7. Larger haemorrhagic areas in kidneys positive for the envelope protein could indicate a correlation between the presence of the viral antigen and haemorrhage severity. An interesting perspective for a similar study would be the analysis of mice urine through urinalysis, to investigate the presence of proteinuria or haematuria.
The histopathological alterations observed in this study seemed much milder than those observed by Jácome et al.4646. Jácome FC, Caldas GC, Rasinhas AC, de Almeida ALT, de Souza DDC, Paulino AC, et al. Brazilian dengue virus type 2-associated renal involvement in a murine model: outcomes after infection by two lineages of the Asian/American genotype. Pathogens. 2021; 10(9): 1084. This could be due to the simple fact that DENV-4 causes a less severe disease, when compared to other DENV serotypes.4444. Balmaseda A, Hammond SN, Pérez L, Tellez Y, Saborío SI, Mercado JC, et al. Serotype-specific differences in clinical manifestations of dengue. Am J Trop Med Hyg. 2006; 74(3): 449-56. Another possibility is that the kidney is not a primary target of dengue infection in mice, at least not under normal circumstances. This is not to say that infection of the kidney does not happen, just that it is less likely during a primary DENV infection. Nonetheless, the inoculation of the virus in the blood is enough to cause damage to the renal tissue, either through the action of cytokines, of circulating immune complexes and/or due to vascular permeability alterations. In the end, as is with all topics surrounding the pathogenesis of dengue, much is yet to be uncovered.
ACKNOWLEDGEMENTS
To the IOC for providing us with its technology and facilities during the course of the research, the Laboratório de Flavivirus, IOC, Fiocruz, for providing the DENV-4 strain used in this study, and the Laboratório de Patologia, IOC, Fiocruz, for the support in sample processing and technical analysis.
REFERENCES
-
1Martina BE, Koraka P, Osterhaus AD. Dengue virus pathogenesis: an integrated view. Clin Microbiol Rev. 2009; 22(4): 564-81.
-
2WHO - World Health Organization. Dengue and severe dengue [homepage on the Internet]. [updated 2022 January 10; cited 2022 August 7]. Available from: https://www.who.int/news-room/fact-sheets/detail/dengue-and-severe-dengue
» https://www.who.int/news-room/fact-sheets/detail/dengue-and-severe-dengue -
3Temporão JG, Penna GO, Carmo EH, Coelho GE, Azevedo RSS, Nunes MRT, et al. Dengue virus serotype 4, Roraima State, Brazil. Emerg Infect Dis. 2011; 17(5): 938-40.
-
4Guzman MG, Gubler DJ, Izquierdo A, Martinez E, Halstead SB. Dengue infection. Nat Rev Dis Primers. 2016; 2: 16055.
-
5CDC - Centers for Disease Control and Prevention. Dengue: symptoms and treatment. [updated 2021 September 20; cited 2022 August 28]. Available from: https://www.cdc.gov/dengue/symptoms/index.html
» https://www.cdc.gov/dengue/symptoms/index.html -
6Póvoa TF, Alves AM, Oliveira CA, Nuovo GJ, Chagas VL, Paes MV. The pathology of severe dengue in multiple organs of human fatal cases: histopathology, ultrastructure and virus replication. PLoS One. 2014; 9(4): e83386.
-
7Fernando S, Wijewickrama A, Gomes L, Punchihewa CT, Madusanka SD, Dissanayake H, et al. Patterns and causes of liver involvement in acute dengue infection. BMC Infect Dis. 2016; 16: 319.
-
8Cunha MDP, Duarte-Neto AN, Pour SZ, Hajjar LA, Frassetto FP, Dolhnikoff M, et al. Systemic dengue infection associated with a new dengue virus type 2 introduction in Brazil - a case report. BMC Infect Dis. 2021; 21(1): 311.
-
9Mansanguan C, Hanboonkunupakarn B, Muangnoicharoen S, Huntrup A, Poolcharoen A, Mansanguan S, et al. Cardiac evaluation in adults with dengue virus infection by serial echocardiography. BMC Infect Dis. 2021; 21(1): 940.
-
10Pandeya A, Upadhyay D, Oli B, Parajuli M, Silwal N, Shrestha A, et al. Dengue encephalitis featuring "double-doughnut" sign - A case report. Ann Med Surg (Lond). 2022; 78: 103939.
-
11Arif A, Razzaque MRA, Kogut LM, Tebha SS, Shahid F, Essar MY. Expanded dengue syndrome presented with rhabdomyolysis, compartment syndrome, and acute kidney injury: a case report. Medicine (Baltimore). 2022; 101(7): e28865.
-
12Lombardi R, Yu L, Younes-Ibrahim M, Schor N, Burdmann EA. Epidemiology of acute kidney injury in Latin America. Semin Nephrol. 2008; 28(4): 320-29.
-
13Oliveira JF, Burdmann EA. Dengue-associated acute kidney injury. Clin Kidney J. 2015; 8(6): 681-5.
-
14Begum F, Das S, Mukherjee D, Mal S, Ray U. Insight into the tropism of dengue virus in humans. Viruses. 2019; 11(12): 1136.
-
15Mehra N, Patel A, Abraham G, Reddy YN, Reddy YN. Acute kidney injury in dengue fever using Acute Kidney Injury Network criteria: incidence and risk factors. Trop Doct. 2012; 42(3): 160-2.
-
16Bignardi PR, Pinto GR, Boscarioli MLN, Lima RAA, Delfino VDA. Acute kidney injury associated with dengue virus infection: a review. J Bras Nefrol. 2022; 44(2): 232-7.
-
17Limonta D, Falcón V, Torres G, Capó V, Menéndez I, Rosario D, et al. Dengue virus identification by transmission electron microscopy and molecular methods in fatal dengue hemorrhagic fever. Infection. 2012; 40(6): 689-94.
-
18Repizo LP, Malheiros DM, Yu L, Barros RT, Burdmann EA. Biopsy proven acute tubular necrosis due to rhabdomyolysis in a dengue fever patient: a case report and review of literature. Rev Inst Med Trop São Paulo. 2014; 56(1): 85-8.
-
19Pagliari C, Quaresma JÁS, Kanashiro-Galo L, de Carvalho LV, Vitoria WO, da Silva WL, et al. Human kidney damage in fatal dengue hemorrhagic fever results of glomeruli injury mainly induced by IL17. J Clin Virol. 2016; 75: 16-20.
-
20Ahsan J, Ahmad SQ, Rafi T. Postmortem findings in fatal dengue haemorrhagic fever. J Coll Physicians Surg Pak. 2018; 28(6): S137-9.
-
21Nunes PCG, Rioja LDS, Coelho JMCO, Salomão NG, Rabelo K, José CC, et al. Renal injury in DENV-4 fatal cases: viremia, immune response and cytokine profile. Pathogens. 2019; 8(4): 223.
-
22Cunha MS, Coletti TM, Guerra JM, Ponce CC, Fernandes NCCA, Résio RA, et al. A fatal case of dengue hemorrhagic fever associated with dengue virus 4 (DENV-4) in Brazil: genomic and histopathological findings. Braz J Microbiol. 2022. 53(3): 1305-12.
-
23Jessie K, Fong MY, Devi S, Lam SK, Wong KT. Localization of dengue virus in naturally infected human tissues, by immunohistochemistry and in situ hybridization. J Infect Dis. 2004; 189(8): 1411-8.
-
24Basílio-de-Oliveira CA, Aguiar GR, Baldanza MS, Barth OM, Eyer-Silva WA, Paes MV. Pathologic study of a fatal case of dengue-3 virus infection in Rio de Janeiro, Brazil. Braz J Infect Dis. 2005; 9(4): 341-7.
-
25Bhoopat L, Bhamarapravati N, Attasiri C, Yoksarn S, Chaiwun B, Khunamornpong S, et al. Immunohistochemical characterization of a new monoclonal antibody reactive with dengue virus-infected cells in frozen tissue using immunoperoxidase technique. Asian Pac J Allergy Immunol. 1996; 14(2): 107-13.
-
26Ismail J, Sankar J. Acute kidney injury in dengue - Not unprecedented. Indian J Pediatr. 2020; 87(12): 993-4.
-
27Mallhi TH, Sarriff A, Adnan AS, Khan YH, Hamzah AA, Jummaat F, et al. Dengue-induced Acute Kidney Injury (DAKI): a neglected and fatal complication of dengue viral infection - a systematic review. J Coll Physicians Surg Pak. 2015; 25(11): 828-34.
-
28Tansir G, Gupta C, Mehta S, Kumar P, Soneja M, Biswas A. Expanded dengue syndrome in secondary dengue infection: a case of biopsy proven rhabdomyolysis induced acute kidney injury with intracranial and intraorbital bleeds. Intractable Rare Dis Res. 2017; 6(4): 314-8.
-
29Diptyanusa A, Phumratanaprapin W. Predictors and outcomes of dengue-associated acute kidney injury. Am J Trop Med Hyg. 2021; 105(1): 24-30.
-
30Eswarappa M, Reddy SB, John MM, Suryadevara S, Madhyashatha RP. Renal manifestations of dengue viral infection. Saudi J Kidney Dis Transpl. 2019; 30(2): 394-400.
-
31Gaut JP, Liapis H. Acute kidney injury pathology and pathophysiology: a retrospective review. Clin Kidney J. 2020; 14(2): 526-36.
-
32Lima EQ, Nogueira ML. Viral hemorrhagic fever-induced acute kidney injury. Semin Nephrol. 2008; 28(4): 409-15.
-
33Paes MV, Pinhão AT, Barreto DF, Costa SM, Oliveira MP, Nogueira AC, et al. Liver injury and viremia in mice infected with dengue-2 virus. Virology. 2005; 338(2): 236-46.
-
34Barreto DF, Takiya CM, Schatzmayr HG, Nogueira RMR, Farias-Filho JC, Barth OM. Histopathological and ultrastructural aspects of mice lungs experimentally infected with dengue virus serotype 2. Mem Inst Oswaldo Cruz. 2007; 102(2): 175-82.
-
35França RF, Zucoloto S, da Fonseca BA. A BALB/c mouse model shows that liver involvement in dengue disease is immune-mediated. Exp Mol Pathol. 2010; 89(3): 321-6.
-
36Salomão NG, Rabelo K, Póvoa TF, Alves AMB, da Costa SM, Gonçalves AJS, et al. BALB/c mice infected with DENV-2 strain 66985 by the intravenous route display injury in the central nervous system. Sci Rep. 2018; 8(1): 9754.
-
37Jácome FC, Teixeira AL, Coutinho DD, Costa AD, Caldas GC, Nunes MA, et al. Secondary dengue infection in immunocompetent murine model leads to heart tissue damage. Acta Virol. 2019; 63(3): 292-300.
-
38Amorim JFS, Azevedo AS, Costa SM, Trindade GF, Basílio-de-Oliveira CA, Gonçalves AJS, et al. Dengue infection in mice inoculated by the intracerebral route: neuropathological effects and identification of target cells for virus replication. Sci Rep. 2019; 9(1): 17926.
-
39Byrne AB, García AG, Brahamian JM, Mauri A, Ferretti A, Polack FP, et al. A murine model of dengue virus infection in suckling C57BL/6 and BALB/c mice. Animal Model Exp Med. 2020; 4(1): 16-26.
-
40Rasinhas AC, Jácome FC, Caldas GC, de Almeida ALT, da Silva MAN, de Souza DDC, et al. Morphological aspects and viremia analysis of BALB/c murine model experimentally infected with dengue virus serotype 4. Viruses. 2021; 13(10): 1954.
-
41Jácome FC, Caldas GC, Rasinhas AC, de Almeida ALT, de Souza DDC, Paulino AC, et al. Immunocompetent mice infected by two lineages of dengue virus type 2: observations on the pathology of the lung, heart and skeletal muscle. Microorganisms. 2021; 9(12): 2536.
-
42Jácome FC, Caldas GC, Rasinhas AC, de Almeida ALT, de Souza DDC, Paulino AC, et al. Comparative analysis of liver involvement caused by two DENV-2 lineages using an immunocompetent murine model. Sci Rep. 2021; 11(1): 9723.
-
43Kangussu LM, Costa VV, Olivon VC, Queiroz-Junior CM, Gondim ANS, Melo MB, et al. Dengue virus infection induces inflammation and oxidative stress on the heart. Heart. 2022; 108(5): 388-96.
-
44Balmaseda A, Hammond SN, Pérez L, Tellez Y, Saborío SI, Mercado JC, et al. Serotype-specific differences in clinical manifestations of dengue. Am J Trop Med Hyg. 2006; 74(3): 449-56.
-
45Barreto DF, Takiya CM, Paes MV, Farias-Filho J, Pinhão AT, Alves AM, et al. Histopathological aspects of dengue-2 virus infected mice tissues and complementary virus isolation. J Submicrosc Cytol Pathol. 2004; 36(2): 121-30.
-
46Jácome FC, Caldas GC, Rasinhas AC, de Almeida ALT, de Souza DDC, Paulino AC, et al. Brazilian dengue virus type 2-associated renal involvement in a murine model: outcomes after infection by two lineages of the Asian/American genotype. Pathogens. 2021; 10(9): 1084.
-
47Johnson BW, Russell BJ, Lanciotti RS. Serotype-specific detection of dengue viruses in a fourplex real-time reverse transcriptase PCR assay. J Clin Microbiol. 2005; 43(10): 4977-83.
-
48Igarashi A. Isolation of a singh's Aedes albopictus cell clone sensitive to dengue and Chikungunya viruses. J Gen Virol. 1978; 40(3): 531-44.
-
49Reed LJ, Muench H. A simple method of estimating fifty per cent endpoints. Am J Epidemiol. 1938; 27(3): 493-7.
-
50Barreto-Vieira DF, Barth-Schatzmayr OM, Schatzmayr HG. Modelo animal experimental para o estudo da patogênese dos vírus dengue sorotipos 1 e 2. Manual de técnicas. 1st ed. Rio de Janeiro: Interciência; 2010.
-
51Gurugama P, Jayarajah U, Wanigasuriya K, Wijewickrama A, Perera J, Seneviratne SL. Renal manifestations of dengue virus infections. J Clin Virol. 2018; 101: 1-6.
-
52U.S. Department of Health and Human Services. National toxicology program. NTP nonneoplasic lesion atlas. [updated 2014 October 23; cited 2022 August 31]. Available from: https://ntp.niehs.nih.gov/nnl/urinary/kidney/rtvac/index.htm
» https://ntp.niehs.nih.gov/nnl/urinary/kidney/rtvac/index.htm -
53Boonpucknavig S, Vuttiviroj O, Boonpucknavig V. Infection of young adult mice with dengue virus type 2. Trans R Soc Trop Med Hyg. 1981; 75(5): 647-53.
-
54Lizarraga KJ, Nayer A. Dengue-associated kidney disease. J Nephropathol. 2014; 3(2): 57-62.
-
55Wiwanitkit V. Immune complex: does it have a role in pathogenesis of renal failure in dengue infection? Ren Fail. 2005; 27(6): 803-4.
-
56Lien TS, Sun DS, Wu CY, Chang HH. Exposure to dengue envelope protein domain III induces Nlrp3 inflammasome-dependent endothelial dysfunction and hemorrhage in mice. Front Immunol. 2021; 12: 617251.
-
57Basu A, Jain P, Sarkar P, Gangodkar S, Deshpande D, Ganti K, et al. Dengue virus infection of SK Hep1 cells: inhibition of in vitro angiogenesis and altered cytomorphology by expressed viral envelope glycoprotein. FEMS Immunol Med Microbiol. 2011; 62(2): 140-7.
-
58Castillo JA, Naranjo JS, Rojas M, Castaño D, Velilla PA. Role of monocytes in the pathogenesis of dengue. Arch Immunol Ther Exp (Warsz). 2019; 67(1): 27-40.
-
59Fink J, Gu F, Vasudevan SG. Role of T cells, cytokines and antibody in dengue fever and dengue haemorrhagic fever. Rev Med Virol. 2006; 16(4): 263-75.
-
60Srikiatkhachorn A, Mathew A, Rothman AL. Immune-mediated cytokine storm and its role in severe dengue. Semin Immunopathol. 2017; 39(5): 563-74.
-
61Oliveira LLS, Alves FAV, Rabelo K, Moragas LJ, Mohana-Borges R, de Carvalho JJ, et al. Immunopathology of renal tissue in fatal cases of dengue in children. Pathogens. 2022; 11(12): 1543.
-
62Laoprasopwattana K, Pruekprasert P, Dissaneewate P, Geater A, Vachvanichsanong P. Outcome of dengue hemorrhagic fever-caused acute kidney injury in Thai children. J Pediatr. 2010; 157(2): 303-9.
-
63Imad HA, Phumratanaprapin W, Phonrat B, Chotivanich K, Charunwatthana P, Muangnoicharoen S, et al. Cytokine expression in dengue fever and dengue hemorrhagic fever patients with bleeding and severe hepatitis. Am J Trop Med Hyg. 2020; 102(5): 943-50.
-
64Rajan M, Geminiganesan S, Sankaranarayanan S, Padmanaban R, Selvam MP. Renal manifestations in children with dengue fever hospitalized in pediatric intensive care unit. Indian J Pediatr. 2020; 87(12): 1014-7.
-
Financial support: This study was supported by Laboratório de Morfologia e Morfogênese Viral, IOC, Fiocruz, FIOTEC to Debora Ferreira Barreto Vieira [grant number IOC-023-FIO-18-2-58], FAPERJ to Flavia Barreto dos Santos [grant number E-26/202.003/2016], CNPq to Flavia Barreto dos Santos [grant number 302462/2018-0], CAPES and CNPq for the student fellowships.
Publication Dates
-
Publication in this collection
08 May 2023 -
Date of issue
2023
History
-
Received
06 Nov 2022 -
Accepted
07 Mar 2023