SciELO - Scientific Electronic Library Online

 
vol.48 número3Associação de marcadores microssatélites com teores de óleo e proteína em sojaCaracterização molecular de cultivares de soja por meio de marcadores microssatélites com sequência de cauda universal índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Artigo

Indicadores

Links relacionados

  • Não possue artigos similaresSimilares em SciELO

Compartilhar


Pesquisa Agropecuária Brasileira

versão impressa ISSN 0100-204X

Pesq. agropec. bras. vol.48 no.3 Brasília mar. 2013

http://dx.doi.org/10.1590/S0100-204X2013000300004 

GENÉTICA

 

Associação de marcadores moleculares SNP com o conteúdo de ácido linolênico em sementes de soja

 

Association of SNP markers with the linolenic acid content in soybean seeds

 

 

Marcos de Oliveira PintoI; Pedro Ivo Vieira Good‑GodII; Maurílio Alves MoreiraIII; Everaldo Gonçalves de BarrosIV

IEmbrapa Milho e Sorgo, Rodovia MG 424, Km 65, CEP 35701‑970 Sete Lagoas, MG. E‑mail: marcosbqiufv@yahoo.com.br
IIUniversidade Federal de Viçosa (UFV), Campus Rio Paranaíba, Rodovia MG 230, Km 7, Caixa Postal 22, CEP 38810‑000 Rio Paranaíba, MG. E‑mail: pedro.god@ufv.br
IIIUFV, Departamento de Bioquímica e Biologia Molecular, Avenida P.H. Rolfs, s/nº, CEP 36570‑000 Viçosa, MG. E‑mail: moreira@ufv.br
IVUFV, Departamento de Biologia Geral, Viçosa, MG. E‑mail: ebarros@ufv.br

 

 


RESUMO

O objetivo deste trabalho foi validar a associação de marcadores moleculares do tipo "single nucleotide polymorphism" (SNP) para os genes FAD3A, FAD3B e FAD3C com o conteúdo de ácido linolênico (18:3) em sementes de soja e analisar a influência dos parâmetros genéticos destes marcadores nesta característica. Foram genotipadas 185 progênies F2 derivadas do cruzamento entre A29 (mutante para os três genes FAD3, 1% de 18:3) e Tucunaré (genótipo selvagem, 11% de 18:3). Os marcadores moleculares para os genes FAD3A, FAD3B e FAD3C explicaram a variação do conteúdo de 18:3 nas populações segregantes F2 e F2:3. Além disso, as substituições alélicas no loco FAD3A proporcionam maiores variações no conteúdo de 18:3 que as substituições nos outros dois locos.

Termos para indexação: Glycine max, FAD3A, FAD3B, FAD3C, 18:3, substituição alélica.


ABSTRACT

The objective of this work was to validate the association of single nucleotide polymorphism (SNP) markers for the genes FAD3A, FAD3B, and FAD3C with the linolenic acid content (18:3) in soybean seeds and to analyze the influence of the genetic parameters of these markers on this trait. One hundred and eighty‑five F2 progenies derived from a cross between A29 (mutant for the three FAD3 genes, 1% 18:3 content) and Tucunaré (wild‑type genotype, 11% 18:3 content) were genotyped. The molecular markers for genes FAD3A, FAD3B, and FAD3C explained the variations in 18:3 content of the F2 and F2:3 segregating populations. In addition, allelic substitutions in the FAD3A locus provide greater variations in 18:3 content than substitutions in the other two loci.

Index terms: Glycine max, FAD3A, FAD3B, FAD3C, 18:3, allelic replacement.


 

 

Introdução

As propriedades físico‑químicas e biológicas do óleo são diretamente afetadas pela sua composição de ácidos graxos. A grande diversificação na utilização do óleo de soja [Glycine max (L.) Merr.] tem demandado o desenvolvimento de genótipos com composição modificada de ácidos graxos, mais adequada a cada tipo de produto. Em razão da baixa estabilidade oxidativa do ácido linolênico (18:3), há interesse no desenvolvimento de genótipos de soja que apresentem baixos teores deste ácido, principalmente para aplicações na indústria alimentícia e na produção de biodiesel (Gerde et al., 2007; Knothe, 2007; Farhoosh et al., 2009; Ramos et al., 2009; Santos et al., 2013).

A síntese de 18:3 é catalisada por ω‑3‑dessaturases, tendo o ácido linoleico (18:2) como substrato (Baud & Lepiniec, 2010). Três genes (FAD3A, FAD3B e FAD3C) que codificam ω‑3‑dessaturases afetam diretamente o acúmulo de 18:3 em sementes de soja (Bilyeu et al., 2003). Genótipos mutantes, com baixos teores de 18:3, já tiveram os alelos do gene FAD3A bem caracterizados, o que tem permitido o desenvolvimento de marcadores moleculares do tipo "single nucleotide polymorphism" (SNP).

Bilyeu et al. (2003) caracterizaram os três genes (FAD3A, FAD3B e FAD3C) responsáveis pelo conteúdo de 18:3 em sementes de soja. No gene FAD3A da linhagem A5, foi identificada uma deleção que permite distinguir o alelo mutante dos alelos para conteúdo normal de 18:3. Os SNPs nos genes FAD3B e FAD3C de A29 foram posteriormente caracterizados por Bilyeu et al. (2006), o que permitiu o desenvolvimento de marcadores moleculares do tipo PCR‑RFLP específicos para os alelos de A29. O acesso PI 361088B (3,8% de 18:3) apresenta inserção de dois resíduos de timina na posição 310 do gene FAD3A, o que muda o quadro de leitura e faz com que surja um códon de parada prematuro na posição 328. A mutação no genótipo M5 (3,3% de 18:3) é similar à de PI 3661088B, também com uma mudança no quadro de leitura; no entanto, neste caso, ocorre a deleção de 19 nucleotídeos na posição 1057, o que resulta em uma proteína com 25 resíduos de aminoácidos a mais na extremidade C‑terminal. O genótipo CX1512‑44 (3% de 18:3) apresenta uma mutação de apenas um par de nucleotídeos na posição 811, exatamente no sítio de recomposição eucariótica ("splicing"), o que leva à formação de uma proteína com estrutura alterada. O genótipo C1640 (3,7% de 18:3) também apresenta mutação com troca de bases, mas esta se encontra em região codificadora: o códon para triptofano (TGG) no éxon 6 é modificado para um códon de parada (TGA) (Chappell & Bilyeu, 2007).

Com base em sequências genômicas do genótipo A29 (1% de 18:3), foi possível o desenvolvimento de marcadores moleculares do tipo SNP para alelos dos genes FAD3A, FAD3B e FAD3C (Bilyeu et al., 2006). A utilização de marcadores moleculares associados a esses genes é promissora para a seleção de genótipos superiores com reduzidos teores de 18:3 (Bilyeu et al., 2005, 2006, 2011; Reinprecht et al., 2009).

Um dos principais objetivos em programas de melhoramento da qualidade de sementes de soja é aumentar a estabilidade oxidativa do óleo, principalmente pela redução do conteúdo de 18:3 (Wilson, 2004; Mahmoud et al., 2006; Fehr, 2007). A composição final de ácidos graxos é influenciada pelo ambiente, por fatores genéticos e pela interação entre ambos. Vários fatores têm sido citados como indutores de alterações no processo de biossíntese de lipídeos, entre os quais se destaca a temperatura de cultivo durante o enchimento das sementes. O aumento da temperatura de cultivo da soja normalmente provoca aumento no conteúdo de 18:1 e redução nos conteúdos de 18:2 e 18:3 (Oliva et al., 2006; Bachlava & Cardinal, 2009). Dessa forma, em razão do pronunciado efeito ambiental, a utilização de marcadores moleculares pode acelerar o processo de obtenção de genótipos superiores, com reduzidos teores de 18:3 (Xu & Crouch, 2008).

O conteúdo de 18:3, além de ser influenciado pelo ambiente, também pode ser determinado pelo "background" genético. Portanto, para a utilização de marcadores SNP na seleção assistida por marcadores, com vistas à redução de 18:3, é fundamental verificar a associação dos SNPs já relatados (Bilyeu et al., 2006) nas populações segregantes obtidas a partir de genótipos elites adaptados às condições de cultivo do Brasil.

O objetivo deste trabalho foi validar a associação de marcadores moleculares do tipo SNP para os genes FAD3A, FAD3B e FAD3C com o conteúdo de ácido linolênico (18:3) em sementes de soja e analisar a influência dos parâmetros genéticos destes marcadores nesta característica.

 

Material e Métodos

Foram utilizados os genótipos A29 e Tucunaré, além das populações segregantes derivadas de seu cruzamento. A cultivar Tucunaré, desenvolvida pela Fundação Mato Grosso, é amplamente cultivada no Brasil Central e apresenta elevado conteúdo de óleo, com aproximadamente 11% de 18:3. Já o genótipo A29, desenvolvido por pesquisadores da Universidade Estadual de Iowa, EUA, apresenta apenas 1% de 18:3 e foi utilizado como fonte doadora de genes para baixos teores desse ácido. O genótipo A29 foi obtido pela combinação de três mutações independentes: fan da linhagem A5, fan2 da linhagem A23 e fan3 da linhagem A89‑144003 (Bilyeu et al., 2006).

Para a obtenção das populações segregantes, inicialmente foram efetuados cruzamentos entre A29 x 'Tucunaré'. O híbrido F1 foi autofecundado, tendo-se obtido 185 progênies F2; esse material foi novamente autofecundado para obtenção da população F2:3.

A extração dos ácidos graxos das sementes de soja e sua derivatização a metil‑ésteres de ácidos graxos foram realizadas seguindo metodologia descrita por Jham et al. (1982). Foram determinados os conteúdos dos ácidos graxos nas variedades A29 e Tucunaré, bem como nos indivíduos das populações segregantes nas gerações F2 e F2:3.

O DNA de folha dos parentais e dos 185 indivíduos da população F2 foi extraído (Doyle & Doyle, 1990), e a genotipagem foi realizada seguindo os procedimentos descritos por Bilyeu et al. (2005).

Os iniciadores utilizados para a amplificação de segmentos dos genes foram: FAD3A Forward 5' TTGCATCACCATGGTCATCAT 3'; FAD3A  Reverse 5' AGCTATTATCTAGCATTAACCTCA 3'; FAD3B Forward 5' AGCCACAGAACTCACCATCAA 3', FAD3B Reverse 5' TGGCACAGTGAATCTAATG 3'; FAD3C Forward 5' TTGGATCAACAACATTCACCA 3' e FAD3C Reverse 5' CATCACATGTTTGTGGTCTTGA 3'. As reações de PCR foram conduzidas com 30 ciclos, constituídos da seguinte sequência: 30 s a 94ºC, 30 s a 55ºC e 30 s a 72ºC. Após os 30 ciclos, realizou-se uma etapa de extensão final de 7 min a 72ºC, e, finalmente, a temperatura foi reduzida a 4ºC. Os produtos da amplificação contidos em 10 μL de cada reação, para os genes FAD3B e FAD3C, foram clivados com enzimas de restrição, para evidenciar o polimorfismo do SNP. Para o gene FAD3B, foi utilizada a enzima HpaI (2,5 U) e, para o gene FAD3C, a enzima BccI (5 U).

Os fragmentos amplificados foram separados por eletroforese em gel não desnaturante de poliacrilamida, a 10%, durante 4 horas, a 120 V. Para a obtenção das imagens, os géis foram corados em solução de brometo de etídio (0,2 mg mL‑1), visualizados sob luz ultravioleta e fotografados com o sistema de fotodocumentação Eagle Eye II (Stratagene, La Jolla, CA, EUA).

As análises estatísticas quanto ao teor de ácidos graxos foram realizadas com o programa Genes (Cruz, 2006). Para analisar a associação dos marcadores com os teores de ácidos graxos, utilizou-se a análise de regressão linear. Para o marcador FAD3A, de natureza dominante, foi utilizado o modelo Yj = βo + β1Xlj + εj, em que: Yj é o valor da característica avaliada no j‑ésimo indivíduo; Xlj é o código do marcador para o j‑ésimo indivíduo; βo é o intercepto da regressão (média da característica); β1 é a inclinação da reta; e εj é o erro aleatório. Para os marcadores FAD3B e FAD3C, de natureza codominante, foi utilizado o modelo Yj = βo + β1X1j + β2X2j + εj, em que: β1 é a inclinação da reta para o efeito aditivo; β2 é a inclinação da reta para o efeito dominante; e εj é o erro aleatório. Foi utilizado o programa GQMOL (Cruz & Schuster, 2012) para análise de associação dos marcadores com as características. O efeito da substituição alélica foi avaliado pelo teste t, a partir das diferenças nas médias do conteúdo de 18:3, tendo-se considerado a modificação dos alelos em um gene alvo e a manutenção dos alelos dos outros dois genes.

Utilizou-se a análise de regressão linear múltipla para avaliar os efeitos aditivos e não aditivos, relativos aos marcadores FAD3B e FAD3C avaliados conjuntamente, sobre o conteúdo de ácido linolênico nas gerações F2 e F2:3. Os efeitos lineares e quadráticos, bem como suas interações, permitiram avaliar a ação gênica aditiva dominante e os diferentes tipos de epistasia. Como o marcador FAD3A é de natureza dominante, a análise de regressão foi realizada primeiro para o conjunto de indivíduos A_ e, posteriormente, para o conjunto de indivíduos aa, a fim de remover os efeitos do marcador FAD3A.

 

Resultados e Discussão

O genótipo A29 apresentou baixíssimo conteúdo de 18:3, próximo a 1% (Tabela 1), o que corrobora os resultados obtidos por Bilyeu et al. (2005). Nas populações F2 e F2:3, verificou-se ampla variação no conteúdo dos cinco principais ácidos graxos encontrados no óleo de soja. Merece destaque a amplitude observada no conteúdo de 18:3: de 0,97 a 7,95% na população F2; e de 1,23 a 11,94% na população F2:3. Bilyeu et al. (2006) relataram que o genótipo IA3017 apresenta as mesmas mutações para os genes FAD3A, FAD3B e FAD3C que o genótipo A29, além de apresentar conteúdo de 18:3 de aproximadamente 1%. Segundo estes autores, o conteúdo de 18:3 determinado na população segregante RC1F2 derivada do retrocruzamento com o genótipo SS97‑6946 (8% de 18:3) apresentou variação de 10 a 1%, amplitude similar à encontrada no presente trabalho.

 

 

As correlações fenotípicas entre o conteúdo dos ácidos graxos apresentaram valores divergentes (Tabela 2), quando comparados os resultados entre as gerações F2 e F2:3. Entretanto, o sentido e a significância de algumas correlações se mantiveram. A correlação negativa entre 18:3 e 18:1 (r=‑0,2367), detectada na geração F2, não se manteve significativa em F2:3. Nesta geração, o conteúdo de 18:3 correlacionou-se positivamente com o de 18:0 (r=0,2179) e negativamente com o de 18:2 (r=‑0,8465). Neste último caso, destaca-se a elevada magnitude de correlação observada. O conteúdo de 18:3 comumente se correlaciona com os de 18:1 e 18:2 (Fehr, 2007). No entanto, a correlação entre ácidos graxos em sementes de soja é fortemente influenciada por componentes ambientais (Carrera et al., 2011), o que está de acordo com as variações obtidas para as estimativas das correlações fenotípicas.

 

 

Na análise de regressão linear, constatou-se que, para a geração F2, apenas o conteúdo de 18:3 é significativamente influenciado pelos genes FAD3A, FAD3B e FAD3C (Tabela 3). O marcador FAD3A explicou 21,92% da variação do conteúdo de 18:3, enquanto os marcadores FAD3B e FAD3C explicaram 4,01 e 11,90%, respectivamente. Foi observado efeito genético aditivo predominante para os marcadores relativos aos genes FAD3B e FAD3C, sem que se detectasse qualquer efeito relacionado aos desvios causados pela dominância.

Na geração F2:3, verificou-se que os conteúdos de 18:2 e 18:3 foram significativamente influenciados pelos três genes FAD3 (Tabela 3). O marcador FAD3A explicou 21,87% da variação no conteúdo de 18:2 e 30,33% da variação no conteúdo de 18:3. Os marcadores FAD3B e FAD3C explicaram, respectivamente, 5,74 e 9,04% da variação no conteúdo de 18:2, e 6,39 e 18,96% da variação no conteúdo de 18:3. Novamente, o efeito genético aditivo predominante foi detectado para os marcadores relativos aos genes FAD3B e FAD3C.

Segundo Cardinal et al. (2011), marcadores moleculares para os alelos do gene FAD3A do genótipo PI 123440 permitem explicar mais de 77,5% da variação no conteúdo de 18:3 em populações segregantes. Portanto, pode-se confirmar forte influência do produto do gene FAD3A na biossíntese desse ácido graxo.

Cruzamentos que envolvem linhagens mutantes com teores modificados de ácidos graxos evidenciam herança simples para esta característica, possivelmente pela ação de genes de efeito maior (Primomo et al., 2002; Anai et al., 2005). Entretanto, estudos mais recentes têm mostrado que a herança dos conteúdos de ácidos graxos é de natureza quantitativa (Bachlava et al., 2009; Xie et al., 2012; Wang et al., 2012).

As diferenças médias no conteúdo de 18:3, em consequência das substituições alélicas nos genes FAD3A, FAD3B e FAD3C, avaliadas na população F2/F2:3 derivada do cruzamento entre A29 x 'Tucunaré', são apresentadas nas Tabelas 4, 5 e 6. As substituições gênicas dos alelos em FAD3A proporcionam maiores variações no conteúdo de 18:3 que as substituições alélicas nos demais locos. O gene FAD3B é o que aparentemente leva à menor variação no conteúdo de 18:3, quando suas formas alélicas são alteradas.

 

 

A ação gênica aditiva foi predominante nos marcadores FAD3B e FAD3C, quando seu efeito conjunto no teor de 18:3 foi analisado por meio da regressão linear múltipla (Tabela 7). A ação gênica relativa à dominância somente foi detectada para o marcador FAD3C, em uma única situação. Não foi observada ação gênica epistática para o conteúdo do ácido linolênico. A análise de regressão linear múltipla confirmou os resultados da regressão linear simples, em que a ação gênica aditiva foi predominante. Ao utilizar a informação conjunta dos marcadores FAD3B e FAD3C, foi possível explicar um percentual maior da variação do conteúdo de 18:3, com valores superiores a 20%, se comparado à regressão linear simples. A inclusão do marcador FAD3A certamente aumentou o percentual de variação explicada no conteúdo de 18:3.

 

 

Esses resultados de associação são condizentes com os encontrados em outras populações derivadas de cruzamentos que envolvam os mesmos alelos de A29, como na RC1F2 derivada de SS97‑6946 x (SS97‑6946 x IA3017) de Bilyeu et al. (2006), e alelos diferentes de A29, como em F2 de Williams 82 x 2721 de Bilyeu et al. (2005). Dessa forma, os genes FAD3A, FAD3B e FAD3C contribuem para o conteúdo total de 18:3 em sementes de soja. Além disso, as mutações no gene FAD3A provocam maior efeito na variação do conteúdo de 18:3 que as mutações observadas nos outros dois locos (Bilyeu et al., 2003, 2005, 2006, 2011).

Não foi detectado efeito de "background" genético para os genes FAD3A, FAD3B e FAD3C.

A partir das análises apresentadas, é possível verificar que o conteúdo de 18:3 de variedades adaptadas às regiões brasileiras pode ser manipulado de acordo com a combinação dos diferentes alelos de FAD3A, FAD3B e FAD3C, oriundos do genótipo A29. Com a validação da associação dos marcadores moleculares será possível empregar a seleção assistida por marcadores, a fim de introduzir alelos para baixo conteúdo de 18:3.

 

Conclusões

1. Os genes FAD3A, FAD3B e FAD3C apresentam, predominantemente, ação gênica aditiva no controle do conteúdo de 18:3, em sementes de soja.

2. As substituições alélicas no loco FAD3A propor–cionam maiores variações no conteúdo de 18:3 que as substituições nos locos FAD3B e FAD3C.

3. Os SNPs para os genes FAD3A, FAD3B e FAD3C podem ser utilizados em programas de seleção assistida para baixo conteúdo de ácido linolênico em soja.

 

Agradecimentos

Ao Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), à Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (Capes) e à Fundação de Amparo à Pesquisa do Estado de Minas Gerais (Fapemig), pelo apoio financeiro.

 

Referências

ANAI, T.; YAMADA, T.; KINOSHITA, T.; RAHMAN, S.M.; TAKAGI, Y. Identification of corresponding genes for three low‑α‑linolenic acid mutants and elucidation of their contribution to fatty acid biosynthesis in soybean seed. Plant Science, v.168, p.1615‑1623, 2005. DOI: 10.1016/j.plantsci.2005.02.016.         [ Links ]

BACHLAVA, E.; CARDINAL, A.J. Correlation between temperature and oleic acid seed content in three segregating soybean populations. Crop Science, v.49, p.1328‑1335, 2009. DOI: 10.2135/cropsci2008.11.0660.         [ Links ]

BACHLAVA, E.; DEWEY, R.E.; BURTON, J.W.; CARDINAL, A.J. Mapping and comparison of quantitative trait loci for oleic acid seed content in two segregating soybean populations. Crop Science, v.49, p.433‑442, 2009. DOI: 10.2135/cropsci2008.06.0324.         [ Links ]

BAUD, S.; LEPINIEC, L. Physiological and developmental regulation of seed oil production. Progress in Lipid Research, v.49, p.235‑249, 2010. DOI: 10.1016/j.plipres.2010.01.001.         [ Links ]

BILYEU, K.D.; GILLMAN, J.D.; LEROY, A.R. Novel FAD3 mutant allele combinations produce soybeans containing 1% linolenic acid in the seed oil. Crop Science, v.51, p.259‑264, 2011. DOI: 10.2135/cropsci2010.01.0044.         [ Links ]

BILYEU, K.D.; PALAVALLI, L.; SLEPER, D.A.; BEUSELINCK, P.R. Molecular genetic resources for development of 1% linolenic acid soybeans. Crop Science, v.46, p.1913‑1918, 2006. DOI: 10.2135/cropsci2005.11‑0426.         [ Links ]

BILYEU, K.D.; PALAVALLI, L.; SLEPER, D.A.; BEUSELINCK, P.R. Mutations in soybean microsomal omega‑3 fatty acid desaturase genes reduce linolenic acid concentration in soybean seeds. Crop Science, v.45, p.1830‑1836, 2005. DOI: 10.2135/cropsci2004.0632.         [ Links ]

BILYEU, K.D.; PALAVALLI, L.; SLEPER, D.A.; BEUSELINCK, P.R. Three microsomal omega‑3 fatty‑acid desaturase genes contribute to soybean linolenic acid levels. Crop Science, v.43, p.1833‑1838, 2003. DOI: 10.2135/cropsci2003.1833.         [ Links ]

CARDINAL, A.J.; BURTON, J.W.; CAMACHO‑ROGER, A.M.; WHETTEN, R.; CHAPPELL, A.S.; BILYEU, K.D.; AUCLAIR, J.; DEW, R.E. Molecular analysis of GmFAD3A in two soybean populations segregating for the fan, fap1, and fapnc loci. Crop Science, v.51, p.2104‑2112, 2011. DOI: 10.2135/cropsci2010.08.0500.         [ Links ]

CARRERA, C.; MARTINEZ, M.J.; DARDANELLI, J.; BALZARINI, M. Environmental variation and correlation of seed components in nontransgenic soybeans: protein, oil, unsaturated fatty acids, tocopherols, and isoflavones. Crop Science, v.51, p.800‑809, 2011. DOI: 10.2135/cropsci2010.06.0314.         [ Links ]

CHAPPELL, A.S.; BILYEU, K.D. The low linolenic acid soybean line PI 361088b contains a novel GmFAD3A mutation. Crop Science, v.47, p.1705‑1710, 2007. DOI: 10.2135/cropsci2006.12.0783.         [ Links ]

CRUZ, C.D. Programa GENES: estatística experimental e matrizes. Viçosa: UFV, 2006. 285p.         [ Links ]

CRUZ, C.D.; SCHUSTER, I. GQMOL: aplicativo computacional para análise de dados moleculares e de suas associações com caracteres quantitativos. 2012. Disponível em: <http://www.ufv.br/dbg/gqmol/gqmol.htm>. Acesso em: 10 ago. 2012.         [ Links ]

DOYLE, J.J.; DOYLE, J.L. A rapid total DNA preparation procedure for fresh plant tissue. Focus, v.12, p.13‑15, 1990.         [ Links ]

FARHOOSH, R.; EINAFSHAR, S.; SHARAYEI, P. The effect of commercial refining steps on the rancidity measures of soybean and canola oils. Food Chemistry, v.115, p.933‑938, 2009. DOI: 10.1016/j.foodchem.2009.01.035.         [ Links ]

FEHR, W.R. Breeding for modified fatty acid composition in soybean. Crop Science, v.47, p.72‑87, 2007. DOI: 10.2135/cropsci2007.04.0004IPBS.         [ Links ]

GERDE, J.; HARDY, C.; FEHR, W.; WHITE, P.J. Frying performance of no‑trans, low‑linolenic acid soybean oils. Journal of the American Oil Chemists' Society, v.84, p.557‑563, 2007. DOI: 10.1007/s11746-007-1066-0.         [ Links ]

JHAM, G.N.; TELES, F.F.F.; CAMPOS, L.G. Use of aqueous HCl/MeOH as esterification reagent for analysis of fatty acids derived from soybean lipids. Journal of the American Oil Chemists' Society, v.59, p.132‑133, 1982.         [ Links ]

KNOTHE, G. Some aspects of biodiesel oxidative stability. Fuel Processing Technology, v.88, p.669‑677, 2007. DOI: 10.1016/j.fuproc.2007.01.005.         [ Links ]

MAHMOUD, A.A.; NATARAJAN, S.S.; BENNETT, J.O.; MAWHINNEY, T.P.; WIEBOLD, W.J.; KRISHNAN, H.B. Effect of six decades of selective breeding on soybean protein composition and quality: a biochemical and molecular analysis. Journal of Agricultural and Food Chemistry, v.54, p.3916‑3922, 2006. DOI: 10.1021/jf060391m.         [ Links ]

OLIVA, M.L.; SHANNON, J.G.; SLEPER, D.A.; ELLERSIECK, M.R.; CARDINAL, A.J.; PARIS, R.L.; LEE, J.D. Stability of fatty acid profile in soybean genotypes with modified seed oil composition. Crop Science, v.46, p.2069‑2075, 2006. DOI: 10.2135/cropsci2005.12.0474.         [ Links ]

PRIMOMO, V.S.; FALK, D.E.; ABLETT, G.R.; TANNER, J.W.; RAJCAN, I. Inheritance and interaction of low palmitic and low linolenic soybean. Crop Science, v.42, p.31‑36, 2002. DOI: 10.2135/cropsci2002.0031.         [ Links ]

RAMOS, M.J.; FERNÁNDEZ, C.M.; CASAS, A.; RODRÍGUEZ, L.; PÉREZ, A. Influence of fatty acid composition of raw materials on biodiesel properties. Bioresource Technology, v.100, p.261‑268, 2009. DOI: 10.1016/j.biortech.2008.06.039.         [ Links ]

REINPRECHT, Y.; LUK‑LABEY, S.‑Y.; LARSEN, J.; POYSA, V.W.; YU, K.; RAJCAN, I.; ABLETT, G.R.; PAULS, K.P. Molecular basis of the low linolenic acid trait in soybean EMS mutant line RG10. Plant Breeding, v.128, p.253‑258, 2009. DOI: 10.1111/j.1439‑0523.2008.01571.x.         [ Links ]

SANTOS, E.M.; PIOVESAN, N.D.; BARROS, E.G.; MOREIRA, M.A. Low linolenic soybeans for biodiesel: characteristics, performance and advantages. Fuel, v.104, p.861‑864, 2013. DOI: 10.1016/j.fuel.2012.06.014.         [ Links ]

WANG, X.; JIANG, G.‑L.; GREEN, M.; SCOTT, R.A.; HYTEN, D.L.; CREGAN, P.B. Quantitative trait locus analysis of saturated fatty acids in a population of recombinant inbred lines of soybean. Molecular Breeding, v.30, p.1163‑1179, 2012. DOI: 10.1007/s11032‑012‑9704‑0.         [ Links ]

WILSON, R.F. Seed composition. In: BOERMA, H.R.; SPECHT, J.E. (Ed.). Soybeans: improvement, production, and uses. 3rd ed. Madison: ASA/CSSA/SSSA, 2004. p.521‑677.         [ Links ]

XIE, D.; HAN, Y.; ZENG, Y.; CHANG, W.; TENG, W.; LI, W. SSR‑ and SNP‑related QTL underlying linolenic acid and other fatty acid contents in soybean seeds across multiple environments. Molecular Breeding, v.30, p.169‑179, 2012. DOI: 10.1007/s11032‑011‑9607‑5.         [ Links ]

XU, Y.; CROUCH, J.H. Marker‑assisted selection in plant breeding: from publications to practice. Crop Science, v.48, p.391‑407, 2008. DOI: 10.2135/cropsci2007.04.0191.         [ Links ]

 

 

Recebido em 16 de agosto de 2012 e aprovado em 8 de fevereiro de 2013