SciELO - Scientific Electronic Library Online

 
vol.38 issue1Cultivar response to fungicide application in relation to rice blast control, productivity and sustainabilityRelationship between caryopsis morphological characteristics and fusarium ear rot in corn author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

Share


Pesquisa Agropecuária Brasileira

Print version ISSN 0100-204XOn-line version ISSN 1678-3921

Pesq. agropec. bras. vol.38 no.1 Brasília Jan. 2003

http://dx.doi.org/10.1590/S0100-204X2003000100003 

Incidência de viroses e enfezamentos e estimativa de perdas causadas por molicutes em milho no Paraná1

 

Occurrence of viruses and stunting diseases and estimative of yield losses by mollicutes in corn in Paraná State, Brazil

 

 

Elizabeth de OliveiraI; Renato de Oliveira ResendeII; María de la Paz Giménez PecciIII; Irma Graciela LagunaIII; Patricia HerreraIII; Ivan CruzI

IEmbrapa-Centro Nacional de Pesquisa de Milho e Sorgo, Caixa Postal 151, CEP 35701970 Sete Lagoas, MG
IIUniversidade de Brasília, Instituto de Biologia, Dep. de Biologia Celular, ICC Entrada Sul, Campus Universitário, CEP 70919970 Brasília, DF
III
Instituto Nacional de Tecnología Agropecuaria, Instituto de Fitopatologia y Fisiologia Vegetal, Camino 60 Cuadras, Km 51/2(5119) Córdoba, Argentina

Endereço para correspondência

 

 


RESUMO

O objetivo deste trabalho foi avaliar a incidência de viroses e enfezamentos e estimar as perdas causadas por enfezamentos na cultura do milho safrinha. Os diagnósticos baseados em sintomas foram confirmados por PCR ou RTPCR. Em todas as lavouras, foram identificadas plantas com sintomas de enfezamentos, em incidência de 6,2% a 49,9% (média de 20,7%). Na identificação de insetos vetores desses patógenos, a cigarrinha Dalbulus maidis foi detectada em 20 lavouras das 24 amostradas, constituindo 66,6% do total de espécimens de cigarrinhas coletadas. A perda potencial causada pelos enfezamentos no período foi estimada em cerca de 16,5 milhões de dólares. A ocorrência de plantas com sintomas de "Maize rayado fino virus" e "Maize dwarf mosaic virus" foi baixa e o diagnóstico confirmado por RTPCR. A análise de 441 amostras suspeitas de infecção por "Mal de Río Cuarto virus", por DASELISA, mostrou ausência desse vírus. Resultados de PCR indicaram a presença de um possível fitoplasma distinto de "Maize bushy stunt phytoplasma" em duas plantas apresentando nanismo acentuado, folhas estreitas, enrijecidas, com deformações, e grãos na inflorescência, havendo necessidade de mais estudos para a confirmação da identidade desse possível novo fitoplasma.

Termos para indexação: Zea mays, espiroplasma, doença das plantas.


ABSTRACT 

The objective of this work was to evaluate the occurence and yield losses by corn stunting diseases and maize viruses in "safrinha" season. Disease diagnostics based on plant symptoms were confirmed by PCR or RTPCR assays. Insect samples were collected in 24 fields for identification of vectors of the pathogens. Corn stunting diseases symptoms were observed in all crops evaluated, with incidence levels ranging from 6.2% to 49.9% (average 20.7%) and the presence of the leafhopper Dalbulus maidis, was detected in 20 of the 24 areas evaluated. This insect species was prevalent, representing 66,6% of total leafhoppers specimens collected. The potential yield losses caused by mollicutes was estimated around US$ 16.5 million. Few plants showing Maize rayado fino virus and Maize dwarf mosaic virus symptoms were found and virus infection was confirmed by RTPCR. Mal de Río Cuarto virus was not detected in all 441 plants analyzed by DASELISA. Results of PCR assays indicated the presence of a possible phytoplasma different from maize bushy stunt phytoplasma in two stunting maize plants showing leaves distortions and grain in the inflorescence. However, new studies should be done to confirm the identity of this possible new phytoplasma.

Index terms: Zea mays, spiroplasma, plant disease.


 

 

Introdução

Os enfezamentos causados por molicutes e as viroses do milho aumentaram em incidência, causando prejuízos significativos na produção de sementes e grãos desse cereal (Oliveira et al., 1998; Massola Júnior et al., 1999). Atualmente, há carência de determinações da incidência e perdas causadas por essas doenças nas principais regiões produtoras de milho, além de aspectos relativos a sua disseminação e alternativas de controle. O enfezamento pálido do milho é causado por espiroplasma (Spiroplasma kunkelli Whitcomb) e o enfezamento vermelho, por fitoplasma (Maize bushy stuntphytoplasma), ambos patógenos pertencentes à classe Mollicutes e transmitidos de forma persistente pela cigarrinha Dalbulus maidis (De Long &Wolcott) (Balmer, 1980; Gordon et al., 1981).

Os vírus mais prejudiciais à cultura do milho no Brasil, pelos danos à produção de grãos, são "Maize rayado fino virus" (MRFV), "Maize mosaic virus" (MMV) e "Maize dwarf mosaic virus" (MDMV), transmitidos, respectivamente, pelas cigarrinhas Dalbulus maidis e Peregrinus maidis (Asmead), e por pulgões (Pinto et al., 1997). Contudo, em 1986, foi mencionada a ocorrência da virose Mal de Río Cuarto, causada por "Mal de Río Cuarto virus" (MRCV), nos municípios de Foz do Iguaçu e Cascavel, no Estado do Paraná, permanecendo a necessidade de confirmação da identidade do vírus encontrado, através de testes sorológicos. O MRCV, que pertence ao gênero Fijivirus, é transmitido pela cigarrinha Delphacodes kuscheli Fennah, infecta diversas gramíneas silvestres e cultivadas, e tem causado perdas elevadas na cultura do milho na Argentina, quando ocorre em surto epidêmico (Lenardon & March, 1998; Ornaghi et al., 1999). Por causa da proximidade geográfica entre os dois países, essa virose constitui um problema potencial para o cultivo do milho no Brasil.

O objetivo deste trabalho foi avaliar a incidência de viroses e enfezamentos e estimar as perdas causadas por enfezamentos na cultura do milho safrinha.

 

Material e Métodos

A incidência de plantas com sintomas de virose e de enfezamento foi avaliada em 24 lavouras de milho safrinha do ano 2000 (cultivado de março a julho de 2000), localizadas nos municípios de Cambé, Alvorada do Sul, Bela Vista, Maringá, Dr. Camargo, Floresta, Campo Mourão, Juranda, Campina da Lagoa, Ubiratã, São Miguel do Iguaçú, Medianeira, Itaipulândia, Nova Santa Rosa, Guaíra, Palotina, Corbélia e Cafelândia, no Estado do Paraná. Na época da avaliação, essas lavouras encontravam-se em estádios fenológicos variando de seis (florescimento) a nove (grão farináceo).

Em cada lavoura, em três fileiras de 10 m cada uma, casualizadas na área, foi determinado o número de plantas com sintomas de enfezamentos e/ou de viroses e o número total de plantas na fileira. Os dados obtidos foram convertidos em porcentual de plantas infectadas em cada fileira, e a média entre as três fileiras, considerada representativa para cada lavoura amostrada. Em cada lavoura, foram coletadas amostras de folhas em duas plantas apresentando sintomas de enfezamento que foram submetidas a PCR, para detecção de fitoplasma e de espiroplasma, visando confirmar o diagnóstico feito no campo e verificar a proporção de infecção entre esses dois patógenos. Foram coletadas amostras de folhas com sintomas de MDMV e de MRFV, para confirmação da presença desses vírus através de RT-PCR.

Além das avaliações feitas nas três fileiras de 10 m de cada lavoura, as mesmas foram avaliadas em vários pontos, em busca de plantas possivelmente portadoras do MRCV. Foram coletadas 441 amostras de folhas, em plantas apresentando deformações foliares, suspeitas de estarem infectadas pelo MRCV, mesmo sem a presença de enações sobre as nervuras, na face inferior das folhas, sintomas típicos desta virose. Estas plantas foram submetidas ao teste sorológico DASELISA, com antisoro específico para detecção do MRCV (Giménez Pecci et al., 1991).

Foram coletadas amostras de folhas em plantas apresentando acentuado nanismo, folhas estreitas e enrijecidas, e presença de grãos na inflorescência, suspeitas de estarem infectadas por molicutes, para serem analisadas ao microscópio eletrônico de transmissão e por PCR.

Em 20 lavouras, dentre as 24 avaliadas, foram coletadas amostras de insetos, com o auxílio de uma rede entomológica, a fim de verificar a presença de cigarrinhas Dalbulus maidis e de Delphacodes kuscheli. As coletas foram realizadas em três locais casualizados, em cada lavoura, mediante 30 movimentos de coleta, ao longo de um percurso de 10 m, entre duas fileiras de plantas. Os espécimens coletados foram congelados, posteriormente preservados em álcool 70% e examinados sob microscópio estereoscópico para identificação de D. maidis e D. kuscheli.

Na detecção de fitoplasma e espiroplasma, o DNA total usado para amplificação por PCR foi extraído segundo Prince et al. (1993), e foram utilizadas as seguintes condições de reação e oligonucleotídeos para detecção de "Maize bushy stuntphytoplasma": MBSF1 5' AATGTCGAACTAACAGGCGG 3', e MBSR1 5' GGTTTTGGTTTAGGGGTT 3', conforme Harrison et al. (1996). Nas seis amostras com sintomas atípicos de MBSP, a detecção de fitoplasma foi testada também utilizando-se condições de reação e os oligonucleotídeos R16F2 5' ACGACTGCTGCTAAGACTGG 3'e R16R0 5' TGA CGGGCGGTGTGTACAAACCCCG 3', descritos por Lee et al. (1993). A detecção de espiroplasma foi feita utilizando-se condições de reação e oligonucleotídeos CSSF2 5' GGCAAAAGATGTAACAAAAGT 3' e CSSR6 5' GTTTACTTCAACAGTAGTTGCG 3', segundo Barros et al. (2001).

As amostras das plantas analisadas foram também fixadas em tampão de Milloning, contendo 2,5% de glutaraldeído, pós-fixadas em tetróxido de ósmio 1%, desidratadas em série álcoolacetona, incluídas em resina Spurr, contrastadas com citrato de chumbo, após secção em ultramicrótomo e observadas ao microscópio eletrônico de transmissão para verificar a presença de molicutes (Hayat, 1989).

Na detecção de MDMV e do MRFV, a extração de dsRNA foi feita conforme Valverde et al. (1990). Na amplificação via RTPCR do MDMV, foram utilizados os oligonucleotídeos MDMV2 5' TATTCCATCAGTCGGGAACTG 3' e MDMV3 5' ACGAGGTAAAACCTCAC 3', seguindo-se o pro-tocolo descrito por Almeida et al. (2000). Na MRFV, foram utilizados os oligonucleotídeos MRFV09 5' CCTCTTCCTGATCCTCCTCGTGTGCTGGAGACG 3' e MRFV10, 5' GCCCACAGGTCTTATGGCCGACCTGCTACC 3', segundo Hammond et al.(1997).

Na detecção de MRCV por DASELISA, amostras de folhas foram maceradas em tampão PBS + 0,05% de Tween 20, seguindo-se o procedimento para o teste DASELISA, conforme Giménez Pecci et al. (1991), utilizando-se IgG anti-MRCV, produzida no INTA, Córdoba.

A perda potencial causada por enfezamentos na cultura do milho safrinha foi estimada utilizando-se os resultados obtidos na incidência média dessas doenças na região, informações referentes às estimativas de danos causados por essas doenças, informações do DERAL referentes à área plantada e produtividade média do milho safrinha de 2000 no Estado do Paraná, e o preço de comercialização do produto em junho de 2000.

 

Resultados e Discussão

A presença de plantas com sintomas de enfezamentos causados por molicutes foi constatada em todas as lavouras de milho amostradas, enquanto a presença de plantas com sintomas de vírus ficou restrita a apenas cinco lavouras (Tabela 1). Esses resultados evidenciam que, atualmente, as doenças causadas por molicutes representam problema mais importante que as viroses, na cultura do milho safrinha, no Estado do Paraná. Os sintomas de enfezamentos caracterizaram-se principalmente pelo avermelhamento das folhas das plantas em intensidade variável em diferentes cultivares. Não foram observadas plantas apresentando faixas esbranquiçadas estendendo-se a partir da base das folhas, sintoma característico e diagnóstico de plantas infectadas por espiroplasma. Contudo, com base apenas nos sintomas observados, não seria possível ter certeza se as plantas estariam infectadas por fitoplasma, por espiroplasma ou por ambos. Algumas vezes foi observada proliferação de espigas associada aos sintomas de avermelhamento foliar.

 

 

Não foram encontradas plantas de milho apresentando sintomas típicos do MRCV, que se caracteriza pela presença de enações sobre as nervuras na face inferior das folhas, associada ao nanismo acentuado e a deformações foliares. O resultado do teste DASELISA para detecção do MRCV, feito nas 441 amostras de plantas que apresentavam acentuado nanismo e deformações foliares, sem presença de enações, foi negativo, confirmando a ausência desse vírus no milho safrinha. Porém, considera-se relevante a realização de outras avaliações, particularmente na safra de verão, visando a adoção de medidas de erradicação imediata, caso esse vírus venha a ser detectado.

Em todas as plantas com sintomas do MDMV e do MRFV, foi confirmada a presença desses vírus, cuja incidência foi inferior a 0,66%, ou seja, o menor nível detectável, pois apenas uma planta apresentou sintoma, num total de 150 plantas avaliadas nos três pontos de amostragem. A virose mosaico-comum geralmente ocorre em surtos, sendo favorecida pela presença de fonte de inóculo proporcionada por gramíneas infectadas, presença de afídeos vetores, suscetibilidade da cultivar e por plantios tardios da safra de verão (Almeida, 1999). Não foi observada a presença de gramíneas silvestres apresentando sintomas dessa virose, as quais poderiam constituir fonte de inóculo para o milho, podendo ser essa a razão da baixa incidência detectada. A incidência do MRFV também pode ser variável, em razão do local e data de plantio (Waquil et al., 1996).

Os níveis de incidência de enfezamento nas lavouras avaliadas variaram de 6,2% a 49,9% de plantas com sintomas, com média de 20,7% (Tabela 1). Considerando-se que estas doenças reduzem, em média, 50% na produção do milho (Massola Júnior et al., 1999) e que a área plantada com milho safrinha no Paraná, em 2000, foi da ordem de 693.478 hectares, para uma produtividade média de 43 sacas por hectare (Paraná, 2002), foi feita uma estimativa de perdas causadas por essas doenças. Considerando-se o preço médio de US$ 5,5 por saca de milho, estimou-se que o potencial de perdas causadas pelos enfezamentos na cultura do milho safrinha no Estado do Paraná foi, aproximadamente, 16,5 milhões de dólares. Com base nessa estimativa, um significativo aumento de lucratividade poderia ser obtido com o controle dessas enfermidades na cultura do milho, resultando em aumento imediato dos níveis atuais de produtividade de grãos.

Por meio de PCR, foi confirmada a presença de fitoplasma em amostras de plantas com sintomas de enfezamentos. Porém, das 46 amostras analisadas, em apenas oito detectou-se a presença desse patógeno. Estas mesmas amostras, quando submetidas a PCR para detecção de espiroplasma, apresentaram resultado negativo, que pode ser atribuído às limitações observadas anteriormente na detecção de molicutes em amostras provenientes do campo, em virtude, provavelmente, do baixo título e distribuição desuniforme desses patógenos nas plantas (Oliveira et al., 1998). Contudo, esses resultados sugerem predominância de fitoplasma em relação a espiroplasma, aspecto importante, considerando-se que os mecanismos de resistência de cultivares de milho a esses patógenos, ainda pouco conhecidos, podem ser provavelmente diferenciados, além da necessidade de elucidação dos fatores epidemiológicos que podem favorecer ou limitar a ocorrência geográfica diferenciada.

A presença da cigarrinha D. maidis foi confirmada em todas as lavouras avaliadas, constituindo 66,6% do total de espécimens de cigarrinhas coletados em 20 lavouras (Figura 1). A ampla distribuição desse inseto vetor de molicutes, no Estado do Paraná, pode explicar a ampla ocorrência e disseminação dos enfezamentos causados por molicutes na região. Por outro lado, a cigarrinha D. kuscheli não foi encontrada entre os espécimens de cigarrinhas coletados, confirmando-se, indiretamente, a ausência do MRCV.

 

 

Seis amostras de plantas com sintomas que se caracterizam por nanismo acentuado, folhas estreitas, enrijecidas, com deformações, e presença de grãos na inflorescência, quando submetidas à PCR para detecção de fitoplasma, utilizando-se oligonucleotídeos específicos para detecção de "Maize bushy stunt phytoplasma" (Harrison et al., 1996), apresentaram resultado negativo. Porém, quando estas mesmas amostras foram submetidas a PCR para detecção de fitoplasma, utilizando-se os primers universais R16F2 e R16R0 (Lee et al., 1993), duas amostras apresentaram resultado positivo. Esse resultado sugere tratar-se de um fitoplasma distinto de "Maizebushy stunt phytoplasma", havendo necessidade de mais estudos para confirmação e caracterização do possível agente etiológico distinto. Entretanto, a análise de quatro outras amostras de plantas com esses mesmos sintomas, através da microscopia eletrônica de transmissão, não permitiu a visualização de fitoplasma, o que também poderia ser explicado pela distribuição desuniforme do patógeno nas plantas. As plantas com esses sintomas foram sempre encontradas em grupos de quatro ou cinco, entre as plantas normais das lavouras, descartando-se por isso, a hipótese de tratar-se de alguma anomalia genética, cuja distribuição esperada nas lavouras seria casual, uniforme e rara.

 

Conclusões

1. Os enfezamentos causados por molicutes ocorrem com alta incidência na cultura do milho safrinha, no Estado do Paraná.

2. O "Maize rayado fino virus" e o "Maize dwarf mosaic virus" estão presentes na cultura do milho safrinha, no Estado do Paraná, em baixos níveis de incidência.

3. O "Mal de Río Cuarto virus" não é detectado na cultura do milho safrinha, no Estado do Paraná.

4. Há incidência maior de Dalbulus maidis em relação a outras espécies de cigarrinhas coletadas nas lavouras do Estado do Paraná.

 

Agradecimentos

À Vitae, ao Prodetab e ao convênio Capes (Brasil)/SeTCIP (Argentina), pelo apoio financeiro; à Dow Agroscience Sementes, pela colaboração na localização das lavouras de milho em estádio adequado para avaliação, dentro da área geográfica amostrada.

 

Referências

ALMEIDA, A. C. L. Detecção, caracterização e aspectos epidemiológicos do complexo viral do mosaico comum do milho (Zea mays L.). 1999. 83 f. Dissertação (Mestrado em Fitopatologia) – Universidade de Brasília, Brasília, 1999.        [ Links ]

ALMEIDA, A. C. L.; OLIVEIRA, E.; RESENDE, R. O. Detecção de vírus por RTPCR, hibridização "dotblot" e dotELISA em milho. Fitopatologia Brasileira, Brasília, v. 25, n. 2, p. 168-174, 2000.        [ Links ]

BALMER, E. Doenças do milho. In: GALLI, F. (Coord.). Manual de fitopatologia:doenças das plantas cultivadas. São Paulo: Agronômica Ceres, 1980. p. 371-391.        [ Links ]

BARROS, T. S. L.; DAVIS, R. E.; RESENDE, R. O.; DALLY, E. L. Design of a polymerase chain reaction for specific detection of corn stunt spiroplasma, Spiroplasma kunkelii. Plant Disease, St. Paul, v. 85, p. 475-480, 2001.        [ Links ]

GIMÉNEZ PECCI, M. P.; CONCI, L. R.; VALDIVIA, B.; CONCI, V. C.; HOOP, H. E.; LAGUNA, I. G.; NOME, S. F. Algunas alternativas de diagnóstico del virus del "Mal de Río Cuarto" (Maize Rough Dwarf Virus MRDV). In: TALLER DE ACTUALIZACIÓN SOBRE MAL DE RÍO CUARTO, 1991, Pergamino. Actas... Pergamino: Instituto Nacional de Tecnología Agropecuaria, 1991. p. 78-86.        [ Links ]

GORDON, D. T.; KNOKE, J. K.; SCOTT, G. E. Virus and viruslike diseases of maize in the United States. Wooster: Ohio Agricultural Research and Development Custer, 1981. 210 p.        [ Links ]

HAMMOND, R. W.; KOGEL, R.; RAMIREZ, P. Variability of geographically distinct isolates of maize rayado fino virus in Latin America. Journal of General Virology, Reading, v. 78, p. 3153-3159, 1997.        [ Links ]

HARRISON, N. A.; RICHARDSON, P. A.; TSAI, J. H. PCR assay for detection of the phytoplasma associated with maize bushy stunt disease. Plant Disease, St. Paul, v. 80, n. 3, p. 263-269, 1996.        [ Links ]

HAYAT, M. A. Principles and techniques of electron microscopy:biological applications. 3rd ed. Boca Raton: CRC Press, 1989. 469 p.        [ Links ]

LEE, I. M.; HAMMOND, R. W.; DAVIS, R. E.; GUNDERSEN, D. E. Universal amplification and analysis of pathogen 16S rDNA for classification and identification of mycoplasmalike organisms. Phytopathology, St. Paul, v. 83, n. 8, p. 834-842, 1993.        [ Links ]

LENARDON, S. L.; MARCH, G. J. Recent outbreak of "Mal de Río Cuarto" virus on corn in Argentina. Plant Disease, St. Paul, v. 82, n. 4, p. 448, 1998.        [ Links ]

MASSOLA JÚNIOR, N. S.; BEDENDO, I. P.; AMORIM, L.; LOPES, J. R. S. Quantificação de danos causados pelo enfezamento vermelho e enfezamento pálido do milho em condições de campo. Fitopatologia Brasileira, Brasília, v. 24, n. 2, p. 136-142, 1999.        [ Links ]

OLIVEIRA, E.; WAQUIL, J. M.; FERNANDES, F. T.; PAIVA, E.; RESENDE, R. O.; KITAJIMA, W. E. Enfezamento pálido e enfezamento vermelho na cultura do milho no Brasil Central. Fitopatologia Brasileira, Brasília, v. 23, n. 1, p. 45-47, 1998.        [ Links ]

ORNAGHI, J. A.; MARCH, G. J.; BOITO, G. T.; MARINELLI, A.; BEVIACQUA, J.; GIUGGIA, J.; LENARDON, S. L. Infectivity in natural populations of Delphacodes Kuscheli vector of "Mal de Río Cuarto" virus. Maydica, Bergamo, v. 44, p. 15, 1999.        [ Links ]

PARANÁ. Secretaria da Agricultura e do Abastecimento. Departamento de Economia Rural. Produção agrícola e pecuária municipal. Disponível em: <http://www.pr.gov.br/seab/deral/epepr.xls> Acesso em: 15 ago. 2002.        [ Links ]

PINTO, N. F. J.; FERNANDES, T. F.; OLIVEIRA, E. Milho. In: VALE, F. R.; ZAMBOLIM, L. (Ed.). Controle de doenças das plantas: grandes culturas. Viçosa, MG: UFV, 1997. v. 1, p. 821-863.        [ Links ]

PRINCE, J. P.; DAVIS, R. E.; WOLF, T. K.; LEE, I. M.; MOGEN, B. D.; DALLY, E. L.; BERTACCINI, A; CREDI, R.; BARBA, M. Molecular detection of diverse mycoplasmalike organisms (MLOs) associated with grapevine yellows and their classification with aster yellows, Xdisease and elm yellows MLOs. Phytopathology, St. Paul, v. 83, p. 1130-1137, 1993.        [ Links ]

VALVERDE, R. A.; NAMETH, S. T.; JORDAN, R. L. Analysis of doublestranded RNA for plant virus diagnosis. Plant Disease, St. Paul, v. 74, n. 3, p. 255-258, 1990.        [ Links ]

WAQUIL, J. M.; OLIVEIRA, E.; PINTO, N. F. J. A.; FERNANDES, F. T.; CORREIA, L. A. Viroses em milho: incidência e efeito na produção. Fitopatologia Brasileira, Brasília, v. 21, p. 460-463, 1996.        [ Links ]

 

 

Endereço para correspondência
Elizabeth de Oliveira
E-mail:
beth@cnpms.embrapa.br

Ivan Cruz
E-mail:
ivancruz@cnpms.embrapa.br

Renato de Oliveira Resende
E-mail:
rresende@unb.br

María de la Paz Giménez Pecci
E-mail:mpazg@correo.inta.gov.ar

Irma Graciela Laguna
E-mail:
gralaguna@hotmail.com

Patricia Herrera
E-mail:
pherrera@correo.inta.gov.ar

 Aceito para publicação em 20 de agosto de 2002

 

 

1 Aceito para publicação em 20 de agosto de 2002.

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License