SciELO - Scientific Electronic Library Online

 
vol.36 número5Nodulação e eficiência da fixação do N2 em feijão-caupi por efeito da taxa do inóculoEstabilidade temporal e variabilidade espacial da distribuição da armazenagem de água no solo numa sucessão feijão/aveia-preta índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Journal

Artigo

  • Português (pdf)
  • Artigo em XML
  • Como citar este artigo
  • SciELO Analytics
  • Curriculum ScienTI
  • Tradução automática

Indicadores

Links relacionados

Compartilhar


Revista Brasileira de Ciência do Solo

versão On-line ISSN 1806-9657

Rev. Bras. Ciênc. Solo vol.36 no.5 Viçosa out./nov. 2012

http://dx.doi.org/10.1590/S0100-06832012000500006 

DIVISÃO 2 - PROCESSOS E PROPRIEDADES DO SOLO
COMISSÃO 2.1 - BIOLOGIA DO SOLO

 

Bactérias diazotróficas em solos sob seringueira1

 

Diazotrophic bacteria in soils under rubber tree

 

 

Patricia Fabian de Araújo DinizI; Luiz Edson Mota de OliveiraII; Noelly Alves LopesIII; Ligiane Aparecida FlorentinoIV; Teotonio Soares de CarvalhoV; Fatima Maria de Souza MoreiraVI

IProfessora e pesquisadora do Instituto Federal de Educação, Ciência e Tecnologia da Paraíba - Campus Cabedelo . Avenida 1º de Maio,  720, Bairro Jaguaribe. CEP 58015-430 João Pessoa (PB). E-mail: patifabian@yahoo.com.br
IIProfessor Titular, Departamento de Biologia, Setor de Fisiologia Vegetal, UFLA. Bolsista CNPq. Caixa Postal 3037 CEP 37200-000 Lavras (MG). E-mail: ledson@dbi.ufla.br
IIIMestranda do Departamento de Biologia, Programa de Pós-Graduação em Microbiologia Agrícola (PPGMA), UFLA. E-mail: noelly.alves@gmail.com
IVPós-Doutoranda do Departamento de Biologia, PPGMA, Professora colaboradora do PPGMA e do Programa de Pós Graduação em Ciência do Solo (PPGCS), UFLA. E-mail: ligianeflorentino@gmail.com
VDoutorando do Departamento de Ciência do Solo, PPGCS, UFLA. E-mail: teo_soares@hotmail.com
VIProfessora Associada 4, Departamento de Ciência do Solo, PPGCS, UFLA. Bolsista CNPq. E-mail: fmoreira@dcs.ufla.br

 

 


RESUMO

Diversos relatos evidenciam os benefícios de procariotos fixadores de nitrogênio atmosférico no crescimento e na nutrição de muitas espécies vegetais; entretanto, não há, até o momento, nenhum trabalho visando à prospecção desses microrganismos na rizosfera da seringueira (Hevea brasiliensis). Assim, os objetivos deste trabalho foram verificar a ocorrência de bactérias diazotróficas em solos sob plantio de seringueira, assim como em suas raízes, e isolar e caracterizar essas bactérias. Para essa finalidade, coletaram-se amostras de solo e de raízes finas de seringueiras cultivadas no Campus Experimental da Universidade Federal de Lavras (Lavras, MG) para inoculação em meios de cultura semissólidos sem N na forma combinada, de modo a favorecer o crescimento de algumas espécies de bactérias diazotróficas. Foram obtidos 19 isolados nas amostras de solo, e não houve crescimento de bactérias fixadoras de nitrogênio nas culturas com amostras de raízes. A caracterização celular e das colônias desses isolados indicou que 17 deles produzem grande quantidade de exopolissacarídeo elástico, algumas vezes cartilaginoso. Eles são todos Gram-negativos, com formato celular de bastonete, imóveis e com dois glóbulos de poli-β-hidroxibutirato (PBH), um em cada extremidade do bastonete. O sequenciamento do 16S rDNA e sua análise filogenética confirmaram que isolados representativos desse grupo pertencem ao gênero Beijerinckia (B. indica e B. derxii) e que os outros dois isolados Gram-positivos pertencem ao gênero Bacillus. A presença da nitrogenase - a enzima responsável pela fixação biológica do nitrogênio atmosférico (FBN) - foi confirmada por meio da técnica de redução do acetileno. Conclui-se que, no solo sob plantio de seringueira, houve predominância de diazotróficas de vida livre pertencentes ao gênero Beijerinckia (B. indica e B. derxii), não havendo indícios de bactérias endofiticas ou rizosféricas.

Termos de indexação: Hevea, diazotróficos, fixação biológica de nitrogênio, Beijerinckia.


SUMMARY

Several reports have shown the benefits of atmospheric nitrogen-fixing prokaryotes in growth and nutrition of many plant species; however, these microorganisms in the rhizosphere of rubber trees (Hevea brasiliensis) have not been investigated so far. Thus, the objective of this study was to verify the occurrence of diazotrophic bacteria in soils and roots of a plantation of rubber trees, and to isolate and characterize these bacteria. For this purpose, soil and fine roots of rubber trees were sampled on the Experimental Campus of the Federal University of Lavras, Minas Gerais, for inoculation in semi-solid culture medium without N, to favor the growth of some diazotrophic bacteria species. Nineteen isolates were obtained from soil samples, and no growth of N-fixing bacteria was verified in the cultures with root samples. The characterization of the cells and colonies of these isolates indicated that 17 of them produce large amounts of elastic and sometimes cartilagenous exopolysaccharide. They are all Gram-negative, have rod-shaped, motionless cells and a globule of poly-β-hydorxybutyrate (PBH) at either cell end. The sequencing of the 16S rDNA and its phylogenetic analysis confirmed that representative isolates of this group belong to the genus Beijerinckia (B.indica and B. derxii), and that the other two Gram-positive isolates belong to the genus Bacillus. The presence of the enzyme nitrogenase, responsible for biological nitrogen fixation (BNF), was confirmed by the acetylene reduction technique. It was concluded that the soil under rubber tree contained predominantly free-living diazotrophs of the genus Beijerinckia (B.indica and B.derxii), with no evidence of endophytic or rhizospheric bacteria.

Index terms: Hevea, diazotrophs, biological nitrogen fixation, Beijerinckia.


 

 

INTRODUÇÃO

Os altos custos econômicos e ambientais relacionados à fertilização nitrogenada têm estimulado a busca por alternativas que possam diminuir a utilização desse fertilizante sem que haja diminuição da produtividade agrícola. Vários estudos sobre a atividade microbiológica que ocorre na rizosfera de diversos vegetais levaram ao descobrimento de grupos de microrganismos importantes para o desenvolvimento vegetal. Nesse sentido, têm-se buscado alternativas aos fertilizantes químicos, e uma das possibilidades é a inoculação de bactérias diazotróficas, que podem associar-se às plantas para fixar nitrogênio (N) atmosférico e, ou, produzir substâncias promotoras de crescimento de plantas (Bergamaschi et al., 2007). Esses procariotos podem ocorrer tanto no solo quanto na rizosfera e estabelecer relações simbióticas e, ou, associativas com uma grande variedade de espécies vegetais, contribuindo para sua nutrição nitrogenada (Moreira et al., 2008).

Na formação dos porta-enxertos de seringueira, a adubação correta das mudas é essencial para uma nutrição equilibrada, o que irá refletir em suprimento adequado de nutrientes, especialmente o N, para que seja possível atingir maior uniformidade das mudas, precocidade, sistema radicular de boa qualidade e aptidão para a enxertia (Bataglia & Santos, 1998). Nessa fase de formação do seringal, a utilização de bactérias diazotróficas, isoladas da própria cultura, poderia propiciar maior aporte de N às plantas, além de promover o crescimento por meio de outros processos.

Plantas jovens de Hevea brasiliensis cultivadas na ausência total de N tiveram aumento de 30 % no teor desse nutriente, possivelmente devido à FBN (Delú-Filho, 1994). Esse autor sugeriu a ocorrência de bactérias diazotróficas pertencentes às espécies Azospirillum brasilense, Azospirillum lipoferum e Herbaspirillum seropedicae associadas às raízes da seringueira. No entanto, o único relato sobre a presença de diazotróficos associados à seringueira notificou a presença do gênero Beijerinckia, uma bactéria de vida livre, em solos sob seringais no Estado do Pará - Brasil (Döbereiner & Ruschel, 1958).

Diante do exposto, o presente trabalho teve como objetivos verificar a ocorrência de bactérias fixadoras de N em solos sob seringal e proceder posteriormente à caracterização cultural e morfológica dos isolados obtidos, assim como de sua capacidade de reduzir o N2. Além disso, a identificação de parte dos isolados foi realizada pelo sequenciamento do 16S rDNA.

 

MATERIAL E MÉTODOS

Levantamento da ocorrência de bactérias diazotróficas em amostras de solo sob seringal e em raízes de plantas de seringueira

Coleta das amostras

A coleta das amostras de solo e de raízes foi realizada em um plantio de seringueira adulto e não adubado, localizado no setor de Fisiologia Vegetal da UFLA (Lavras-MG). Foram coletadas 12 amostras compostas (seis de solo e seis de raízes) de seis plantas de seringueira, que constituíram as unidades experimentais. Cada amostra composta foi constituída de quatro amostras simples coletadas de quatro pontos de cada unidade experimental, localizados a 30 cm de distância do tronco da planta e a uma profundidade de 0-20 cm. Essas amostras foram homogeneizadas para constituir uma amostra composta. As 12 amostras compostas destinadas à análise microbiológica foram acondicionadas em sacos plásticos estéreis Millipore e foram conservadas a 4 ºC.

Ocorrência, isolamento e caracterização dos isolados

Procedeu-se à avaliação da presença das bactérias fixadoras de N atmosférico (N2) nas amostras de solo e de raízes, inoculando-as nos seguintes meios de cultura semissólidos e semisseletivos: NFb, JNFb, LGI (Döbereiner et al., 1995), JMV (Reis et al., 2004) e FAM (Magalhães & Döbereiner, 1984). As amostras de raízes foram separadas em: raízes finas com solo rizosférico agregado; raízes finas lavadas em água destilada estéril por 10 min; e raízes finas superficialmente desinfestadas em hipoclorito de sódio (1 % v/v) durante 2 min, posteriormente lavadas em água destilada estéril. Com a finalidade de verificar a presença de bactérias fixadoras endofíticas, as raízes superficialmente desinfestadas foram maceradas antes da inoculação no meio de cultura. As amostras de solo não receberam tratamento diferenciado, sendo inoculadas diretamente nos meios de cultura referidos. Para cada amostra foram feitas cinco repetições. Os meios inoculados com as amostras foram mantidos em câmara de crescimento a 28 ºC e observou-se o crescimento bacteriano por meio da formação de película característica durante o período de incubação de 6-7 dias. O isolamento das colônias típicas de fixadores de N2 foi realizado por meio de repicagens sucessivas, alternando o crescimento no mesmo meio de origem sólido e no mesmo meio de origem semissólido, de acordo com método descrito nas referências supracitadas.

Após a purificação dos isolados, todos  oriundos do meio FAM semissólido, procedeu-se à caracterização cultural em meio sólido FAM. As características avaliadas foram: velocidade de crescimento; diâmetro médio (mm); forma (puntiforme circular e irregular); elevação (plana, lenticular, convexa, drop-like, umbonada e umbilicada); borda (inteira, ondulada, lobada, denteada e filamentosa); superfície (lisa, rugosa e papilada); produção de muco (escassa, pouca, moderada e abundante); consistência da massa de crescimento (seca, aquosa, gomosa, viscosa e butírica); e detalhes ópticos (transparente, translúcido, opaco e brilhante). As observações morfológicas das células quanto à mobilidade celular (imóvel ou móvel), forma das células e  presença de glóbulos de poli-β-hidroxibutirato (PHB) foi feita após a montagem de lâminas e com auxílio de microscópio óptico de contraste de fases (Olympus BX40).

O teste de coloração Gram foi realizado segundo o método de Bartholomew (Yano et al., 1993). Após a montagem em lâminas, avaliou-se a coloração em microscópio óptico (Nikon AFX-IIA).

Para observação em microscopia eletrônica, amostras das colônias em meio FAM foram coletadas, e procedeu-se ao esfregaço sobre lamínulas de 13 mm incrustadas com Poly-L-Lysine. As lamínulas foram transferidas para placas de Petri, e as amostras foram então submetidas à fixação em solução de Karnovisky modificada (glutaraldeído (2,5 %) e paraformaldeído (2,5 %), em tampão cacodilato, pH 7,2, 0,05 mol L-1 + CaCl2 0,001 mol L-1) por 24 h em câmara fria, lavadas com tampão cacodilato e pós-fixadas em tetróxido de ósmio 1 % por 1 h. Após lavagem em água destilada, iniciou-se o processo de desidratação em gradiente de acetona (25, 50, 75, 90 e 100 %, três vezes por 10 min). Após passar pelo aparelho de ponto crítico (BAL-TEC, CPD-03) e fixação em suporte metálico (stubs) com ajuda de fita de carbono, as amostras foram submetidas ao processo de metalização em ouro no aparelho BAL-TEC, SCD-050. As observações e eletromicrografias foram feitas em microscópio eletrônico de varredura LEO-EVO 40, XVP (Alves, 2005). 

Atividade da nitrogenase

A análise qualitativa (presença/ausência) da atividade da nitrogenase pela técnica de redução do acetileno foi realizada seguindo o método descrito por Dilworth (1966). Os isolados foram crescidos em seus meios semissólidos de origem em frascos de 10 mL, contendo 5 mL de meio de cultura, a 28 ºC, por cinco dias. No ensaio da redução do acetileno ("acetylene reduction assay"- ARA), o gás foi produzido em um erlenmeyer de Kitasato por meio da reação de carbureto de cálcio (CaC2) com água. Foi injetado 1 mL de acetileno e, após 1 h, retirou-se 1 mL do gás presente no tubo, para verificar a produção de etileno, pela leitura por cromatografia gasosa (Varian Star 3400 cx).

Um dendrograma foi construído a partir de oito variáveis morfológicas: forma da colônia, elevação, superfície, velocidade de crescimento, produção de muco, consistência, detalhes ópticos e presença de glóbulos de PBH. Para construção do dendrograma, foi formada uma matriz de distância binária entre os isolados, a partir da qual se fez o agrupamento com o pacote hclust usando o método average, no R 2.13.2 (R. Development Core Team, 2011).

Sequenciamento do 16S rDNA

Para extração do DNA, os isolados foram crescidos em 200 mL de meio FAM líquido por três dias a 28 ºC. As amostras foram centrifugadas a 13.000 rpm, a 4 ºC, por 30 min. O sobrenadante foi descartado, e as células bacterianas foram submetidas aos procedimentos de extração. Após maceração em almofariz com areia, 5 mL de CTAB 2X a 65 ºC e 20 µL de 2-β-mercaptoetanol, o material foi incubado em banho-maria a 65 ºC (30-60 min). Após incubação, adicionaram-se 10 mL de clorofórmio-álcool isoamil, e o material foi centrifugado a 5.000 rpm por 5 min. Ao sobrenadante coletado foi adicionado três vezes o volume de acetato de amônio - álcool etílico que foi mantido em freezer por 1 h para precipitação do DNA. O precipitado foi seco ao ar livre e dissolvido em tampão TE (tris-EDTA) (200 - 400 µL). Após dissolvido, adicionou-se igual volume de fenol clorofórmio - álcool isoamil e centrifugou-se a 14.000 rpm por 5 min. O sobrenadante foi coletado, e procedeu-se à precipitação em três vezes o seu volume com álcool isopropílico - acetato de sódio, sendo mantido em freezer por 1 h. O álcool isopropílico-acetato de sódio foi eliminado das amostras e, após ressuspensão em TE 50/20, procedeu-se à quantificação do DNA (Nienhuis et al., 1995, com modificações).

Após extração do DNA, as amostras foram diluídas 10 vezes, e uma alíquota de 5 µL foi utilizada para amplificação pela técnica de PCR, em um volume final de 50 µL por reação. A concentração final dos reagentes por reação foi de 0,2 µmol L-1 de cada oligonucleotídeo iniciador 27F (5AGAGTTTGATCCTGGCTCAG) e 1492R (GGTTACCTTGTTACGACTT) (Lane, 1991), 2,5 mmol L-1 de cloreto de magnésio, tampão 1x para PCR, 0,2 µmol L-1 de cada dNTP e 0,02 U Taq DNA polimerase (Plantium™ taq DNA polimerase, Invitrogen). A reação de amplificação foi realizada em Eppendorf  Mastercycler®, Alemanha, sob as seguintes condições: uma desnaturação inicial de 94 °C por 5 min, 30 ciclos de desnaturação (94 °C por 40 s), anelamento (55 °C por 40 s), extensão (72 °C por 1,5 min) e uma extensão final a 72 °C por 7 min. Uma alíquota de cada reação da PCR (20 µL) foi analisada, usando-se gel de agarose 1 % (w/v) com tampão TAE (tris-acetato-EDTA) e coloração em brometo de etídeo (5 µg mL-1). Os produtos da reação foram purificados por meio de precipitação em etanol, e o sequenciamento parcial do DNA (utilizando-se o primer 27F) foi realizado em sequenciador ABI 3739x1.

Os eletroferogramas obtidos foram avaliados no programa Phred Q20 (Ewing et al., 1998), usado para remoção de regiões de baixa qualidade. As sequências resultantes foram avaliadas e comparadas com sequências do GenBank, utilizando-se a Ferramenta de Busca de Alinhamento Local Básica (NCBI), (http://www.ncbi.nlm.nih.gov), para identificação dos gêneros e espécies. Para a análise filogenética, as sequências obtidas foram alinhadas no Clustal X2 com as sequências das seguintes estirpes, obtidas no banco de germoplasma (GenBank): Beijerinckia derxii (NR 042182), Beijerinckia indica (CP001016.1-:680554-682033), Bacillus vallismortis (JF496324.1), Bacillus amyloliquefaciens (AB301017.1) e uma Archaeae não cultivada (U40238.2-:31654-33126), que foi utilizada como raiz da árvore. A árvore filogenética foi construída usando o software Mega 5.05, por máxima verossimilhança, e avaliada por bootstrap com 1.000 permutações.

 

RESULTADOS

Ocorrência, isolamento e caracterização dos isolados

Nenhum crescimento foi detectado nos meios inoculados com amostras de raízes, e apenas o meio FAM detectou a presença de diazotróficos em todas as amostras de solo, indicada pela formação de película típica, próximo à superfície do meio de cultura. Nessas amostras de solo foram obtidos 19 isolados bacterianos, cuja caracterização morfológica das colônias está apresentada no quadro 1. Esses isolados foram identificados com os códigos UFLA-96 a UFLA-114. Os isolados UFLA-96 e UFLA-97 formaram uma película menos espessa, sendo ausente a característica gomosa, e suas colônias foram transparentes, secas, pequenas e de crescimento muito lento (10 dias). Os demais isolados formaram uma película de cor branco-leitosa, espessa e gomosa, sendo esse padrão de crescimento idêntico para 17 dos isolados encontrados. Aos cinco dias após a repicagem, estes apresentaram colônias grandes, com produção de goma - exopolissacarídeos - em grande quantidade. A caracterização cultural no meio FAM revelou baixa diversidade fenotípica entre os isolados.

 

 

Verificou-se a formação de três tipos de colônias: (1) colônias pequenas, transparentes e secas (UFLA-96;97); (2) colônias elásticas, opacas e grandes não cartilaginosas (UFLA-98;100;101;102;103;104;105;107;108;110;111); e (3) colônias elásticas, opacas, grandes e cartilaginosas (UFLA-99;106;109;112;113;114).

Pela caracterização celular por meio da microscopia óptica e microscopia eletrônica de varredura (Figuras 1 e 2), os isolados dos tipos 2 e 3 apresentaram formato de bastonete, imóveis, e negativos ao teste de coloração Gram. Além disso, verificou-se a presença de dois glóbulos lipídicos (poli-β-hidroxibutirato), um em cada polo da célula (Figuras 1a,b e 2a,b). Já os isolados do tipo 1, UFLA-96 e UFLA-97 (Figura 1c), apresentaram grande produção de endósporos e foram Gram-positivos. Submetidos ao teste ARA, todos foram capazes de reduzir o acetileno.

 


 

Pela análise de agrupamento das características culturais dos 19 isolados, dois grupos foram obtidos a 60 % de similaridade, sendo os isolados UFLA-96 e 97 distintos dos demais (Figura 3a).

 


 

Sequenciamento do 16S rDNA

Após remoção de regiões de baixa qualidade (extremidades das sequências), as sequências resultantes apresentaram número de bases variando entre 344 (UFLA-102; 109 e 99) e 370 (UFLA- 96). Quando as sequências dos quatro isolados foram submetidas ao GenBank do NCBI para verificar alinhamentos significativos, verificou-se que UFLA-102 apresentou 100 % de similaridade com Beijerinckia derxii (NR042182) e 100 % com Beijerinckia indica (CP001016.1-:680554-682033); UFLA-109, 99 % de similaridade tanto com Beijerinckia derxii (NR 042182) quanto com Beijerinckia indica (CP001016.1-:680554-682033); UFLA -99, 100% de similaridade com Beijerinckia derxii (NR042182) e 99 % com Beijerinckia indica (CP001016.1-:680554-682033); e  UFLA-96, 100 % de similaridade tanto com Bacillus vallismortis (JF496324.1) quanto com Bacillus amyloliquefaciens (AB301017.1). Pela análise das relações filogenéticas dos isolados sequenciados (Figura 3b), também foram obtidos dois grupos distintos, formados pelo agrupamento de (1) UFLA-102; 109; 99, Beijerinckia derxii e Beijerinckia indica; e (2) UFLA-96, Bacillus vallismortis e Bacillus liquefaciens, demonstrando alta relação com os grupamentos por características culturais.

 

DISCUSSÃO

Todos os isolados encontrados foram oriundos das amostras de solo. Entretanto, a ausência de crescimento bacteriano nos meios de cultura semissólidos utilizados, que receberam raízes desinfestadas e maceradas, não deve ser um indicativo de ausência de bactérias endofíticas na seringueira, uma vez que esses microrganismos podem não ter sido capazes de crescer apenas nos meios de cultura utilizados. Döbereiner (1953) iniciou o estudo de bactérias diazotróficas no Brasil, o que levou à descoberta de várias novas espécies e comprovação da incorporação de N fixado em tecidos vegetais por técnicas que empregam o isótopo N15. Azospirillum spp. estão entre as espécies mais comumente encontradas como capazes de colonizar a rizosfera de plantas e tecidos vegetais. No entanto, essas espécies não foram encontradas nas raízes de seringueira, mesmo utilizando meios que favorecem seu crescimento.

As características das colônias, como a produção de grandes quantidades de exopolissacarídeo (consistindo de uma goma bastante elástica e algumas vezes cartilaginosa) (Quadro 1), o formato celular de bastonete, a coloração Gram negativa e a presença de dois glóbulos de poli-β-hidroxibutirato (PBH), um em cada polo da célula, evidenciaram que 17 dos 19 isolados apresentam elevada similaridade com as bactérias do gênero Beijerinckia. O sequenciamento de UFLA-102;109;99 e seu alinhamento em elevado grau (maior que 99 %) com as espécies do gênero Beijerinckia permitem identificar esses isolados como pertencentes a esse gênero. Do mesmo modo, as características morfológicas das células, bem como a sequência do 16S rDNA, mostraram que os isolados UFLA-96;97 pertencem ao gênero Bacillus (Figura 3b).

Embora não tenha sido utilizada nenhuma técnica de coloração para se confirmar a natureza desses grânulos, segundo Becking (1984), o material que constitui os corpos lipídicos ou grânulos, posicionados em cada polo da célula de Beijerinckia, é o poli-β-hidroxibutirato (PBH), um composto da classe dos polímeros termoplásticos chamados de poli-hidroxialcanoatos e que podem ser utilizados pelas bactérias como uma reserva celular. O polissacarídeo extracelular produzido em grande quantidade pelas espécies do gênero Beijerinckia pode atuar como proteção aos sítios de redução da nitrogenase contra danos ocasionados pela presença de oxigênio (Barbosa & Altherthum, 1992).

Todos os isolados reduziram o acetileno, o que denota a presença da nitrogenase, enzima capaz de reduzir o N2 para NH3. De acordo com Han & New (1998), há grande variabilidade na capacidade de isolados reduzirem o acetileno e podem existir diferenças in vitro e in vivo. Isso, em parte, pode justificar o fato de que bactérias podem demonstrar eficiência em fixar N2 in vitro sem, no entanto, fazê-lo in vivo, podendo ocasionar baixos ganhos de N pelas plantas. Esses mesmos autores esclarecem ainda que a técnica de redução do acetileno é um método indireto para se avaliar a FBN, e muitas estirpes que apresentam alto potencial de FBN in vitro podem não apresentar associação eficiente com as plantas no campo.  Soma-se a isso o fato de que a alta fixação de N2 por bactérias não implica necessariamente transferência do N fixado para a planta (Mantelin & Touraine, 2004), uma vez que, no solo, a interferência de fatores físicos, químicos e biológicos pode evitar que as plantas tenham acesso ao NH3 produzido (Moreira & Siqueira, 2006).

Dos meios utilizados, o FAM foi o único que detectou a presença de diazotróficos dos gêneros Beijerinckia e Bacillus. Outros meios são geralmente utilizados para pesquisas desse gênero (Campelo & Döbereiner, 1970; Döbereiner et al., 1995), além dos citados na metodologia. No entanto, a detecção de bactérias do gênero Beijerinckia pelo meio FAM já tinha ocorrido anteriormente (Magalhães & Döbereiner, 1984) em amostras de solo coletadas sob plantios de Bactris gasipaes e de Brachiaria humidicola; desse modo, os resultados aqui apresentados comprovam a eficiência do meio FAM em detectar bactérias desse gênero. Estirpes de Bacillus spp. foram detectadas de amostras de solo inoculadas em meios NFb, LGI e FAM (Silva et al., 2011).

Döbereiner & Ruschel (1958), pesquisando a ocorrência de bactérias fixadoras de N em amostras de solo de vários Estados brasileiros, utilizando o meio sílica-gel de Winogradsky com sacarose, isolaram uma nova espécie do gênero Beijerinckia (B. fluminensis) de solos sob os seringais do Pará - Brasil. Esse é o único relato científico até o momento da presença do gênero associado à seringueira. Este trabalho mostra a ocorrência de mais duas espécies do gênero (Beijerinckia indica e Beijerinckia derxii), além de espécies do gênero Bacillus.

 

CONCLUSÕES

1. Bactérias de vida livre fixadoras de nitrogênio atmosférico foram encontradas em solo sob seringal.

2. Não houve indícios de bactérias rizosféricas ou endofíticas associadas à seringueira capazes de crescer nos meios de cultura utilizados (NFb, JNFb, FAM, JMV e LGI).

3. Pelas caracterizações morfológicas e molecular dos isolados obtidos, verificou-se predominância de bactérias pertencentes ao gênero Beijerinckia, havendo ainda a presença de dois isolados do gênero Bacillus.

 

AGRADECIMENTOS

Projeto parcialmente financiado pelo CNPq e pela FAPEMIG. Ao CNPq, pelas bolsas de produtividade em pesquisa (F.M.S. Moreira e L.E.M. Oliveira). À FAPEMIG, pela bolsa de I.C. (N.A. Lopes). À Capes, pela bolsa de doutorado (T.S. Carvalho) e de pós doutorado (L.A. Florentino).

 

LITERATURA CITADA

ALVES, E. Curso introdutório de microscopia eletrônica de varredura. Lavras: UFLA, 2005. 43p.         [ Links ]

BARBOSA, H.R. & ALTERTHUM, F.  The role of extracellular polysaccharide in cell viability and nitrogenase activity of Beijerinckia derxii. Can. J. Microbiol., 38:986-988, 1992.         [ Links ]

BATAGLIA, O.C. & SANTOS, W.R.  Nutrição e adubação de seringais em formação e produção. In: CICLO DE PALESTRAS SOBRE A HEVEICULTURA PAULISTA, 1., Barretos, 1998. Palestra...Barretos, 1998.         [ Links ]

BECKING, J.H.  Genus Beijerinckia. In: KRIEG, N.R., ed. Bergey's manual of systematic bacteriology. 2.ed. Baltimore, Williams & Wilkins, 1984. p.311-325.         [ Links ]

BERGAMASCHI, C.; ROESCH, L.F.W.; QUADROS, P.D. & CAMARGO, F.A.O.  Occurrence of diazotrophic bacteria associated with forage sorghum cultivars. Ci. Rural, 37:727-733, 2007.         [ Links ]

CAMPELO, A.B. & DÖBEREINER, J.  Ocorrência de Derxia sp. em solos de alguns estados brasileiros. Pesq. Agropec. Bras., 5:327-332, 1970.         [ Links ]

DELÚ-FILHO, N.  Efeito do N-NO-3 sobre o crescimento e atividade das enzimas de assimilação do nitrogênio em plantas jovens de seringueira (Hevea brasiliensis Muell. Arg.). Lavras, Universidade Federal de Lavras, 1994. 87p.         [ Links ] (Tese de Mestrado)

DILWORTH, M.J.  Acetylene reduction by nitrogen-fixing preparations from Clostridium pasteurianum. BBA - General Subjects, 127:285-294, 1966.         [ Links ]

DÖBEREINER, J.; BALDANI, J.I. & BALDANI, V.L.D.  Como isolar e identificar bactérias diazotróficas de plantas não leguminosas. Brasília, Embrapa-SPI/Seropédica, Embrapa-CNPAB, 1995. 60p.         [ Links ]

DÖBEREINER, J. & RUSCHEL, A.P.  Uma nova espécie de Beijerinckia.  R. Biol., 1:260-272, 1958.         [ Links ]

DÖBEREINER, J.  Azotobacter em solos ácidos. B. IEEA, 1:1-30, 1953.         [ Links ]

EWING, B.; HILLIER, L.; WENDL, M.C. & GREEN, P.  Base-calling of automated sequencer traces using phred. I. Accuracy Assess. Genome Res, 8:175-185, 1998.         [ Links ]

HAN, S.O. & NEW, P.B.  Variation in nitrogen fixing ability among natural isolates of Azospirillum. Microb. Ecol., 36:193-201, 1998.         [ Links ]

LANE, D.J.  16S/23S rRNA sequencing. In: STACKEBRANDT, E. & GOODFELLOW, M., eds. Nucleic acid techniques in bacterial systematics. New York, Wiley, 1991. p.130-141.         [ Links ]

MAGALHÃES, F.M.M. & DÖBEREINER, J.  Ocorrência de Azospirillum amazonense em alguns ecossistemas da Amazônia. R. Microbiol., 15:246-252, 1984.         [ Links ]

MANTELIN, S. & TOURAINE, B.  Plant growth-promoting bacteria and nitrate availability: impacts on root development and nitrate uptake. J. Exper. Bot., 55:27-24, 2004.         [ Links ]

MOREIRA, M.F.S.; LANGE, A.; KLAUBERG-FILHO, O.; SIQUEIRA, J.O.; NÓBREGA, R.S.A. & LIMA, A.S.  Associative diazotrophic bacteria in grass roots and soils from heavy metal contaminated sites. Ann. Braz. Acad. Sci., 80:749-761, 2008.         [ Links ]

MOREIRA, F.M.S. & SIQUEIRA, J.O.  Microbiologia e bioquímica do solo. 2.ed. Lavras, Universidade Federal de Lavras, 2006. 729p.         [ Links ]

NIENHUIS, J.; TIVANG, L.; SCKROCH, P. & SANTOS, J.B.  Genetic relationships among cultivars and lines of lima bean (Phaseolus lunatus L.) as measure by RAPD markers. J. Am. Soc. Hortic. Sci., 120:300-306, 1995.         [ Links ]

R. DEVELOPMENT CORE TEAM.  R: A language and environment for statistical computing. R Foundation for Statistical Computing. Vienna, 2011. Disponível em: <http://www.R-project.org> Acesso em: 01 de jun. de 2011.         [ Links ]

REIS, V.M.; ESTRADA-DE-LOS SANTOS, P.; TENORIO-SALGADO, S.; VOGEL, J.; STOFFELS, M.; GUYON, S.; MAVINGUI, P.; BALDANI, V.L.D.; SCHMID, M.; BALDANI, J.I.; BALANDREAU, J.; HARTMANN, A. & CABALLERO-MELLADO, J.  Burkholderia tropica sp. nov., a novel nitrogen-fixing, plant-associated bacterium. Intern. J. System. Evol. Microbiol., 54:2155-2162, 2004.         [ Links ]

SILVA, K.; NÓBREGA, R.S.A.; LIMA, A.S.; BARBERI, A. & MOREIRA, F.M.S.  Density and diversity of diazotrophic bacteria isolated from Amazonian soils using N-free semi-solid media. Sci. Agric., 68:518-525, 2011.         [ Links ]

YANO, D.M.Y.; FARRIS, M.G.; UMINO, C.Y.; COUTINHO, H.L.C. & CANHOS, V.P.  Técnicas para cultivo, identificação e preservação de bactérias, Campinas, Fundação Tropical de Pesquisas e Tecnologia "André Tosello", 1993. 64p.         [ Links ]

 

 

1 Parte da Tese de Doutorado do primeiro autor apresentada ao Programa de Pós-Graduação em Fisiologia Vegetal, Universidade Federal de Lavras - UFLA. Recebido para publicação em 15 de dezembro de 2011 e aprovado em 18 de julho de 2012.

Creative Commons License Todo o conteúdo deste periódico, exceto onde está identificado, está licenciado sob uma Licença Creative Commons