SciELO - Scientific Electronic Library Online

 
vol.29 issue2Spatial variability of soil physical properties on an experimental plotIsolation and identification of rhizoctonia-like mycorrhizal fungi associated to three neotropical epiphytic orchid species in Brazil author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

Share


Revista Brasileira de Ciência do Solo

On-line version ISSN 1806-9657

Rev. Bras. Ciênc. Solo vol.29 no.2 Viçosa May/Apr. 2005

http://dx.doi.org/10.1590/S0100-06832005000200003 

SEÇÃO III - BIOLOGIA DO SOLO

 

Ocorrência e diversidade de bactérias diazotróficas associadas a gramíneas forrageiras do Pantanal Sul Matogrossense1

 

Occurrence and diversity of diazotrophic bacteria associated to forage grasses of the Pantanal in the state of Mato Grosso do Sul

 

 

Marivaine da Silva BrasilI; José Ivo BaldaniII; Vera Lucia Divan BaldaniII

IDoutora em Fitotecnia pela Universidade Federal Rural do Rio de Janeiro. Rod. BR 465 Km 07, CEP 23851-970 Rio de Janeiro (RJ). E-mail: marivaine@yahoo.com
IIPesquisador da Embrapa Agrobiologia. Rod. BR 465 Km 07, CEP 23851-970 Rio de Janeiro (RJ). E-mail. ibadani@cnpab.embrapa.br; vera@cnpab.embrapa.br

 

 


RESUMO

Este trabalho teve por objetivo avaliar a ocorrência e a diversidade genética de bactérias fixadoras de N2 associadas às gramíneas nativas Elyonurus muticus (capim carona) e Axonopus purpusii (capim mimoso) e à gramínea exótica Brachiaria humidicola (braquiária) que formam as pastagens na região da Nhecolândia. As coletas das plantas e solo foram feitas nos períodos de seca e de cheia para determinar a população de bactérias diazotróficas. Identificaram-se Azospirillum brasilense, A. lipoferum, A. amazonense, Herbaspirillum spp., Burkholderia spp. em amostras de solo, raízes e folhas das três espécies forrageiras. As populações dessas bactérias foram menores na época da cheia em comparação com a época da seca. A diversidade genética das bactérias isoladas foi avaliada por meio da técnica de análise de restrição do DNA ribossomal amplificado (ARDRA). Os isolados foram divididos em cinco grupos genotípicos distintos. Os isolados de A. brasilense e A. lipoferum apresentaram cerca de 50 % de similaridade, enquanto A. amazonense formou um grupo a parte, com apenas 25 % de similaridade em relação ao grupo das espécies do gênero. As bactérias do gênero Herbaspirillum formaram um grupo isolado com apenas 25 % de similaridade em relação ao gênero Azospirillum. O quinto grupo foi formado por apenas um isolado com 25 % de similaridade em relação aos demais.

Termos de indexação: fixação biológica de nitrogênio, Azospirillum, ARDRA.


SUMMARY

This study was carried out to verify the occurrence and genetic diversity of diazotrophic bacteria associated to the native graminaceus plants Elyonurus muticus (Carona grass) and Axonopus purpusii (Mimoso grass) and the exotic Brachiaria humidicola (Brachiaria) that form the pastures in the Nhecolândia region of the Pantanal in the state of Mato Grosso do Sul, Brazil. The plants were harvested in the dry and rainy seasons and the diazotrophic bacteria populations in the soil and on roots and leaves of the three grasses were determined. Strains belonging to the species Azospirillum brasilense, A. lipoferum, A. amazonense; Herbaspirillum spp., and Burkholderia spp. were isolated. The number of diazotrophic bacteria associated to the three forage grass species during the rainy season was smaller than in the dry season. Genetic diversity in the isolated bacteria was studied by amplified rDNA restriction analysis (ARDRA) using the amplified 16S rDNA region. The isolates were divided into five different genotype groups. A. brasilense and A. lipoferum presented 50 % similarity while A. amazonense was included in another group with 25 % similarity to other species of the genus. The bacteria of genus Herbaspirillum formed a separate group with only 25 % similarity to genus Azospirillum. The fifth group consisted of only one isolate with 25 % similarity to the other groups.

Index terms: Biological Nitrogen Fixation, Azospirillum, ARDRA.


 

 

INTRODUÇÃO

A região do Pantanal Matogrossense corresponde a uma extensa planície inundável da região Centro-Oeste do Brasil com aproximadamente 139.000 km2 (Sudeco, 1978), caracterizada por enchentes cíclicas. Essa inundação é o fenômeno ecológico mais importante e que caracteriza o Pantanal como um macroecossistema peculiar, sendo dividido, tradicionalmente, em sub-regiões em virtude do regime de inundação local, relevo e cobertura vegetal. (Adámoli, 1982). Os pulsos de inundações podem ser provocados por oscilações do nível da água do rio, distribuições das chuvas locais e profundidade do lençol freático, dentre outras razões. Segundo Junk & Da Silva (1995), a inundação é importante para muitos aspectos ecológicos nas áreas sob alagamento, pois aumenta a diversidade de organismos e o nível de fertilidade do solo.

A principal atividade sócio-econômica desenvolvida no Pantanal é a pecuária de corte, desenvolvida de maneira extensiva, com a alimentação do rebanho constituída, principalmente, de pastagens de gramíneas nativas ou exóticas, como as braquiárias. No entanto, não se faz, normalmente, uso de insumos agrícolas, principalmente de fertilizantes nitrogenados, no cultivo dessas pastagens. Em agroecossistema pastoril, a fixação biológica de N2 (FBN) associada a plantas forrageiras é uma etapa importante no ciclo do N, visto que bactérias diazotróficas podem contribuir no suprimento de parte do N necessário às plantas (Chalk, 1991). As bactérias diazotróficas pertencentes aos gêneros Azospirillum, Herbaspirillum e Burkholderia, dentre outras, poderiam ser as responsáveis pela entrada de N nos agroecossistemas do Pantanal. Entretanto, pouco se conhece sobre a incorporação de N proveniente da associação das bactérias diazotróficas com as forrageiras da região do Pantanal.

Trabalhos de pesquisas realizadas nas décadas de 60 a 80 evidenciaram a contribuição considerável da FBN para a nutrição nitrogenada de algumas gramíneas forrageiras. Pelo uso da técnica de diluição isotópica de N15, Boddey et al. (1983) demonstraram que a gramínea Paspalum notatum cv. batatais obteve 10 % de seu N (20 kg ha-1 ano-1 ) via FBN. Boddey & Victoria (1986), usando essa mesma técnica, observaram que Brachiaria humidicola e B. decumbens obtiveram 30 a 40 % de N via FBN. Estes percentuais correspondem a 30 e 45 kg ha-1 ano-1 de N, respectivamente.

Na década de 90, praticamente não houve estudos para avaliar a contribuição da FBN em gramíneas forrageiras. Todavia, bactérias dos gêneros Azospirillum e Herbaspirillum foram isoladas do interior de raízes de diversas gramíneas forrageiras, tais como: Pennisetum purpureum, Miscanthus sinensis, Miscanthus sacchariflorus e Spartina pectinata (Kirchhof et al., 1997). Reis Junior (2002) salienta a necessidade de retomar as pesquisas com FBN em gramíneas forrageiras, principalmente na área de diversidade de bactérias diazotróficas associadas a essas plantas, porque novas bactérias podem ser encontradas e seu potencial de FBN explorado.

O presente trabalho objetivou isolar e caracterizar a diversidade de bactérias diazotróficas associadas às gramíneas Elyonurus muticus, Axonopus purpusii e Brachiaria humidicola crescidas na região do Pantanal do Mato Grosso do Sul, proporcionando informações preliminares sobre a comunidade nativa dessas bactérias na região.

 

MATERIAL E MÉTODOS

Área de estudo e espécies de plantas

O estudo foi realizado na Fazenda Nhumirim, pertencente à Embrapa Pantanal, situada na sub-região da Nhecolândia do Pantanal Sul Matogros-sense, tendo como coordenadas geográficas 18 º 59 ' S de latitude e 56 º 39 ' W de longitude, ocupando uma área de 4.310 ha. O solo é predominantemente do tipo Espodossolo Ferrocárbico Hidromórfico arênico (Embrapa, 1999), que contém, em média, 0,5 % de matéria orgânica e 2 % de argila.

Foram selecionadas três espécies forrageiras normalmente cultivadas em pastagens na área de estudo: Axonopus purpusii (capim mimoso), Elyonurus muticus (capim carona) e Brachiaria humidicola (braquiária). Foram coletadas, de cada espécie forrageira, amostras de 12 plantas em torrões de solo aderidos ás raízes. As coletas foram realizadas nas épocas de chuva e cheia (outubro a abril de 1999) e de seca (maio a setembro de 2000) do Pantanal. As amostras foram acondicionadas em caixa de isopor e transportadas, por via aérea, para o Laboratório de Gramíneas da Embrapa Agrobiologia em Seropédica (RJ).

Contagem e isolamento de bactérias diazotróficas

Vinte quatro horas após a coleta, foram preparadas amostras compostas das plantas de cada espécie no laboratório de Gramíneas da Embrapa Agrobiologia (três repetições de cada). Em seguida, as amostras foram separadas em subamostras para análise da população de bactérias diazotróficas nas folhas, raízes e solo. Parte das raízes foi lavada em água corrente e parte foi desinfestada com cloramina-T 1 % por 5 min. O método utilizado para a contagem de bactérias diazotróficas foi o Número Mais Provável (NMP), conforme descrito por Döbereiner et al. (1995). Foram usados 10 g de cada subamostra, a qual foi diluída seriadamente em solução salina (sais do meio NFb), sendo 0,1 mL de cada diluição inoculado em vidros de penicilina de 12 mL que continham 5 mL de meios de cultura semi-sólidos usados para contagem e isolamento das bactérias diazotróficas, conforme descrito por Döbereiner et al. (1995). O isolamento de estirpes de Azospirillum lipoferum e Azospirillum brasilense foi realizado em meio NFb, enquanto Azospirillum amazonense foi isolado em meio LGI. Já as estirpes de Herbaspirillum spp. foram isoladas em meio JNFb e a de Burkholderia spp. em meio JMV. Foram utilizados três frascos por diluição, os quais foram incubados a 30 ºC por cinco dias. Após esse período, foi feita a contagem das bactérias nas amostras, baseando-se na presença de película característica (em forma de véu) de bactérias diazotróficas, nos meios de cultura. A tabela de McCrady (Döbereiner et al., 1995) foi usada para determinar, pelo método estatístico, a população de bactérias presente nas amostras.

O isolamento de bactérias diazotróficas foi realizado após a contagem, utilizando-se os frascos com películas das maiores diluições seriadas. As películas foram repicadas para novos meios semi-sólidos semi-específicos (NFb, LGI, JNFb e JMV) com ajuda de alça de platina e incubadas por três dias a 30 ºC. Após a incubação por três dias, os frascos que apresentaram a película característica foram riscados em placas que continham os meios sólidos, usando os mesmos meios de cultura inicialmente usados para a contagem: NFb, NFb (com 3X a concentração do corante para o isolamento de Herbaspirillum spp. que acumulam o corante em suas colônias), LGI, JNFb e JMV.

As colônias crescidas nesses meios foram comparadas com as colônias de estirpes tipo de A. brasilense (BR 11001T), A. lipoferum (BR 11080T), A. amazonense (BR 11140T), Herbaspirillum seropedicae (BR 11175T) e de referência de Burkholderia brasilensis (BR 11340). No texto, as estirpes tipo foram denominadas Sp7, Sp59, Y2, Z67 e M130, respectivamente. Colônias semelhantes às estirpes tipo foram novamente repicadas para novos meios semi-sólidos supradescritos. Colônias diferentes foram repicadas em todos os meios semi-sólidos para verificar o caráter diazotrófico dessas bactérias em outro meio de cultivo.

A purificação final das culturas de Azospirillum spp. e Herbaspirillum spp. foi realizada em meio Batata (Döbereiner et al., 1995), enquanto, para Burkholderia, utilizou-se o mesmo meio do isolamento (JMV). Nessa etapa, as características morfológicas das colônias obtidas foram comparadas com as estirpes tipo. Assim, as colônias idênticas às estirpes tipo foram novamente repicadas para novos meios semi-sólidos para serem examinadas ao microscópio ótico (motilidade, tamanho de célula). Após isolamento e purificação, os isolados foram estocados.

A estocagem dos isolados caracterizados como pertencentes às espécies A. brasilense, A lipoferum e Herbaspirillum spp foi feita em meio Batata. No caso de A. amazonense e Burkholderia, a estocagem foi feita nos próprios meios de cultivo sólidos (LGI e JMV, respectivamente). As colônias puras dos isolados também foram estocadas em microtubos tipo "ependorf" que continham 0,6 mL de água estéril.

Avaliação da diversidade genética de bactérias diazotróficas

Foram utilizadas somente bactérias com características morfológicas semelhantes às das quatro primeiras estirpes tipo já citadas na avaliação da diversidade genética das bactérias diazotróficas isoladas das três espécies de gramíneas. Foram escolhidos de um a três isolados de cada região da planta amostrada para cada espécie forrageira. Os isolados bacterianos com características similares a "Burkholderia brasilensis" não foram analisados geneticamente, considerando o baixo número de isolados representativos das plantas em estudo.

Extração de DNA dos isolados de bactérias diazotróficas

O método utilizado para extração do DNA das células dos isolados bacterianos foi o de lise alcalina das células, adaptando-se os métodos propostos por Wang et al. (1993) e Audy et al. (1996).

As bactérias foram crescidas por 48 h em meio Dygs (Rodrigues Neto et al., 1986) líquido e 1 mL dessa suspensão foi centrifugado a 8.000 x g/2 min. O sobrenadante foi descartado e o precipitado foi ressuspenso em 1 mL de água tipo Milli-Q estéril. Esse procedimento foi repetido três vezes, e, na última lavagem, o precipitado foi ressuspenso em 0,5 mL de solução de NaOH 0,5 mol L-1 e deixado em repouso, por 10 min, para a completa lise das células. Em seguida, 10 µL do material lisado foram coletados e dissolvidos em 490 µL de solução de Tris-HCl 20 mol L-1 (pH 8,0). Essa solução foi dividida em quatro microtubos tipo ependorf, de onde se retiraram 10 µL da suspensão para a reação de amplificação de DNA pela técnica de PCR.

Amplificação da região 16S DNAr

A reação de amplificação ocorreu em 50 µL de uma mistura que continha de 1,25 µL de Tween 20, 5,0 µL de Tampão de reação (10X), 4,0 µL de MgCl2 (25 mol L-1 m), 1,0 µL de dNTP (2,5 mol L-1), 1,25 µL (5,0 pmol) dos Primers Y1 (5'-TGGCTCAGAACGAACGCTGGCGGC – 3') e Y3 (5'–CTAGACCCCACTTCAGCATTGTTCCAT–3'), descritos por Young et al. (1991), 0,20 µL de Taq DNA Polimerase (5 U/µL) (GibcoBRL, Gaithersburg, EUA), e 10 µL de amostra de DNA molde. As condições de termociclagem foram: 1 ciclo inicial de desnaturação (93 °C por 2 min), seguido por 35 ciclos intermediários (93 °C por 45 seg, 62 °C por 45 seg; 72 °C por 2 min) e 1 ciclo final a 72 °C por 5 min. Os fragmentos amplificados foram separados por eletroforese em gel de agarose 1,2 % em tampão de corrida TAE 1X a 65V por 2 h e 30 min. As bandas separadas no gel foram visualizadas após coloração com brometo de etídeo sob iluminação ultravioleta e fotografadas com filme Polaroid tipo 667.

Restrição dos Fragmentos 16S amplificados (ARDRA)

Os produtos de amplificação da região 16S DNAr de cada isolado bacteriano foram incubados em banho-maria a 37 °C por 3 h com as endonucleases de restrição tetraméricas Hae III, Alu I, Rsa I e Mbo I. Para um volume final de 25 µL por reação, cada sistema de restrição conteve 5 U de enzima de interesse, 2,5 µL de tampão de reação da enzima (10X) e 15 µL de material amplificado. Os produtos da reação foram analisados por eletroforese em gel de agarose (2,5 %) em tampão de corrida TAE 1X a 65V por 2 h 30 min. As bandas separadas no gel foram visualizadas, após coloração com brometo de etídeo, sob iluminação ultravioleta e fotografadas com filme Polaroid tipo 667.

Análise de agrupamento

Os perfis de restrição de cada isolado bacteriano gerados foram comparados e suas semelhanças estimadas pelo coeficiente de JACARD e analisados por meio de uma matriz de similaridade. Para características binárias, esse coeficiente define as semelhanças entre dois indivíduos como sendo expresso por Jxy= a/(n-d), em que Jxy é a semelhança entre os indivíduos X e Y, "a" é o número de combinações da presença de fragmentos dos indivíduos; "n", o número de combinações possíveis, e "d", as combinações da ausência de fragmentos. Os isolados foram agrupados pelo método das médias das distâncias UPGMA (Sneath & Sokal, 1973) e representados graficamente por um dendrograma (NYTSYS-pc, versão 1.8, Exceter Software, Setauket, NY).

 

RESULTADOS E DISCUSSÃO

Espécies de bactérias diazotróficas isoladas

Os resultados mostraram a ocorrência das espécies de bactérias diazotróficas Azospirillum lipoferum, A. brasilense, A. amazonense, Herbaspirillum seropedicae e Burkholderia spp. associadas às três espécies de gramíneas forrageiras estudadas (Quadro 1). A presença de bactérias diazotróficas do gênero Azospirillum em braquiária já tinha sido demonstrada por Neyra & Döbereiner, (1977), Souto (1982) e Magalhães et al. (1983).

As bactérias diazotróficas foram isoladas de todas as partes amostradas (raízes e folhas) das plantas forrageiras, bem como do solo. Em geral, os regimes de seca e cheia, aos quais a região do Pantanal está submetida, influenciaram o número de bactérias diazotróficas associadas às três espécies forrageiras estudadas (Quadro 1). Na época da cheia, em geral, foi observada a diminuição do número de bactérias nas raízes e no solo, porém, nas folhas de braquiária, esse número foi de modo geral, maior do que na época de seca. Nas folhas de capim carona também foi observado maior número de bactérias diazotróficas quando os meios de cultura NFb e JMV foram usados.

Observou-se um maior número de bactérias diazotróficas nas raízes lavadas das plantas avaliadas do que nas outras partes (Quadro 1). Maior número de bactérias nas raízes lavadas do que nas raízes desinfestadas de plantas forrageiras, bem como no solo, também foi observado por Souto (1982) e Magalhães et al. (1983). Reis Junior et al. (1999) também observaram números maiores de Azospirillum spp. nas raízes lavadas de Brachiaria humidicola e Brachiaria decumbens do que quando suas raízes foram desinfestadas. No entanto, esses autores não observaram correlação significativa entre o número de bactérias diazotróficas nas raízes lavadas e a atividade da nitrogenase. Observaram, porém, correlações significativas entre raízes esterilizadas e atividade da nitrogenase, sugerindo que as bactérias diazotróficas endofíticas sejam as principais responsáveis pela fixação biológica de N2 em gramíneas forrageiras. Döbereiner et al. (1976) verificaram correlações significativas entre a incidência de colonização de A. lipoferum e a atividade nitrogenase dessa bactéria em raízes de Panicum maximum, Brachiaria spp. e Penisetum spp.

O isolamento realizado a partir das maiores diluições confirmou a presença de bactérias diazotróficas associadas a três forrageiras no Pantanal. Foram obtidos 72 isolados bacterianos das diferentes partes das forrageiras estudadas, mas não foram obtidos isolados de solo para os gêneros Herbaspirillum e Burkholderia. Resultados semelhantes também foram observados por Baldani et al. (2000), que sugeriram que estas bactérias podem estar num estado viável, mas não-cultivável no solo. Do total dos isolados bacterianos, 32 foram isoladas do capim mimoso, 23 da braquiária e 17 do capim carona. Foi obtido um número menor de isolados bacterianos dos meios de cultivo originários da época da cheia.

Observou-se maior número de isolados bacterianos originários das raízes, seguido das folhas e do solo para todas as três espécies forrageiras. Este resultado concorda com o de outros autores, os quais verificaram que as bactérias diazotróficas isoladas, em sua maioria, também foram originárias das raízes lavadas de plantas (Baldani et al., 1981; Souto, 1982; Magalhães et al., 1983; Baldani, 1984; Olivares, 1997; Reis Junior, 1998; Brasil et al., 1999).

O maior percentual de isolados bacterianos foi para o gênero Azospirillum (Figura 1). A maior percentagem de bactérias caracterizadas morfologicamente como A. amazonense foi observada em braquiária e capim carona (Figura 1). Reis Junior (2002) também isolou de braquiária número maior de A. amazonense. Segundo o autor, a adaptabilidade desta espécie a pH ácido (Magalhães et al., 1983) também é responsável pelos altos números de A. amazonense, uma vez que o pH ácido é uma característica comum à maioria dos solos brasileiros. Altos números da espécie A. amazonense foram encontrados em associação com gramíneas forrageiras, dentre elas a braquiária (Souto, 1982; Magalhães & Döbereiner, 1984; Baldani, 1984).

 

 

Em capim mimoso, grande número de bactérias foram caracterizadas como pertencentes à espécie A. brasilense. Os isolados de A. lipoferum são citados por apresentar maior afinidade por plantas com via fotossintética C4 (como a braquiária, capim mimoso e capim carona) do que aqueles de A. brasilense (Baldani & Döbereiner, 1980). Por outro lado, Baldani et al. (1981) observaram predominância da espécie A. brasilense em solos com predominância de plantas via fotossintética C4 (milho), porém nas raízes dessas plantas houve o predomíneo da espécie A. lipoferum. Os resultados apresentados (Figura 1) não corroboram essa afirmação. Segundo Bashan & Holguin (1997), ainda não foi demonstrada especificidade típica entre as espécies de Azospirillum spp. e a planta hospedeira.

Diversidade genética de isolados bacterianos

A análise da diversidade genética foi feita com 39 isolados bacterianos (Quadro 2), representativos das bactérias obtidas das raízes, parte aérea e solo das três forrageiras em estudo. A amplificação da região 16S DNAr gerou fragmentos de aproximadamente 1450 pares de base (pb). Este tamanho do fragmento correspondeu ao esperado, visto que os primers utilizados flanqueavam quase todo o gene, que apresentava um tamanho médio de 1500pb (Young et al., 1991).

Os perfis de restrição geraram 65 bandas com 16 perfis distintos. A enzima que produziu maior número de bandas foi a Alu I com 21 bandas, seguida da Hae III com 18, Mbo I com 15 bandas e Rsa I com 14 bandas (Figura 2).

O dendrograma construído a partir do perfil de fragmentos de restrição da região 16S DNAr agrupou os 39 isolados bacterianos (Figura 3) e identificados fenotipicamente (Quadro 2). Os isolados foram divididos em cinco grupos genotípicos distintos, que permitiram separar aqueles pertencentes à espécie de Azopirillum e de Herbaspirillum. Os resultados evidenciam que, para o gênero Azospirillum, as espécies A. brasilense e A. lipoferum aparecem próximas somente com aproximadamente 50 % de similaridade, formando A. amazonense um grupo a parte com apenas 25 % de similaridade com as outras espécies do gênero. Essa observação concorda com os dados apresentados nos trabalhos de Fani et al. (1995) e Grifoni et al. (1995) que usaram a técnica de ARDRA. A descrição de outras espécies de Azospirillum: A. largimobilis e A. doebereinerae também mostra essa divergência (Dekhil et al., 1997; Eckert et al., 2001).

 

 

O grupo I conteve 11 isolados caracterizados como A. brasilense, dos quais oito apresentaram 70 % de similaridade com a estirpe Sp7, tipo da espécie (Figura 3). Apenas três isolados (67Ab, 69Ab e 68Al) diferiram da estirpe tipo a 50 % e formaram subgrupos independentes dentro desse grupo. O isolado 68Al foi identificado morfologicamente como pertencente à espécie A. lipoferum, porém a análise do perfil de restrição agrupou-o com as espécies de A. brasilense. O subgrupo com 70 % de similaridade com a estirpe Sp7 dividiu-se em cinco subgrupos, onde o isolado 20Ab apresentou 77 % de similaridade com a estirpe tipo. Os isolados 37Ab e 65Ab, obtidos de capim mimoso, apresentaram 100 % de similaridade entre si e constituíram, juntamente com os isolados 41Ab, 10Ab, 60Ab, uma similaridade de 90 % com a estirpe tipo Sp7. Os dois últimos isolados mostraram-se diferentes dos isolados 41Ab, 37Ab e 65Ab a 15 %, aproximadamente.

O grupo II foi composto por dez isolados caracterizados morfologicamente como pertencentes a A. lipoferum, sendo a maioria isolado de capim mimoso. Nove isolados apresentaram 75 % de similaridade com a estirpe Sp59 tipo para a espécie e apenas um isolado (19Al) diferiu da estirpe tipo a 50 % e formou um grupo independente. Os isolados com 75 % de similaridade formaram vários subgrupos com diferentes níveis de similaridade com a estirpe tipo Sp59. O isolado 39Al assemelhou-se a 100 % à estirpe tipo, enquanto os isolados 66Al e 11Al apresentaram 100 % de similaridade entre si, porém apresentaram 80 % de similaridade com a estirpe tipo, assim como os isolados 43Al e 64Al. Um segundo subgrupo foi formado apenas com o isolado 61Al, que foi obtido de capim carona e se assemelhou com a estirpe Sp59 a 75 %. O terceiro subgrupo, formado pelos isolados 42Al, 8Al e 9Al, provenientes de capim mimoso e braquiária, respectivamente, assemelhou-se à estirpe Sp59 em aproximadamente 75 %. Os isolados 8Al e 9Al apresentaram 100 % de similaridade entre si. O grupo formado por isolados de A. brasilense apresentou-se mais heterogêneo, quando comparado com A. lipoferum. Esse resultado diferiu dos encontrados por Fani et al. (1993), Fani et al. (1995) e Grifoni et al. (1995), que mostraram que grupos de isolados de A. lipoferum foram mais heterogêneos que os de A. brasilense.

O grupo III foi formado por dez isolados caracterizados como A. amazonense. Dentro do gênero, esse foi o grupo mais homogêneo: cinco isolados apresentaram 100 % de similaridade com a estirpe Y2 tipo para a espécie e dois isolados, 62Aa e 31Aa, 100 % de similaridade com a estirpe CBAmC. É interessante notar que as bactérias homólogas e a estirpe Y2 foram isoladas de plantas forrageiras. Baldani (1984) isolou a espécie de diferentes gramíneas forrageiras, sendo a estirpe CBAmC isolada de planta de cana-de-açúcar. Este fato poderia explicar a grande similaridade dos isolados com a estirpe Y2. Um subgrupo foi formado por dois isolados (45 Aa e 24 Aa) com 80 % de similaridade e que foram provenientes de espécies forrageiras diferentes (braquiária e capim carona, respectivamente).

O grupo IV foi formado por oito isolados caracterizados como pertencentes à espécie Herbaspirillum seropedicae. Neste grupo, o isolado 48H assemelhou-se de 100 % com a estirpe Z67, tipo da espécie. Os isolados 40H, 49H e 50 H apresentaram 100 % de similaridade entre si. Os isolados 47H e 16H formaram, a 70 %, um subgrupo dentro do grupo IV. Esses resultados mostram que a técnica de ARDRA, com geração de perfis polimórficos, pode ser usada na discriminação de espécies de Herbaspirillum, como assinalado por Olivares (1997), que revelou que outras técnicas biomoleculares, como ERIC e REP-PCR, que também geram perfis polimórficos, podem ser ferramentas hábeis na discriminação de espécies de Herbaspirillum. A homogeneidade desse grupo concordou como os resultados de Baldani et al. (1996) que, comparando as espécies de Herbaspirillum com várias outras espécies de bactérias diazotróficas, verificaram que o grupo formado por espécies de Herbaspirillum constitui um gênero único.

O grupo V foi formado apenas pelo isolado15Ab. Apesar de ter características fenotípicas semelhante à estirpe tipo Sp7, esse isolado não se agrupou com os isolados caracterizados para a espécie, tampouco com os outros grupos formados pela análise de restrição, indicando que este isolado pode pertencer a outra espécie de bactéria diazotrófica.

Muitos dos isolados, com alto grau de similaridade, foram obtidos da mesma planta, evidenciando uma possível distribuição isolado-planta. As espécies de gramíneas influenciaram a diversidade dos isolados (Figura 4). A maioria dos isolados de braquiária estão distribuídos no grupo I, enquanto os isolados de capim mimoso encontram-se principalmente nos grupos II e IV, e os isolados de capim carona, em maior freqüência no grupo III. Tais resultados podem estar relacionados com a composição química dos exsudados liberados pela planta. De acordo com Christensen (1989), a composição de plantas de determinada área pode influenciar a diversidade da comunidade microbiana graças à variabilidade da composição química de seus exsudados.

 

 

Segundo Grayston (1998), a variedade de compostos orgânicos liberados pela planta influencia a diversidade de microrganismos presentes na sua rizosfera. Lemanceau et al. (1995) e Latour et al. (1996) observaram efeitos discriminatórios de plantas sobre isolados de Pseudomonas, quando cultivadas em mesmo solo. Os resultados do dendrograma para o grupo III corroboram a observação desses autores. Resultados obtidos por Azevedo (1998) mostraram a maior influência exercida pelo tipo de solo e mesmo pelo tipo de planta para os isolados de A .amazonense, obtidos de plantas de arroz, milho e sorgo.

A formação de subgrupos, evidenciada no dendrograma (Figura 3), indica a existência de diversidade entre as espécies. A técnica de ARDRA foi capaz de discriminar a diversidade de isolados, exceto para o grupo de A. amazonense. Reis Junior (2002) utilizou as técnicas de ARDRA com o gene 16S DNAr e RISA para o espaço intergênico 16-23S DNAr, para analisar a diversidade de isolados bacterianos caracterizados fenotipicamente como pertencentes à espécie A. amazonense, originados da rizosfera de Brachiaria sp. Os resultados mostraram a formação de dois grupos muito similares (90 % de similaridade) quando usou a técnica de ARDRA, porém, observou um efeito sobre a diversidade dos isolados analisados em função da espécie de Brachiaria com as quais os isolados encontravam-se associados, quando usou a técnica de RISA. Azevedo (1998), em estudo semelhante com isolados de A. amazonense provenientes de arroz, milho e sorgo, cultivados em dois tipos de solo, revelou a existência de cinco grupos distintos, predominantes e evidentes, formados a 78 % de similaridade. Tal comportamento evidencia, no nível intra-específico, grande diversidade genética entre os isolados. É possível que os padrões genotípicos dos isolados de A. amazonense possam ser um reflexo da elevada capacidade de sobrevivência e colonização desta espécie no ambiente.

Os isolados bacterianos do presente trabalho foram isolados de plantas nativas e cultivadas em solo pantaneiro e talvez o estresse causado pelos regimes de seca e cheia neste ecossistema possa exercer influência e causar variação dentro das espécies de bactérias isoladas, de modo que muitos desses isolados podem ter-se adaptado a essa condição de estresse. Vários fatores podem influenciar o que Schloter et al. (2000) chamam de "microdiversidade" bacteriana. Os autores indicam a separação espacial, diferenças de habitat, interações específicas entre a bactéria e o hospedeiro, como os fatores que podem agir de maneira diferente de acordo com a espécie, razão por que cada caso deve ser estudado especificamente.

 

CONCLUSÕES

1. Bactérias diazotróficas dos gêneros Azospirillum, Herbaspirillum e Burkholderia apresentaram-se associadas às gramíneas forrageiras braquiária, capim mimoso e capim carona.

2. Os regimes de seca e cheia aos quais o agroecossistema pantaneiro está submetido influenciaram o número de bactérias diazotróficas associadas às plantas.

3. O percentual mais elevado de isolados bacterianos das gramíneas forrageiras do Pantanal do Mato Grosso do Sul foi para o gênero Azospirillum.

4. A técnica de ARDRA evidenciou alta diversidade entre os isolados, principalmente para os grupos formados por isolados bacterianos similares a A. brasilense e A. lipoferum.

 

AGRADECIMENTOS

Os autores agradecem ao Curso de Pós-Graduação em Agronomia Ciência do Solo da Universidade Federal Rural do Rio de Janeiro, onde o primeiro autor se graduou em Magister Scientiae. Agradecem também à Embrapa Pantanal, por permitir as coletas das plantas na fazenda Nhumirim; à Embrapa Agrobiologia, especialmente ao laboratório de Gramíneas, por permitir o uso de sua infra-estrutura. Os agradecimentos são extensivos ao Conselho Nacional de Pesquisa (CNPq), pela concessão da bolsa ao primeiro autor e produtividade em pesquisa dos demais autores.

 

LITERATURA CITADA

ADÁMOLI, J. O Pantanal e suas relações fitogeográficas com os cerrados. Discussão sobre o conceito de "Complexo do Pantanal". In: Congresso Nacional de Botânica, 32., Teresina, 1982. Anais. Teresina, 1982. p.109-119.        [ Links ]

AUDY, P.; BRAAT, C.E.; SAIDON, G.; HUANG, H.C. & LAROCHE, A. A rapid and sensitive PCR-basead assay for concurrent detection of bacteria causing commom and halo blights in bean seed. Phytopathology, 86:361-366, 1996.        [ Links ]

AZEVEDO, M.S. Influência do solo e da planta sobre a diversidade gênica de isolados de Azosprillum amazonense, associados às raízes de arroz, milho e sorgo. Seropédica, Universidade Federal Rural do Rio de Janeiro, 1998. 110p. (Tese de Mestrado)        [ Links ]

BALDANI, V.L.D. & DÖBEREINER, J. Host - plant specificity in the infection of cereals with Azospirillum spp. Soil Biol.Biochem, 12:433-439, 1980.        [ Links ]

BALDANI, J.I.; PEREIRA, P.A.; ROCHA, R.E.M. & DÖBEREINER, J. Especificidade na infecção de raízes por Azospirillum spp. em plantas com via fotossintética C3 e C4. Pesq. Agropec. Bras. 16:323-325, 1981.        [ Links ]

BALDANI, J.I. Ocorrência e caracterização de Azospirillum amazonense em comparação com as outras espécies deste gênero, em raízes de milho, sorgo e arroz. Itaguai, Universidade Federal Rural do Rio de Janeiro, 1984. 110p. (Tese de Mestrado)        [ Links ]

BALDANI, J.I.; BALDANI, V.L.D.; SELDIN, L. & DÖBEREINER, J. Characterization of Herbaspirillum seropedicae gen. nov. a root associated nitrogen fixing bacterium. Int. J. System. Bacteriol., 36:86-39, 1986.        [ Links ]

BALDANI, V.L.D.; BALDANI, I.J. & DÖBEREINER, J. Inoculation, of rice with the endophytic diazotrophs Herbaspirillum seropedicae and Burkholderia spp. Biol Fertil Soils., 30:485-491, 2000.        [ Links ]

BASHAN, Y. & HOLGUIN, G. Azospirillum-plant relationships: environmental and physiological advances (1990-1996). Can. J. Microbiol., 43:103-121, 1997.        [ Links ]

BERGEY'S Manual of determinative bacteriology. 9ed. Baltimore, Williams & Wilkins, 1994.        [ Links ]

BODDEY, R.M.; CLARK, P.M.; VICTORIA, R.L.; MATSUI, E. & DÖBEREINER, J. The use of the 15N isotope dilution tecnique to estimate the contribution of associated biological nitrogen fixation to the nitrogen nutrition of Paspalum notatum cv batatais. Can J. Microbiol., 29:1036-1045, 1983.        [ Links ]

Boddey, R.M. & Victoria, R.L. Estimation of biological nitrogen fixation associated with Brachiaria e Paspalum notaturn cv. batatais using 15N labelled organic matter and fertilizer. Plant Soil, 90:265-292, 1986.        [ Links ]

BRASIL, M.S.; GUIMARÃES, S.L.; SILVA. R.A.; FERNANDES, F.A.; BALDANI, V.L.D. & ISHII, I.H. Contagem e isolamento de bactérias diazotróficas do gênero Azospirillum associadas a três espécies forrageiras no Pantanal da Nhecolândia - MS. In: Congresso de Microbiologia, 20., Salvador, 1999. Livro de Resumos. Salvador, 1999.p.297.        [ Links ]

CHALK, P.M. The contribution of associative and symbiotic nitrogen fixation to the nitrogen nutrition of non-legumes. Plant Soil., 132:29-39, 1991.        [ Links ]

CHRISTENSEN, M. A view of fungal ecology. Micologia, 81:1-19, 1989.        [ Links ]

DEKHIL, S.B.; CAHILL, M.; STACKBRANDT, E. & SLY, L.I. Transfer of Conglomeromonas largomobilis subs. largomobilis to the genus Azospirillum as Azospirillum lagomobile comb. nov., and elevation of Conglomeromonas largomobilis subs. parooensis to the new type species of Conglomeromonas, Conglomeromonas parooensis sp. nov. System. Appl. Microbiol., 20:72-77, 1997.        [ Links ]

DÖBEREINER, J.; MARRIEL, I.E. & NERY, M. Ecological distribution of Spirillum lipoferum Beijerinck. Can. J. Microbiol., 22:1464-1473, 1976.        [ Links ]

DÖBEREINER, J.; BALDANI, V.L.D. & BALDANI, J.I. Como isolar e identificar bactérias diazotróficas de plantas não-leguminosas. Brasília, Embrapa-SPI; Itaguaí, RJ, Embrapa-Centro Nacional de Pesquisa em Agrobiologia, 1995. 60p.        [ Links ]

EMPRESA BRASILIEIRA DE PESQUISA AGROPECUÁRIA - EMBRAPA. Sistema Brasileiro de Classificação do Solos. Brasíla: Brasília Produção de Informação, Rio de Janeiro, Embrapa Solos, 1999. 412p.        [ Links ]

ECKERT, B.; WEBER, O.B.; KIRCHHOF, A.H.; HALBRITTER, A. & STOFFELS, M.; HARTMANN, A. Azospirillum doebereinerae sp. nov., a nitrogen-fixing bacterium associated with the C4-grass Miscanthus. Intern. J. Syst. Evol. Microbiol., 51:17-26, 2001.        [ Links ]

FANI, R.; BANDI, C.; BARDIN, M.G.; COMINCINI, S.; DAMIANI, G.; GRIFONI, A. & BAZZICALUPO, M. RAPD fingerprint is useful for indentification of Azospirillum strains. Microbiol. Releases, 1: 217-221, 1993.        [ Links ]

FANI, R.; BANDI, C.; BAZZICALUPO, M.; DAMIANI, G.; DI CELLO, B.; FANCELLI, S.; GALLORI, S.; GERACE, E.; GRIFONI, A.; LIÒ, P. & MORI, E. Phylogenetic studies of the Genus Azospirillum. In: FENDRIK, I.; DEL GALLO, M.; VANDERLEYDEN, J. & ZAMAROCZY, M., eds. Azospirillum VI and Related Microrganisms: Genetics, physiology, ecology. Berlin, Springer – Verlag, 1995. p.245-249.        [ Links ]

GRAYSTON, S.J.; WANG, S.; CAMPBELL, C.D. & EDWARDS, A.C. Selective influence of plant species on microbiol diversity in the rizosphere. Soil Biol. Biochem., 30:369-378, 1998.        [ Links ]

GRIFONI, A.; BAZZICALUPO, M.; DI SERIO.; FANCELLI, S. & FANI, R. Identification of Azospirillum strains by restriction lenght polymorphism of the 16S rDNA and the histidine operon. FEMS Microbiol. Letters, 127:85-91, 1995.        [ Links ]

JUNK, W.J. & DA SILVA, C.J. Neotropical floodplains: A comparison between the Pantanal of Mato Grosso and large Amazonian river floodplains. In: TUNDISI, J.G.; BUCUDU, C.E. & TUNDISI, T.M., eds. Limnology in Brasil. Rio de Janeiro, Brazilian Academy of Sciences Brazilian Limnological Society,1995. p.195-217.        [ Links ]

KIRCHHOF, G.; SCHLOTER, M.; AbMUS, B. & HARTMANN, A. Molecular microbial ecology approaches applied to diazotrophs associated with non-legumes. Soil Biol. & Biochem., 29:853-862, 1997.        [ Links ]

LATOUR, X.; CORBERAND, T.; LAGUERRE, G.; ALLARD, F. & LEMANCEAU, P. The compositation of fluorescent pseudomonad populations associated with roots is influenced by plant and soil type. Appl. Environ. Microbiol., 62:2449-2456, 1996.        [ Links ]

LEMANCEAU, P.; CORBERAND, T.; GARDAN, L.; LATOUR, X.; LAGUERRE, G.; BOEUFGRAS, J. & ALABOUVETE, C. Effect of two plant species, flax (Linum usitatissinum L.) and tomato (Licopersicum esculentum Mill.), on the diversity of soilborn populations of fluorescent pseudomonads. Appl. Environ. Microbiol., 61:1004-1012, 1995.        [ Links ]

MAGALHÃES, F.M.; BALDANI, J.I.; SOUTO, S.M.; KUYKENDALL, J.R & DOBEREINER, J. A new acid-tolerant Azospirillum species. Acad. Bras. Ci., 55:417-430, 1983.        [ Links ]

NEYRA, C.A. & DÖBEREINER, J. Nitrogen fixation in grasses. Adv. Agron., 29:1-38, 1977.        [ Links ]

OLIVARES, F.L. Taxonomia, ecologia e mecanismos envolvidos na infecção e colonização de plantas de cana-de-açúcar por bactérias diazotróficas do gênero Herbaspirillum. Seropédica, Universidade Federal Rural do Rio de Janeiro, 1997. 341p. (Tese de Doutorado)        [ Links ]

REIS JUNIOR., F.B. Influência do genótipo da planta, micropropagação e fertilização nitrogeneda sobre a população de bactérias diazotróficas em cana-de-açúcar (Saccharum.). Seropédica, Universidade Federal Rural do Rio de Janeiro, 1998. 158p. (Tese de Mestrado)        [ Links ]

Reis Junior, F.B.; REIS, V.M.; TEIXEIRA, K.R.S. & URQUIAGA, S. Avaliação da diversidade de bactérias diazotróficas em diferentes genótipos de Brachiaria. Seropédica, Embrapa Agrobiologia, nov/1999. 4p. (Embrapa – CNPAB. Pesquisa em andamento, 24)        [ Links ]

REIS JUNIOR, F.B. Ecologia e diversidade de bactérias do gênero Azospirillum em associação com pastagens de Brachiaria spp. Seropédica, Universidade Federal Rural do Rio de Janeiro, Instituto de Agronomia, 2002. 97p. (Tese de Doutorado)        [ Links ]

REIS, V.M.; BALDANI, I.; BALDANI, V.L.D. & DÖBEREINER, J. Biologocal dinitrogen fixation in Graminea and Palm Trees. Crit. Rev. Plant Sci., 19:227-247, 2000.        [ Links ]

RODRIGUES NETO, J.; MALAVOLTA Jr., V.A. & VICTOR, O. Meio simples para o isolamento e cultivo de Xanthomonas campestris pv. citri tipo B.Summa Phytopathol., 12:16, 1986 (Resumo)        [ Links ]

SCHLOTER, M.; LEBULN, M.; HEULIN, T. & HARTMANN, A. Ecology and evolution of bacterial microdiversity. FEMS Microbiol. Rev., 24:647-660, 2000.        [ Links ]

Sneath, P.H.A. & Sokal, R.R. Numerical taxonomy. San Francisco, W. F.Freeman and Company, San Francisco, 1973. p.230-234.        [ Links ]

SOUTO, S.M. Variação estacional da fixação de N2 e denitrificação em gramíneas forrageiras tropicais. Seropédica, Universidade Federal Rural do Rio de Janeiro, 1982. 268p. (Tese de Doutorado)        [ Links ]

TARRAND, J.J.; KRIEG, N.R. & DÖBEREINER, J. A taxonomic study of the Spirillum lipoferum group, with descriptions of a new genus, Azospirillum gen. nov. and two specie, Azospirillum lipoferum (Beijerinck) comb. nov. and Azospirillum brasilense sp. nov. Can. J. Microbiol., 24:967-980, 1978.        [ Links ]

WANG, H.; Q. I.M. & CUTLER, A.J. A simple method of preparing plant samples for PCR. Nucl. Acids Res., 21:4153-4154, 1993.        [ Links ]

SUPERINTENDÊNCIA DE DESENVOLVIMENTO SUSTENTÁVEL DO CENTRO-OESTE SUDECO. Estudo de desenvolvimento integrado da Bacia do Alto Paraguai. Brasília, 1978. t.2, 235p.        [ Links ]

YOUNG, J.P.W.; DOWNER, H,L. & EARDLY, B.D. Philogeny of photrophic Rhizobium strain BTAi1 by polymerase chain reaction-based sequencing of a 16S rRNA segment. J. Bacteriol., 173:2271-2277, 1991.        [ Links ]

 

 

Recebido para publicação em maio de 2003 e aprovado em dezembro de 2004.

 

 

1 Parte da Tese de Mestrado em Ciências do Solo do primeiro autor.

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License