SciELO - Scientific Electronic Library Online

 
vol.40 issue12Larvicidal potential of Sapindus saponaria to control the cattle tick Boophilus microplusVariation of seed lipid content among Coffea canephora varieties author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

Share


Pesquisa Agropecuária Brasileira

Print version ISSN 0100-204XOn-line version ISSN 1678-3921

Pesq. agropec. bras. vol.40 no.12 Brasília Dec. 2005

http://dx.doi.org/10.1590/S0100-204X2005001200014 

NOTAS CIENTÍFICAS

 

Reação em cadeia da polimerase para detecção de Clostridium chauvoei em tecidos de Cavia porcellus

 

PCR detection of Clostridium chauvoei in tissues of Cavia porcellus

 

 

Ronnie Antunes de AssisI; Francisco Carlos Faria LobatoI; Mariano Fernandez MiyakawaII; Francisco Alejandro UzalII

IUniversidade Federal de Minas Gerais, Escola de Veterinária, Av. Antônio Carlos, nº 6627, Pampulha, Caixa Postal 567, CEP 30123-970 Belo Horizonte, MG, Brasil. E-mail: assisra@rwnet.com.br, flobato@vet.ufmg.br
IIInstituto Nacional de Tecnologia Agropecuária, CC 277 (8400) Bariloche, Argentina. E-mail: mmiyakaw@cvdls.ucdavis.edu, fauzal@ucdavis.edu

 

 


RESUMO

O objetivo deste trabalho foi padronizar uma técnica de reação em cadeia da polimerase (PCR), para detecção de Clostridium chauvoei, em tecidos fixados em formol e incluídos em parafina de cobaias (Cavia porcellus) experimentalmente infectadas com esse microrganismo. Os animais foram sacrificados, e amostras do músculo da área de inoculação (MAI), fígado, miocárdio e baço foram disponibilizadas para a técnica de PCR. O clostrídio foi detectado em todas as secções do MAI, fígado e miocárdio, mas não foi observado em secções do baço. Reações cruzadas não foram observadas a partir de secções do MAI dos animais com inoculação de outras espécies de clostrídios, bem como nenhuma amplificação foi observada a partir de secções do MAI dos animais controle. Esses resultados mostram que a técnica de PCR desenvolvida neste estudo, pode ser usada para detecção de Clostridium chauvoei em tecidos fixados em formol e incluídos em parafina.

Termos para indexação: carbúnculo sintomático, edema maligno.


ABSTRACT

The objective of this work was the standardization of a polymerase chain reaction (PCR) for detection of Clostridium chauvoei in formalin-fixed, paraffin-embedded tissues of guinea-pigs (Cavia porcellus) infected experimentally with this microorganism. The animals were sacrificed, and samples of muscle from inoculation area (MIA), liver, myocardium and spleen were available for PCR technique. Clostridium chauvoei was detected in all sections of the MIA, liver and myocardium, and no product was observed in sections of the spleen. Cross-reactions were not observed in sections of MIA of the animals inoculated with other clostridia, as well as no amplification was observed in sections of MIA of control animals. These results show that the PCR technique developed in this study may be useful for detection of C. chauvoei in formalin-fixed, paraffin-embedded tissues.

Index terms: blackleg, malignant edema.


 

 

A bactéria Clostridium chauvoei é o agente etiológico do carbúnculo sintomático, uma doença altamente fatal dos ruminantes e outras espécies animais, que geralmente acomete a musculatura. O carbúnculo sintomático deve ser diferenciado do edema maligno, outra doença letal de diferentes espécies animais, que é causada principalmente pelo Clostridium septicum, e pode, também, ter como agentes etiológicos C. chauvoei, C. sordellii, C. novyi tipo A e C. perfringens tipo A; o edema maligno ocorre isoladamente ou em associações (Sterne & Batty, 1975).

No Brasil, a maioria dos diagnósticos do carbúnculo sintomático e do edema maligno são baseados apenas em aspectos presuntivos, dados clínicos e achados de necropsia (Assis et al., 2002). Tradicionalmente, a confirmação do diagnóstico dessas enfermidades é baseada no cultivo e isolamento dos microrganismos envolvidos (Correa et al., 1980; Baldassi et al., 1985). Entretanto, esses procedimentos podem apresentar dificuldades relacionadas à obtenção, submissão e processamento dos espécimes clínicos em laboratório. Outros entraves relacionam-se à diferenciação entre C. chauvoei e C. septicum, em razão da similaridade dos caracteres morfológicos e bioquímicos desses microrganismos (Sterne & Batty, 1975), e ao tempo necessário para o cultivo e isolamento, que é de quatro dias a uma semana para ser completado (Assis et al., 2001). Portanto, um diagnóstico preciso de C. chauvoei, apenas por meio de cultivo, é freqüentemente difícil (Kuhnert et al., 1997).

A técnica de imunofluorescência direta (IFD) é freqüentemente empregada (padrão ouro) no diagnóstico definitivo dos agentes envolvidos, nos quadros de carbúnculo sintomático e edema maligno, em impressões obtidas diretamente dos materiais suspeitos e em esfregaços de cultivos puros (Batty & Walker, 1963; Pinto & Abreu, 1992; Assis et al., 2001), entretanto, essa técnica requer materiais frescos, bem como equipamentos e reagentes não disponíveis usualmente na maioria dos laboratórios.

A técnica de reação em cadeia da polimerase (PCR) está livre da maioria dos problemas mencionados acima e tem sido usada para identificar diferentes microrganismos, até mesmo clostrídios causadores do carbúnculo sintomático e edema maligno, em cultivos e espécimes clínicos a fresco (Kuhnert et al., 1997; Takeuchi et al., 1997; Sasaki et al., 2000; Kojima et al., 2001), e para detecção de C. chauvoei em tecidos de ovinos fixados em formol e incluídos em parafina (Uzal et al., 2003). Essa técnica poderá ser particularmente útil em áreas onde o cultivo de anaeróbios não está disponível e em tecidos fixados em formol. Pelo fato de diferentes espécies animais serem acometidas pelo C. chauvoei, a utilização dessa técnica como instrumento diagnóstico é altamente desejável.

O objetivo deste trabalho foi estudar a aplicação da técnica de PCR, para amplificação do gene que codifica a subunidade 16S  rRNA de C. chauvoei, a fim de se detectar esse microrganismo em tecidos de cobaias (Cavia porcellus) fixados em formol e incluídos em parafina (TCFP).

Foram usados noventa TCFP de 60  cobaias, que passaram previamente por inoculação intramuscular, na coxa direita, de 0,25 mL de cultura pura de C. chauvoei (ATCC 10092), C. septicum (ATCC 12464), C. sordellii (ATCC 9714), C. novyi tipo A (ATCC 19402) e C. perfringens tipo A (ATCC 3624), com 0,25 mL de uma solução estéril de cloreto de cálcio (CaCl2) a 10%. Utilizaram-se dez animais para cada microrganismo e outras dez cobaias como controle, que passaram por inoculação de 0,25 mL de CaCl2 a 10% com 0,25 mL de caldo Tioglicolato. O músculo da área de inoculação (MAI), coração, baço e fígado foi obtido depois do sacrifício. Quarenta TCFP de C. chauvoei (dez  de cada órgão), bem como dez  TCFP do MAI de cada um dos seguintes agentes: C. septicum, C. sordellii, C. novyi tipo A e C. perfringens tipo A, e outros dez TCFP do MAI dos animais controles foram disponibilizados para avaliação da especificidade. Três secções de 10 mm foram cortadas de cada bloco, usando-se uma nova lâmina de micrótomo cada um deles, e foram colocadas em um tubo de microcentrífuga.

A técnica de PCR foi realizada conforme Uzal et al. (2003). Para extração de DNA, utilizou-se tampão de lise com proteinase K na concentração de 200 mg mL-1 e solução de fenol/clorofórmio na proporção de 1:1 e, para a amplificação, utilizaram-se28  ciclos: um ciclo inicial para desnaturação do DNA de 98ºC por 20  minutos, e 27 ciclos de 93ºC por um  minuto para desnaturação, um minuto a 50ºC para anelamento e dois minutos a 72ºC, para extensão. Utilizou-se um ciclo final de 50ºC por um minuto e 72ºC por cinco minutos. Foram utilizados os seguintes pares de oligos: CC 16S-L: 5'  GTCGAGCGAGGAGAGTTC  3' (Kuhnert et al., 1997) e CC 193-R: 5'  CGGATTGCTCCTTTAATTAC  3' (Uzal et al., 2003), para amplificação de um produto esperado de 159  pb (Uzal et al., 2003).

Quando foi usada a técnica de PCR para os animais infetados com C. chauvoei, o produto de 159  pb foi observado em gel de agarose a  2%, a partir dos dez extratos de DNA do MAI, dez  do fígado e dez  do miocárdio. Nenhum produto foi observado a partir dos dez extratos de DNA do baço. Nenhum amplificado foi observado a partir de extratos de DNA dos animais com inoculação de outros clostrídios, bem como nos extratos de DNA dos animais controle (Figura 1).

 

 

Os resultados obtidos a partir dos extratos de DNA dos diferentes órgãos, provenientes da inoculação com C. chauvoei, poderiam estar relacionados a determinados fatores como a quantidade decrescente de bacilos C. chauvoei nos órgãos, em relação ao músculo da área de inoculação (Tabela 1). Assis et al. (2005) também usaram blocos parafinizados, para defecção imunohistoquímica (IHQ) de C. chauvoei, C. septicum, C. sordellii e C. novyi tipo A, e verificaram que a quantidade de bacilos C. chauvoei, nos diferentes órgãos, foi decrescendo progressivamente a partir do músculo da área de inoculação. Além disso, o fato de os materiais de todos os animais com inoculação de C. chauvoei terem sido positivos pela IHQ (Tabela 1), e o fato de as secções de baço terem sido negativas pela reação em cadeia da polimerase realizada neste estudo, podem ser atribuídos à presença de substâncias inibitórias da PCR (Miller et al., 1997).

 

 

Considerando-se que a técnica de PCR em tecidos fixados em formol e incluídos em parafina (TFIP) tenha sido usada em ovelhas, animais susceptíveis à infecção pelo C. chauvoei (Uzal et al., 2003), é provável que essa técnica possa ser empregada rotineiramente na detecção desses clostrídios em tecidos de outros animais acometidos pelo carbúnculo sintomático e edema maligno.

Como o diagnóstico do carbúnculo sintomático e do edema maligno é geralmente clínico, a PCR para detecção de C. chauvoei em TCFP poderá melhorar, significativamente, a taxa de sucesso no diagnóstico e estabelecer a real prevalência dessas doenças em nosso meio.

Essa técnica pode ser, também, uma valiosa ferramenta para estudos retrospectivos em materiais mantidos em arquivos de Patologia.

 

Agradecimentos

Ao CNPq, pela concessão da bolsa aos dois primeiros autores; à Fapemig e ao Fondo Nacional para la Ciência y la Tecnología (PITC-01-3591, Argentina); ao Ministério da Agricultura, Pecuária e Abastecimento (MAPA), por ceder animais experimentais; à E.N. Vidal (INTA, Bariloche, Argentina), pela assistência técnica; ao Dr. Massami Nakajima (MAPA) e Dr. Eduardo Henrique Moreira Lima, da EV-UFMG, pelo processamento fotográfico.

 

Referências

ASSIS, R.A.; LOBATO, F.C.F.; DIAS, L.D.; UZAL, F.A.; MARTINS, N.E.; SILVA, N. Producción y evaluación de conjugados fluorescentes para diagnóstico de mancha y gangrena gaseosa. Revista de Medicina Veterinaria, v.82, p.68-70, 2001.        [ Links ]

ASSIS, R.A.; LOBATO, F.C.F.; MARTINS, N.E.; NASCIMENTO, R.A.P.; ABREU, V.L.V.; UZAL, F.A. An outbreak of malignant edema in cattle. Revista Portuguesa de Ciências Veterinárias, v.97, p.143-145, 2002.        [ Links ]

ASSIS, R.A.; LOBATO, F.C.F.; SERAKIDES, R.; SANTOS, R.L.; DIAS, G.C.; NASCIMENTO, R.A.P.; ABREU, V.L.V.; PARREIRAS, P.M.; UZAL, F.A. Immunohistochemical detection of Clostridia species in paraffin-embedded tissues of experimentally inoculated guinea pigs. Pesquisa Veterinária Brasileira, v.25, p.4-8, 2005.        [ Links ]

BALDASSI, L.; HIPÓLITO, M.; CALIL, E.M.B.; CHIBA, S.; MOULIN, A.A.P. Observações sobre incidência da gangrena gasosa e do carbúnculo sintomático durante 10 anos, 1970–1979, no Estado de São Paulo. Biológico, v.51, p.161-165, 1985.        [ Links ]

BATTY, I.; WALKER, P.D. Differentiation of Clostridium septicum and Clostridium chauvoei by use of fluorescent labelled antibodies. Journal of Pathology and Bacteriology, v.85, p.517-521, 1963.        [ Links ]

CORREA, W.M.; CORREA, C.N.N.; LOPES, C.A.M.; LANGONI, H.; MODOLO, J.F. Enfermidades por clostrídios 1969–1978 (clostridial diseases 1969–1978). Arquivo Brasileiro de Medicina Veterinária e Zootecnia, v.32, p.369-374, 1980.        [ Links ]

KOJIMA, A.; UCHIDA, I.; SEKIZAKI, T.; SASAKI, Y.; OGIKUBO, Y.; TAMURA, Y. Rapid detection and identification of Clostridium chauvoei by PCR based on flagellin gene sequence. Veterinary Microbiology, v.78, p.363-371, 2001.        [ Links ]

KUHNERT, P.; KRAMPE, M.; CAPAUL, S.E.; FREY, J.; NICOLET, J. Identification of Clostridium chauvoei in cultures and clinical material from blackleg using PCR. Veterinary Microbiology, v.51, p.291-298, 1997.        [ Links ]

MILLER, J.; JENNY, A.; RHYAN, J.; SAARI, D.; SUAREZ, D. Detection of Mycobacterium bovis in formalin-fixed, paraffin-embedded tissues of cattle and elk by PCR amplification of an IS6110 sequence specific of Mycobacterium tuberculosis complex organisms. Journal of Veterinary Diagnostic Investigation, v.9, p.244-249, 1997.        [ Links ]

PINTO, M.P.; ABREU, V.L.V. Comparação de técnicas para preparo de conjugados anti-Clostridium septicum e anti-Clostridium chauvoei. Arquivo Brasileiro de Medicina Veterinária e Zootecnia, v.44, p.513-520, 1992.        [ Links ]

SASAKI, Y.; YAMAMOTO, K.; KOJIMA, A.; TETSUKA, Y.; NORIMATSU, M.; TAMURA, Y. Rapid and direct detection of Clostridium chauvoei by PCR of the 16S-23S rDNA spacer region and partial 23S rDNA sequences. Journal of Veterinary Medical Science, v.62, p.1275-1281, 2000.        [ Links ]

STERNE, M.; BATTY, I. Pathogenic clostridia. London: Butterworths, 1975. 144p.        [ Links ]

TAKEUCHI, S.; HASHIZUME, N.; KINOSHITA, T.; KAIDOH, T.; TAMURA, Y. Detection of Clostridium septicum hemolysin gene by polymerase chain reaction. Journal of Veterinary Medical Science, v.59, p.853-855, 1997.        [ Links ]

UZAL, F.A.; HUGENHOLTZ, P.; BLACKALL, L.L.; PETRAY, S.; MOSS, S.; ASSIS, R.A.; FERNANDEZ MIYAKAWA, M.; CARLONI, G. PCR detection of Clostridium chauvoei in pure cultures and in formalin-fixed, paraffin-embedded tissues. Veterinary Microbiology, v.91, p.239-248, 2003.        [ Links ]

 

 

Recebido em 7 de outubro de 2004 e aprovado em 5 de maio de 2005

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License