SciELO - Scientific Electronic Library Online

 
vol.32 número especialDistribuição e caracterização de substâncias húmicas em vermicompostos de origem animal e vegetalAnálise multivariada de atributos microbiológicos e químicos do solo em florestas com Araucaria angustifolia índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Journal

Artigo

Indicadores

Links relacionados

Compartilhar


Revista Brasileira de Ciência do Solo

versão On-line ISSN 1806-9657

Rev. Bras. Ciênc. Solo v.32 n.spe Viçosa out./dez. 2008

http://dx.doi.org/10.1590/S0100-06832008000700010 

SEÇÃO III - BIOLOGIA DO SOLO

 

Caracterização do dna ribossômico do isolado de Scleroderma UFSMSc1 de Eucalyptus grandis W. Hill ex-maiden1

 

Ribosomal dna characterization of Scleroderma UFSMSc1 of Eucalyptus grandis W. Hill ex-maiden

 

 

Manoeli LupatiniI; Andrea Hentz de MelloII; Zaida Inês AntoniolliIII

IGraduanda do curso de Agronomia, Bolsista FAPERGS, Departamento de Solos, Universidade Federal de Santa Maria (UFSM), Avenida Roraima 1000, Camobi, Santa Maria, RS, CEP 97105 900. E-mail:mlupatini@gmail.com
IIProfessora da Universidade Federal do Pará, Departamento de Ciências Agrárias, Campus Universitário do Sul do Pará - Núcleo Marabá. E-mail: andreahentz@ufpa.br
IIIProfessora do Departamento de Solos da UFSM. E-mail: zaida@ccr.ufsm.br

 

 


RESUMO

O ácido desoxiribunocléico ribossomal (rDNA) é utilizado como uma ferramenta importante para caracterizar o polimorfismo entre os fungos. Existem muitas cópias de rDNA as quais são arranjadas por espaços não codificados. Essas cópias são altamente conservadas entre espécies de fungos. O objetivo deste trabalho foi estudar a região do Espaço Interno Transcrito (ITS) e analisar as diferenças no polimorfismo da seqüência dessa região no fungo Scleroderma UFSMSc1 com seqüências dos isolados de Scleroderma e Pisolithus do banco de dados GenBank. O DNA do isolado de Scleroderma UFSMSc1 foi extraído por meio da solução de extração à base de CTAB. A partir do DNA, foram feitas reações de PCR com os oligonucleotídeos iniciadores universais ITS1 e ITS4, cujo produto amplificado foi purificado e seqüenciado. A região do ITS do fungo mostrou uma banda simples de aproximadamente 650 pares de base. Na análise da seqüência dessa região em comparação com algumas depositadas no GenBank, observou-se a formação de agrupamento com espécies de Scleroderma. Os resultados mostraram que essa técnica favorece a identificação de espécies de Scleroderma, visto que tais fungos são difíceis de ser identificados apenas por seus caracteres morfológicos.

Termos de indexação: caracterização do DNA, PCR, Scleroderma.


SUMMARY

The ribossomal deoxyribonucleic acid (rDNA) represents an important tool in the characterization of fungi polymorphism. There are many copies of rDNA arranged in non encoded spaces. These copies are highly preserved in fungus species. The purpose of this study was to investigate the Internal Transcribed Spacer (ITS) region and to analyze the differences in the sequence polymorphism of the ITS region in the fungus Scleroderma UFSMSc1 with sequences of Scleroderma and Pisolithus isolates from the GenBank database. The DNA of the Scleroderma UFSMSc1 isolate was extracted with CTAB solution. PCR reactions were carried out with the universal primers ITS1 and ITS4. The amplified products were purified and sequenced. A simple band with a fragment of approximately 650 base pairs was observed in the ITS region of the fungus. The formation of grouping with Scleroderma species was observed in the sequence analysis of this region in comparison with entries of the GenBank database. The results confirmed this technique for Scleroderma species identification, since these fungi are not easily identified by morphological characters.

Index terms: DNA characterization, PCR, Scleroderma.


 

 

INTRODUÇÃO

O rDNA é uma ferramenta importante para avaliação de polimorfismo nos fungos. Existem muitas cópias de rDNA, como 18S, 5.8S, 28S, as quais são arranjadas por espaços não codificados. As seqüências codificadas do rDNA são altamente conservadas entre espécies de fungos. A diferenciação genética entre populações de uma espécie constitui o primeiro estádio da divergência evolutiva. Essa diferenciação resulta, na maioria dos casos, da ação de diferentes ambientes a que cada população está sujeita sobre a variabilidade preexistente na espécie (Marques, 2003). Os métodos usuais de identificação de espécies de fungos ectomicorrízicos (fECMs) são baseados em critérios morfológicos, observando-se as características dos carpóforos e dos critérios das chaves de classificação, conforme Brundett et al., (1996) e Mello et al., (2006). A morfologia é uma característica importante para a identificação e, em muitos casos, pode proporcionar uma rápida e confiável caracterização.

A identidade dos seres vivos é determinada pela composição e seqüência do material genético. As técnicas moleculares, por meio da análise de DNA, apresentam a vantagem de ser um processo rápido e altamente sensível, além disso, não estão sujeitas a variações fenotípicas, à ação do ambiente, ao estádio de desenvolvimento do fungo e a outros fatores que possam alterar a morfologia do organismo (Martin, 2007).

Todas as técnicas conhecidas de diagnóstico molecular fundamentam-se na análise direta ou indireta da composição ou na seqüência dos ácidos nucléicos para identificação e caracterização de organismos e características genéticas de interesse (Marques et al., 2002). A técnica mais utilizada em fungos ectomicorrízicos é a amplificação de rDNA por Reação de Polimerase em Cadeia (PCR). Esta técnica permite a amplificação de regiões específicas do genoma, como o Espaço Interno Transcrito (ITS), localizado entre regiões altamente conservadas, como as regiões correspondentes aos genes 18S e 28S. O ITS é altamente conservado na espécie, mas é variável entre espécies, sendo freqüentemente usado para taxonomia (Bruns et al., 1991; Antoniolli et al., 2000; Gomes et al., 2002).

O estudo do polimorfismo da região ITS para fungos ectomicorrízicos tem sido determinado para poucas espécies. Trabalho realizado com 26 isolados de fungos ectomicorrízicos, do Estado de Minas Gerais, caracterizou polimorfismo em oito gêneros, dentre os quais estão o Suillus brevipes (Peck) Kuntze, Hebeloma cylindrosporum Rogmanesi, Cenococcum geophilum Fr. e Scleroderma sp. (Gomes et al., 2002). Este trabalho teve por objetivo caracterizar e analisar a região do ITS do rDNA do isolado do fungo ectomicorrízico de Scleroderma UFSMSc1, oriundo de população de Eucalyptus grandis.

 

MATERIAL E MÉTODOS

Obtenção e manutenção do fungo ectomicorrízico

O isolado de fungo ectomicorrízico estudado foi coletado em plantação de Eucalyptus grandis situada na Fazenda Ynhacundá, município de São Franscisco de Assis, RS. O fungo foi multiplicado no Laboratório de Biologia e Microbiologia do Solo Prof. Marcos Rubens Fries, Universidade Federal de Santa Maria. A descrição morfológica do isolado Scleroderma UFSMSc1 foi realizada pela Prof. Vetúria Lopes de Oliveira, da Universidade Federal de Santa Catarina - UFSC.

O isolado foi mantido em meio de cultura sólido Melin-Norkans Modificado - MNM (Marx, 1969), em placa de Petri de 9 cm de diâmetro, em estufa a 25 ºC, por 15 dias. Em seguida, foram feitas suspensões micelianas em 25 mL de MNM líquido em erlenmeyers de 250 mL, a partir de discos de 8 mm de diâmetro obtidos das culturas em placa. O material foi incubado em estufa a 25 ºC por 30 dias.

Extração do DNA

A extração de DNA foi realizada conforme método CTAB, sendo o DNA extraído a partir de micélio produzido em meio líquido MNM. As suspensões micelianas, após serem retiradas do meio líquido, foram secas em papel toalha e submetidas à maceração com N líquido até aparência de pó. Nesse estádio, foram adicionados 600 mL de tampão CTAB 2 % (1,4 mol L-1 de NaCl, 0,2 mol L-1 de EDTA, 2 % de CTAB e 0,1 mol L-1 de Tris-HCl) As suspensões foram novamente maceradas, homogeneizadas em misturador por 1 min e incubadas em banho-maria a 65 ºC por 1 h. Após, foram adicionados às amostras 600 mL de fenol: clorofórmio: isoamyl álcool (25:24:1). Essas foram novamente submetidas à homogeneização em misturador por 5 min e centrifugadas a 18894 g, rotor 12130 por 10 min a 15 ºC, em centrífuga Sigma Laboratory Centrifuge 4K15. Feita a centrifugação, o sobrenadante foi transferido para outro tubo e foram adicionados 600 mL de fenol: clorofórmio: isoamyl álcool (25:24:1) sendo as amostras centrifugadas a 18894 g por 10 min a 15 ºC. O sobrenante foi então retirado e adicionado a um novo tubo com igual volume de isopropanol. As amostras foram homogeneizadas novamente em misturador e os tubos permaneceram em temperatura ambiente por 5 min. Após este período, as amostras foram centrifugadas a 18894 g por 10 min. Após este processo, descartou-se o líquido sobrenadante e inverteu-se o tubo por 5 min para retirar o isopropanol. Adicionaram-se 100 μL de etanol gelado 70 %, e as amostras permaneceram em temperatura ambiente por 5 min. Após este tempo, as amostras foram centrifugadas a 18894 g por 10 min. Descartou-se o sobrenadante e deixou-se o restante do etanol evaporar por 1 h. O pellet foi ressuspenso em 50 μL de água ultrapura e as amostras armazenadas a - 20 ºC.

Posterior à extração do DNA, as amostras foram submetidas ao tratamento com RNAse A (10 mg ml L-1). Adicionaram-se às amostras 2 % do volume da amostra de RNAse A. As mesmas permaneceram em banho - maria a 37 ºC por 30 min. Em seguida, o DNA foi analisado em gel de agarose 1,5 %, que consiste de 100 mL de solução TBE 1X (89 mmol L-1 de Tris, 89 m mol L-1 de ácido bórico, 2 mmol L-1 de EDTA, pH 8,0) e 1,5 g de agarose. Essa mistura foi dissolvida em forno de microondas. Após esfriar, adicionou-se 0,5 μL de brometo de etídeo para visualização da presença do DNA genômico.

O gel foi corrido em cuba em voltagem de 60 mV. Depois de realizada a corrida do gel este foi visualizado em luz ultravioleta e fotografado com câmara para fotografia de gel marca Kodac.

Reação de PCR

As amostras de DNA genômico foram submetidas a PCR para a amplificação do DNA. Os oligonucleo-tídeos iniciadores utilizados foram o ITS1 (5' TTCCGTAGGTGAACCTGCGG 3') e ITS4 (5' TCCTCCGCTTATTGATATGC 3') para estudo da região do ITS (White et al., 1990) (Figura 1).

 

 

A reação de PCR utilizada foi a seguinte: 1,0 µL de DNA; 2,5 µL de tampão 10X; 3,0 µL de DNTP (estoque com 1,5 m mol L-1); 2,0 µL de MgCl2 (20 m mol L-1); 3,0 µL do oligonucleotídeos iniciadores ITS1 (25 ñmol); 3,0 µL do oligonucleotídeos iniciadores ITS4 (25 ñmol); 0,5 unidades da enzima Taq polimerase (5 unidades/µL); 10,5 µL de água ultrapura para completar o volume da reação para 25µL.

A reação de PCR foi obtida nas seguintes condições: 94 ºC por 2 min, seguidos por 30 ciclos de 94 ºC por 45 s, 55 ºC por 30 s e 72 ºC por 35 s, e com uma extensão final de 72 ºC por 10 min e mantidas em 4 ºC. Um controle negativo sem DNA foi incluído em todos as amostras. A reação de PCR foi realizada em termociclador marca PTC - 100 da MJ Research, Inc. O DNA do isolado foi amplificado em mais de 10 repetições com as mesmas condições para garantir a reprodutividade dos resultados. Os fragmentos de DNA gerados pela PCR foram separados por eletroforese (1,5 % gel de agarose) por 2 h, a 60 mV em TBE 1X. Posteriormente, foi feita a visualização do gel com brometo de etidio, conforme descrita para a extração do DNA.

Purificação, seqüenciamento e análise das seqüências de DNA

O produto de reação da PCR foi submetido à purificação, adicionado-se 1 volume de PEG 13% (PEG 13 % e 1,6 mol L-1 de NaCl) e deixado 16 h em geladeira. Após serem retiradas da geladeira, as amostras foram centrifugadas a 18894 g por 15 min. A solução PEG 13 % foi então descartada e acrescidos 200 µL de álcool 70 %. As amostras foram novamente centrifugadas a 18894 g durante 10 min. Após essa etapa, o álcool foi descartado e deixado evaporar por 1 h. O DNA foi ressuspenso em 8 µL de água ultrapura.

Para o seqüenciamento do DNA, foi utilizado o aparelho Mega BACE 500, desenvolvido pela Amersham Biosciences. As seqüências obtidas foram editadas no aplicativo EditSeq e alinhadas no aplicativo MegaAlign do software DNASTAR (Lasergene, 1994). Para a construção do diagrama de similaridade e comparação da seqüência consensus, foram utilizadas seqüências obtidas no banco de dados GenBank - NCBI Blast (Altschul et al., 1997) (Quadro 1).

 

RESULTADOS E DISCUSSÃO

O método utilizado para a extração do DNA do micélio do isolado de Scleroderma UFSMSc1 mostrou-se eficiente, resultando em quantidade de DNA suficiente para a utilização de técnicas de purificação e análises de polimorfismo da região do ITS pelo seqüenciamento direto do DNA do produto do PCR.

As regiões ITS1, ITS2 e 5.8S do rDNA do micélio de Scleroderma UFSMSc1 foram amplificadas com sucesso com os oligonucleotídeos iniciadores ITS1/ITS4. A região do ITS do fungo Scleroderma UFSMSc1 mostrou uma banda simples representando um fragmento de DNA de aproximadamente 650 pares de base (pb), não demonstrando contaminação por agentes externos.

Para o seqüenciamento, foi utilizado o produto direto da PCR (Figura 2), e ambas as regiões do ITS foram seqüenciadas do Scleroderma UFSMSc1. Comparando a seqüência do isolado Scleroderma UFSMSc1 com as informações da estrutura genética dos isolados de Scleroderma spp, disponibilizada no Banco de Dados GenBank.

 

 

A seqüência de genes conservados 5.8S encontra-se entre os pares de base 398 e 561 (Figura 3).

A região 5.8S apresenta 100 % de similaridade com a mesma região de fungos do gênero de Scleroderma no banco de dados do GenBank (Quadro 1 e Figura 2).

O isolado UFSMSc1 mostrou uma similaridade de 100 % com os fungos Scleroderma sp (Kanchanaprayuh et al., 2003) e com fungos ectomicorrízicos não cultivados (Diedhiou et al., 2005), 99 % de similaridade com fungos ectomicorrízicos não cultivados (Fons & Kjoller, 2005) e 98 % de similaridade com fungos ectomicorrízicos não cultivados (Hawley et al., 2006; Booth & Horton, 2006). Esses dados evidenciam a variabilidade da região do ITS1 e ITS2 que pode estar envolvida com a formação da associação micorrízica com o eucalipto em diferentes regiões e locais. Embora as espécies de Scleroderma possam apresentar dificuldade para diferenciação entre espécies pelos caracteres morfológicos (Malvarez & Oliveira, 2003), a análise filogenética do rDNA certifica a identificação dos isolados coletados, desde vegetação natural até áreas de reflorestamento (Martin et al., 2002).

Quando analisadas as seqüências obtidas com as depositadas no GenBank, observou-se a formação de grupos em dois níveis, sendo um grupamento dos isolados da espécie Pisolithus ssp com uma similaridade mínima de 95 % e um grupamento referente a isolados da espécie Scleroderma spp com similaridade mínima de 98 %. A seqüência do isolado Sclerodrema UFSMSc1 formou grupamento com as seqüências de isolados de Scleroderma spp e de fungos ectomicorrizicos não cultivados. É importante salientar que ocorreram formas distintas dos grupos para Pisolithus e Scleroderma (Figura 4). O grupamento dos isolados da espécie Scleroderma spp, quando comparado com o isolado em estudo, apresentou maior score ou menor número de "gaps", ou seja, menos nucleotídeos foram alterados pelo banco de dados NCBI Blast quando da realização do alinhamento das bases.

A análise da região ITS do isolado suporta a identificação morfológica descrita por Kanchanaprayuh et al. (2003), Nara (2006) e Booth & Horton (2006) para isolados de fungos ectomicorrízicos.

Os resultados mostraram que a técnica por meio de seqüenciamento direto do produto do PCR-ITS mostrou-se eficiente para a identificação de espécies de Scleroderma pois estes fungos são difíceis de ser identificados apenas por seus caracteres morfológicos. Esta ferramenta requer quantidades mínimas de DNA e apresenta alta confiabilidade nos resultados, tornando-se assim um método excelente para estudo de populações nativas de fungos ectomicorrizicos e monitoramento de isolados específicos utilizados em programas de inoculação com esses fungos nas mais diversas condições ambientais.

 

AGRADECIMENTOS

À Fapergs, pelo financiamento do projeto e pela Bolsa de Iniciação Cientifica, e à CAPES, pela Bolsa de Doutorado.

 

LITERATURA CITADA

ALTSCHUL, S.F.; MADDEN, T.L.; SCHAFFON, A.A.; ZHANG, J.; ZHANG, Z.; MILLER, W. & LIPMAN, D.J. Gapped BLAST and PSI-BLAST: A new generation of protein data base search programs. Nucleic. Aci. Res., 26:3389-3402, 1997.         [ Links ]

ANDERSON, I.C.; CHAMBERS, S.M. & CAIRNEY, J.W.G. ITS-RFLP and ITS sequence diversity in Pisolithus from Central and Eastern Australian sclerophyll forests. Mycol. Res., 105:1304-1312, 2001.         [ Links ]

ANTONIOLLI, Z.I.; SCHACHTMAN, D.; OPHELKELLER, D. & SMITH, S.E. Variation in ribosomal internal transcribed spacer sequences in Glomus mosseae and Gigaspora margarita spores from a permanent pasture. Mycol. Res., 104:708-715, 2000.         [ Links ]

BONUSO, E.; IOTTI, M. & ZAMBONELLI, A. Identification of some ectomycorrhizal fungi. 2002. (Não Publicado). Número de acesso ao GenBank: DQ679804,         [ Links ]

BOOTH, M.G. & HORTON, T.R. Overstorey mycorrhizal networks determine mycobiont diversity and composition on seedlings in a New England forest. (Não Publicado). Número de acesso ao GenBank: DQ437705, 2006.         [ Links ]

BRUNDETT, M.; BOUGHER, N.; DELL, B.; GROVE, T. & MALAJCZUK, N. Working with mycorrhizas in forestry and agriculture. Canberra,, Australian Centre for Agricultural Research, 1996. 374p.         [ Links ]

BRUNS, T.; WHITE, T. & TAYLOR, J. Fungal molecular systematics. Ann. Rev. Ecol. Syst., 22:525-564, 1991.         [ Links ]

DIEDHIOU, A.G.; DIABATE, M.; DREYFUS, B.; BA, A.M.; GALIANA, A.; DE FARIA, S.M.; DUCOUSSO, M. & BENA, G. Tropical rain forest canopy trees share ectomycorrhizal fungi with their understorey seedlings. (Não Publicado) 2005. Número de acesso ao GenBank: AM113465, AM113464,         [ Links ]

FONS, K. & KJOLLER, R. The influence of forest continuity and geographic distance on the ectomycorrhizal fungal community associated with beech. (Não Publicado) 2005. Número de acesso ao GenBank: AM087282,         [ Links ]

GOMES, E.A.; KASUYA, M.C. M.; BARROS, E.G. & BORGES, A.C. Polymorphism in the internal transcribed spacer (ITS) of the ribosomal DNA of 26 isolates of ectomycorrhizal fungi. Genetic Molec. Biol., 25:477-483, 2002.         [ Links ]

HAWLEY, G.L.; TAYLOR, A.S. & DAMES, J.F. Ectomycorrhizal in association with Pinus patula in South Africa. 2006. (Não Publicado) Número de acesso ao GenBank: EF031134, 2006.         [ Links ]

KANCHANAPRAYUDH, J.; ZHOU, Z.; YOMYART, S.; SIHANONTH, P. & HOGETSU, T. Molecular phylogeny of ectomycorrhizal Pisolithus fungi associated with pine, dipterocarp, and eucalyptus trees in Thailand. Mycoscience, 44:287-294, 2003.         [ Links ]

LASERGENE. User's guide: A manual for the Lasergene System. Biocomputing Software for Windows. 1994. 253p.         [ Links ]

LUPATINI M; MELLO, A.H. & ANTONIOLLI, Z.I. Ribossomal DNA characterization of Scleroderma UFSCSc1 ectomycorrhizal fungi from Eucalyptus grandis (W. Hill ex-Maiden). 2007. Número de acesso ao GenBank: EF517491.         [ Links ]

MALVÁREZ, G. & OLIVEIRA, V.L. A PCR/RFLP technique to characterize fungal species in Eucalyptus grandis Hillex Maiden ectomycorrhizas. Mycorrhiza, 13:101-105, 2003.         [ Links ]

MARQUES, E.K. Diagnóstico genético molecular. Canoas, ULBRA, 2003. 372p.         [ Links ]

MARQUES, E.K.; IKUTA, N.; LUNGE, V.R. & FONSECA, A.S.K. Diagnóstico molecular e biotecnologia. In: SERAFINI, L.A.; BARROS, N.M. & AZEVEDO, J.L. Biotecnologia: Avanços na agricultura e na agroindústria. Caxias do Sul, 2002. 433p.         [ Links ]

MARTIN, F.; DÍEZ J.; DELL, B. & CELARUELLE, C. Phytogeography of the ectomycorrhizal Pisolithus species as inferred from nuclear ribosomal DNA ITS sequences. New Phytol., 153:345-357, 2002.         [ Links ]

MARTIN, K.J. Introduction to molecular analysis of ectomycorrhizal communities. Soil Sci. Soc. Am. J., 71:601-610, 2007.         [ Links ]

MARX, D.H. The influence of ectotrophic mycorrhizal fungi on the resistence of pine roots to pathogenic inflections. I. Antagonism of mycorrhizal fungi to root pathogenic fungi and soil bacteria. Phytopathology, 59:153-163, 1969.         [ Links ]

MELLO, A.H.; ANTONIOLLI, Z.I.; KAMINSKI, J.; SOUZA, E.L. & OLIVEIRA, V.L. Fungos arbusculares e ectomicorrízicos em áreas de eucalipto e de campo nativo em solo arenoso. Ci. Flor., 16:293-301, 2006        [ Links ]

NARA, K. Ectomycorrhizal networks and seedling establishment during early primary succession. New Phytol., 169:169-178, 2006.         [ Links ]

WHITE, T.; BRUNS, T.; LEE, S. & TAYLOR, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: INNIS, M.A.; GELFAND, D.H.J.J.; SNINSKY, J.J. & WITHE, T.J. PCR Protocols: A guide to methods and applications. New York, Academic Press, 1990. p.315-322.         [ Links ]

 

 

1 Parte da Tese de Doutorado da segunda autora. Trabalho apresentado no XXXI Congresso Brasileiro de Ciência do Solo, 2007 (Gramado, RS).

Creative Commons License Todo o conteúdo deste periódico, exceto onde está identificado, está licenciado sob uma Licença Creative Commons