SciELO - Scientific Electronic Library Online

 
vol.34 issue5Synthesis and biological activity of n-{5-(4-methylphenyl) diazenyl-4-phenyl-1, 3-thiazol-2-yl}benzamide derivativesOptimization and validation of a method using modified quechers and lc-esi-ms/ms for the determination of pesticides in onion author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

  • Portuguese (pdf)
  • Article in xml format
  • How to cite this article
  • SciELO Analytics
  • Curriculum ScienTI
  • Automatic translation

Indicators

Related links

Share


Química Nova

Print version ISSN 0100-4042

Quím. Nova vol.34 no.5 São Paulo  2011

http://dx.doi.org/10.1590/S0100-40422011000500009 

ARTIGO

 

Estudos de biodegradação de óleo diesel por consórcio microbiano coletado em Porto Velho - RO, amazônia

 

Biodegradation study of diesel by microbial consortium collected in Porto Velho - RO, amazonia

 

 

Cleber C. LuzI; Elisângela A. SantosII; Maria Odaíse S. SantosII; Marília Y. MussyII; Miyuki YamashitaII; Wanderley R. BastosII; Gunther BruchaIII; Marlon M. Reis e Mariza G. ReisIV, *

IFaculdade de Ciências Humanas, Exatas e Letras de Rondônia, BR 364, km 6,5, 78814-751 Porto Velho - RO, Brasil
IIUniversidade Federal de Rondônia, Campus Porto Velho, BR 364, km 9,5, 78900-000 Porto Velho - RO, Brasil
IIIUniversidade Federal de Rondônia, Campus Ji Paraná, Rua Rio Amazonas, s/n, 76801-974 Ji Paraná - RO, Brasil
IVAgResearch, Ruakura Research Centre, East Street, Hamilton, Nova Zelândia

 

 


ABSTRACT

The goal of this research was to evaluate the biodegradation of diesel by a microbial consortium collected in a region close to distributors of fuel. The experiments were monitored by SPME-GC-FID and SPME-GC-MS. The consortium showed a high potential for production of biosurfactants, presenting an emulsification index of 53%. The consortium degraded completely n-alkanes, while dimethylnaphtalene, hepthyl-cyclohexane and 2,6,10-trimethyl-undecane were partially degraded and pristane was not degraded. From this consortium five strains were isolated and identified as Acinetobacter baumannii. Based on this initial investigation this consortium appears to be effective for bioremediation in Porto Velho - RO region.

Keywords: diesel; biodegradation; Acinetobacter baumannii.


 

 

INTRODUÇÃO

A poluição de solos por derivados de petróleo é um problema de grande relevância, principalmente devido ao risco de contaminação de aquíferos que estão em contato com zonas poluídas.1 Casos de contaminação de aquíferos por combustíveis líquidos foram descritos na cidade de Porto Velho, incluindo a contaminação de poços artesianos com níveis perceptíveis de odor.2 Poços artesianos representam a principal fonte de água potável para a maioria da população de Porto Velho. Logo, é de extrema importância a manutenção da qualidade das águas de seus aquíferos, através da prevenção de derramamentos acidentais e, quando necessário, por meio de remediação de áreas impactadas.

Várias tecnologias de remediaçao in situ têm sido consideradas para remediação de solos e águas contaminados por derivados de petróleo como, por exemplo, extração de vapor,3 tratamentos térmicos,4 adição de surfactantes,5 oxidações químicas usando reagentes de Fenton6 e bioremediação.7 A extração de vapor tem sido amplamente utilizada para remediação de solos contaminados com produtos de petróleo voláteis, tais como a gasolina.8 Apesar de ser um tratamento rápido, não pode ser aplicado para produtos de petróleo com baixa volatilidade. Diesel pode ser extraído por aumento de sua pressão de vapor utilizando ar aquecido;9 entretanto, tratamentos térmicos são caros. Uma alternativa como a adição de surfactantes também pode ser utilizada para remediação de solos; todavia, neste caso, é necessário o pós-tratamento da água usada no processo de remoção do diesel após a adição do surfactante.10 Outro risco neste processo de adição de surfactantes é a dispersão dos contaminantes para outras áreas devido ao processo de transporte. Estudos mostram a eficiência do processo Fenton na remediação de solos contaminados com compostos orgânicos; contudo, este processo também pode gerar efeitos indesejáveis como a dissolução de metais (cobre, cromo e níquel).8 O diesel é rapidamente biodegradado por micro-organismos de solo em processos de biorremediação combinados com bioventilação,9 bioestimulação10 e bioaumento.11 Dentre as diversas tecnologias desenvolvidas, a biorremediação se destaca como um método atrativo de remediação para região de Porto Velho devido: ao baixo custo comparativamente a outras técnicas de remediação; à habilidade dos micro-organismos de biodegradar substâncias ao invés de meramente transferir o contaminante de um meio para outro; à capacidade de redução do risco de contaminação de outras áreas e, da possibilidade de atingir concentrações alvo ambientalmente aceitáveis.

Diversas cepas que degradam diferentes compostos estão disponíveis comercialmente. Entretanto, o sucesso do processo de biorremediação depende do emprego de culturas adequadas às condições biológicas e físico-químicas do local impactado e que atuem em sinergia com as espécies indígenas do local, não interferindo, assim, nos processos biogeoquímicos naturais. Desta forma, a seleção de micro-organismos autóctones da região contaminada pode levar a um processo de biorremediação mais rápido e eficiente.12 Observações realizadas em áreas cronicamente poluídas revelaram que a população microbiana nestes ecossistemas contaminados tende a ser dominada por organismos capazes de utilizar e/ou sobreviver com contaminantes tóxicos.10 Em geral, estes ambientes são pontos de partida para o isolamento de micro-organismos para serem utilizados em processos de biorremediação.10

Este trabalho visou avaliar a capacidade de micro-organismos autóctones coletados em uma área impactada de Porto Velho na biodegradação de compostos presentes no diesel. Para avaliar esta capacidade, o processo de biodegradação foi monitorado ao longo de 21 dias, sendo identificados os compostos biodegradados e não biodegradados. Os micro-organismos presentes na fase final do experimento de degradação do diesel foram isolados e identificados.

 

PARTE EXPERIMENTAL

Reagentes e soluções

Todos os reagentes empregados foram de grau analítico e todas as soluções foram preparadas usando água ultrapura, obtida pelo sistema milli-Q da Millipore. Os reagentes KH2PO4, Na2HPO4, (NH4)2SO4, MgSO4.7H2O, CaCl2.H2O, CoCl2, CuSO4.5H2O, Na2MoO4.2 H2O foram da Vetec e os demais reagentes, da Synth. O meio de cultura inorgânico utilizado foi baseado na metodologia descrita anteriormente por Sakata et al.13 e continha g L-1 de água destilada: 1,36 de KH2PO4, 1,40 de Na2H PO4, 0.30 de (NH4)2SO4, 0,05 de MgSO4.7H2O e (mg L-1 de água destilada) 5,8 de CaCl2.H2O, 2,75 mg de FeSO4.7H2O, 1,7 mg de ZnSO4.7H2O, 0,325 mg CoCl2, 0,235 mg de CuSO4.5H2O e 0,17 mg de Na2MoO4.2 H2O.

Amostras

A amostra de diesel foi adquirida em um posto de combustíveis situado no centro da cidade de Porto velho - RO.

Consórcio microbiano

Foram coletadas amostras de água residuária nas proximidades de uma distribuidora de combustíveis situada no bairro Nacional, zona norte da cidade de Porto Velho-RO, nas coordenadas geográficas: 8º43'45.59'' S e 63º 55'02.32'' W (Figura 1S, material suplementar). A metodologia utilizada para seleção do consórcio microbiano foi baseada na metodologia de Jacques et al..14 Brevemente, alíquotas de 1 mL da água residuária foram adicionadas a 200 mL de meio inorgânico, previamente autoclavado (15 min a 121 ºC), e adicionados 200 mg de diesel como única fonte de carbono. Os meios de cultura foram mantidos sob agitação em incubadora shaker (142 rpm, 30 °C). Foram realizadas medidas de crescimentos dos micro-organismos a cada 24 h, para avaliar a curva de crescimento. A partir da obtenção da fase estacionária do crescimento microbiano foram feitas sucessivas transferências a cada 120 h, sendo 7 transferências no total. As taxas de crescimento e enriquecimento de cultura foram avaliadas por espectrofotometria de UV-VIS, em 600 nm.

Indicador redox 2,6-diclorofenol indofenol

O experimento foi baseado na metodologia descrita por Kubota et al.15 e feito em tubos de ensaio contendo 7,5 mL de meio de cultivo BH (Bushnell-Haas) com 7,5 µg/mL do indicador redox 2,6-diclorofenol indofenol, 50 µL de diesel e 125 µL de inóculo. Os tubos de ensaio foram mantidos a 30 °C em shaker rotatório e observados com frequência até o desaparecimento da coloração azul.

Produção de biossurfactantes

A produção de biossurfactante foi avaliada utilizando o procedimento descrito por Robert et al.,16 onde ao meio mineral de cultivo foi adicionada a alíquota de 0,05 mL/L da seguinte solução de elementos traços: boro (0,026%), cobre (0,05%), manganês (0,05%), molibdênio (0,006%) e zinco (0,07%). Diesel foi usado como fonte de carbono. Em seguida foi feito ajuste de pH para 6,8 com NaOH ou HCl (1 mol L-1). Os ensaios foram realizados em Erlenmeyers de 250 mL, contendo um volume final de 200 mL de meio de cultivo, 1 mL de diesel e 1 mL do inóculo. Todos os experimentos foram incubados em mesa agitadora por 72 h, a 30 °C e 200 rpm.

Determinação do índice de emulsificação

As análises foram realizadas em temperatura ambiente. O índice de emulsificação foi determinado através da adição do diesel (2 mL) ao caldo de cultivo livre de células (2 mL), em tubos de ensaio seguidos por agitação em alta velocidade em vórtex durante 2 min.17 Os tubos foram deixados em repouso por 24 h e o índice de emulsificação foi calculado através da fórmula: IE= (altura da camada de emulsão/altura total) x 100.18

Experimentos de biodegradação

Os ensaios de biodegradação foram realizados em frascos de 50 mL contendo 20 mL de meio mineral inorgânico, 20 μL de diesel e 200 μL de inóculo microbiano do meio de cultura da 7ª transferência. Foram realizados ensaios controles preparados da mesma forma dos demais ensaios, porém sem a adição do inóculo microbiano. Os frascos foram fechados com tampão de algodão e mantidos a temperatura de 28 ºC sem agitação. Os experimentos foram realizados a 28 ºC e sem agitação para diminuir perdas dos componentes do diesel por volatilização.

Amostragem

Os experimentos foram monitorados por microextração em fase sólida do headspace estático seguido por análise de CG-DIC e CG-EM. As análises por CG-DIC foram realizadas nos dias 3, 7, 14 e 21 e por CG-EM no dia 21. Para as análises por cromatografia gasosa, os experimentos e controles foram transferidos para um banho-maria a 40 ºC e mantidos por 5 min. Este procedimento foi realizado para deslocar o equilíbrio para fase gasosa. Em seguida, uma fibra de SPME polimetilsiloxane/divinilbenzeno 65 μm foi conectada através do tampão de algodão e mantida por 5 min, para extração e pré-concentração dos compostos presentes no headspace.19 Os compostos absorvidos/adsorvidos pela fibra foram dessorvidos no injetor do CG a 230 ºC. Todas as análises foram realizadas em triplicata. A percentagem de degradação foi calculada pela expressão: Percentagem de degradação = [(ATC - ATT)/ATC] x 100, onde: ATC é a área total dos hidrocarbonetos no cromatograma do controle e ATT é a área total dos hidrocarbonetos no cromatograma do tratamento.10

Cromatografia gasosa com detecção por ionização em chama (CG-DIC)

As análises foram realizadas em um cromatógrafo CG17A (Shimadzu) equipado com uma coluna capilar DB5 (5% fenilmetilsiloxano, 30 m x 0,25 mm x 0,25 µm). O programa de temperatura do forno foi iniciado a 50 ºC. A temperatura do forno foi elevada 6 ºC/min até 200 ºC, e então elevada 30 ºC/min até 290 ºC. O hélio foi usado como gás de arraste com fluxo de 1,0 mL/min. O injetor foi usado no modo splitless durante 1 min, a temperatura foi de 230 ºC, enquanto a temperatura do detector foi mantida à 250 ºC. Todas as análises foram realizadas em triplicata.

Cromatografia gasosa acoplada à espectrometria de massas (CG-EM)

As análises foram realizadas em um CG-EM Thermoelectron modelo Trace GC Ultra - DSQ. Foi utilizada coluna capilar OV5-MS (5% fenilmetilsiloxano, 30 m x 0,25 mm x 0,25 µm). O programa de temperatura foi iniciado a 50 ºC. A temperatura foi elevada 6 ºC/min até 200 ºC, e então elevada 30 ºC/min até 290 ºC. O hélio foi usado como gás de arraste com fluxo de 1,0 mL/min. O injetor foi usado no modo splitless durante 1 min, com temperatura de 230 ºC. O modo de operação do espectrômetro de massas foi por impacto de elétrons a 70 eV. Os constituintes químicos presentes no diesel foram caracterizados através da comparação dos espectros de massas com o espectro do banco de dados da biblioteca de espectros NIST (National Institute of Standards and Technology) e da comparação dos índices de retenção calculados com os índices de retenção descritos na literatura (IR).20 Os índices de retenção foram calculados a partir do tempo de retenção dos hidrocabonetos lineares presentes nas amostras. Todas as análises foram realizadas em triplicata.

Análise de dados

Os cromatogramas obtidos por CG-DIC foram convertidos através do software Shimatzu CG-10 em arquivos ASCII, contendo para cada amostra os tempos de retenção e correspondentes intensidades detectadas no DIC. Cada cromatograma contém 12000 pontos, correspondendo à resolução de 0,003334 min. Para a análise de dados por componentes principais o período entre 8,33 e 26,66 min foi selecionado, pois não foram identificados sinais cromatográficos fora deste intervalo. A resolução usada para a análise de dados foi de 0,01 min, resultando para cada amostra um cromatograma de 2751 pontos. As intensidades no DIC referentes a estes pontos foram transferidas em matrizes onde cada linha representa uma amostra. Para o diesel foi obtida uma matriz com 24 linhas e 2751 colunas sendo 12 para amostras controle e 12 para amostras do experimento de biodegradação. Para a análise de componentes principais as amostras foram pré-processadas centrando-se na média. Neste caso, um cromatograma médio é calculado e, então, subtraído dos cromatogramas originais. A matriz resultante desta subtração é aquela usada para a análise de componentes principais. Os gráficos para avaliação de escores resultantes da análise componentes principais e cromatogramas foram obtidos através do pacote Lattice do R. Os gráficos de escores foram efetuados através de boxplots, que representam a distribuição das triplicatas em cada tempo de monitoramento. Os boxplots apresentam os valores do 1º e 4º quartis (25 e 75% da variação de cada grupo) representados pelos 'limites da caixa'. A mediana é indicada pelo 'ponto central' e valores máximo e mínimo dos dados pelos traços externos à caixa. O programa R foi usado para análise de dados.21

Isolamento microbiano

Alíquotas de 100 μL provenientes da fase final do ensaio de biodegradação foram transferidas para placa de Petri contendo ágar nutriente (Difco) (g L-1 3,0 g de extrato de carne, 5,0 g de peptona, 15,0 g de ágar-ágar) e 30 μL de óleo diesel. Realizou-se o espalhamento do consórcio utilizando-se da Alça de Drigalsky e as placas foram incubadas a 32 ºC por um período de 2 dias. Após o crescimento microbiano, deu-se início ao isolamento através da técnica de esgotamento por estrias.14

Identificação molecular bacteriana

Para a identificação molecular realizou-se primeiramente a extração do DNA das amostras bacterianas isoladas da fase final do ensaio de degradação. Para isso, utilizou-se metodologia proposta por Wilson.22 As amostras de DNA foram submetidas à amplificação do DNAr 16S através da metodologia da reação em cadeia da polimerase (PCR). Os fragmentos de DNAr 16S amplificados foram purificados e sequenciados. Para a sequência a ser replicada do DNAr referente ao gene 16 S foram utilizados os primers 27F (5'AGAGTTTGATCMTGGCTCAG3') e 1401R (5'CGGTGTGTACAAGGCCCGGGAACG3'). As amplificações foram realizadas com o uso de um termociclador Gene Amp PCR System 2400 (Perkin-Elmer Cetus, Norwalk, Conn.). O controle positivo utilizado foi o DNA da Escherichia coli. Os produtos do PCR foram purificados com o kit Invitrogen PureLink PCR Purification kit. As reações de sequenciamento já purificadas foram aplicadas no sequenciador Megabace 1000 da GE Halthcare. As análises foram feitas pelo software Sequence Analyser 3.0 com basecaller Cimerron 3.12. Os resultados foram analisados no programa BioEdit (Sequence Alignment Editor) e comparados com bancos de dados internacionais GenBank do NCBI (National Center for Biotechnology Information) utilizando-se da ferramenta do BLAST (Basic Local Alignment Search Tool) para a identificação dos micro-organismos.

 

RESULTADOS E DISCUSSÃO

Inicialmente foi investigada a presença de micro-organismos degradadores de hidrocarbonetos no consórcio microbiano selecionado, utilizando-se 2,6-diclorofenol indofenol como indicador. O princípio deste teste é que durante a oxidação microbiana dos hidrocarbonetos ocorre tranferências de elétrons. Assim, a presença de aceptores de elétrons, como o 2,6-diclorofenol indofenol, no meio de cultura pode ser utilizada para averiguar a presença de micro-organismos que usam hidrocarbonetos como substrato, pela observação da mudança de cor do 2,6-diclorofenol indofenol de azul (oxidado) para incolor (reduzido).15 Os ensaios realizados com o consórcio microbiano apresentaram resultados positivos, obtidos a partir da observação visual da completa descoloração do meio após 96 h. Em seguida, foi investigada a possível produção de biossurfactantes pelo consórcio microbiano, já que hidrocarbonetos apresentam baixa solubilidade em água e a presença de biossurfactantes auxilia o processo de biodegradação pelo aumento da disponibilidade dos hidrocarbonetos aos micro-organismos.23 O surfactante produzido pelo consórcio apresentou um índice de emulsificação de 53%, quando o diesel foi utilizado como agente apolar. Este valor corresponde a um alto grau de emulsificação quando comparado com outros valores reportados na literatura. Por exemplo, Pruthi e Cameotra24 encontraram que culturas Pseudomonas aeruginosa apresentaram um índice de emulsificação de 30% e este é considerado um excelente produtor de biossurfactantes.

Na etapa seguinte, o processo de biodegradação foi monitorado ao longo de 21 dias. A Figura 1 mostra o efeito dos tratamentos no processo de desaparecimento dos hidrocarbonetos. A diminuição na concentração de compostos foi observada nos experimentos controles sem inóculo, devido ao processo de volatilização (Figura 1 - controles). Entretanto, uma maior diminuição na concentração de compostos é observada no experimento contendo o consórcio microbiano, devido ao processo de biodegradação (Figura 1 - experimentos). A principal diferença entre os tratamentos (com adição e sem a adição do consórcio) ocorreu durante os 7 primeiros dias, pois o experimento com consórcio resultou em uma redução nas áreas relativas de vários hidrocarbonetos, sendo a percentagem total de degradação durante este período de 13%. No dia 15 a percentagem de degradação foi de 33%. No final do ensaio (após 21 dias), uma pronunciada redução do conteúdo de hidrocarbonetos foi observada no experimento contendo o consórcio (Figura 1- experimentos - dia 21), correspondendo a 35% de degradação.

 

 

Análises por CG/EM (Figura 2), realizadas no 21º dia de experimento, revelaram que os hidrocarbonetos lineares (n-dodecano, n-tridecano, n-tetradecano, n-pentadecano, n-hexadecano e n-heptadecano) e o dimetil-naftaleno foram completamente degradados. Já o heptil-ciclo-hexano e o 2,6,10-trimetil-undecano foram parcialmente degradados, enquanto o pristano e outros alcanos ramificados se mostraram mais resistentes à degradação (Tabela 1). Como o pristano apresentou-se resistente à degradação, este composto (pico 12) foi utilizado como padrão interno conservado25 para avaliar o desaparecimento dos demais hidrocarbonetos na amostra.

 

 

 

 

Para identificar a contribuição do processo de vaporização e biodegradação sobre os experimentos, a relação entre análises cromatográficas foi investigada através de análise por componentes principais. Os dados foram centrados na média, ou seja, cada cromatograma foi subtraído da média de todos os cromatogramas (três replicatas). O programa R (versão 2.6.0, de 03/10/2007, The R Foundation for Statistical Computing) foi empregado. A Tabela 2 mostra a variância explicada dos 5 componentes principais mais importantes. A Figura 2S, material suplementar, apresenta os loadings dos cinco componentes principais (60, 22, 8, 4 e 2%, respectivamente), que representam 96% da variância explicada. Os dois primeiros componentes, que explicam a maior parte da variação dos dados, variam com em função do período de degradação o que sugere que estes escores estão relacionados aos processos de vaporização e biodegradação. A Figura 2S, material suplementar, mostra que controle e experimento apresentam decaimento similar no primeiro componente principal, mas no segundo este decaimento é distinto, sugerindo que o segundo componente principal informa sobre a diferença entre controle e experimento. Os loadings deste segundo componente principal indicam que esta diferença está relacionada, principalmente, aos perfis cromatográficos da série homóloga de hidrocarbonetos lineares. Uma análise de dados adicional confirmou os resultados observados pela análise de componentes principais.26

 

 

Para identificar os micro-organismos envolvidos no processo de biodegradação do diesel estes foram isolados pela técnica de esgotamento por estrias. Através do sequenciamento e dos testes bioquímicos pôde-se identificar 5 cepas presentes na fase final do experimento de degradação do diesel, sendo que todas foram identificadas como Acinetobacter baumannii. O gênero Acinetobacter é amplamente citado na literatura como potencial assimilador de hidrocarbonetos derivados de petróleo.27 Resultados obtidos por Mishra et al.28 e por Morais e Tauk-Tornisielo29 apontam, também, a eficiência da Acinetobacter baumannii como micro-organismo com grande potencial para biodegradação de hidrocarbonetos derivados de petróleo. Maeng et al.30 relataram que a enzima dioxigenase isolada de Acinetobacter sp foi capaz de oxidar alcanos de 10 a 30 átomos de carbono, alcenos (C12 a C20) e alguns compostos aromáticos alquilados, mas não alcanos ramificados como os isoprenoides. Estes resultados estão de acordo com os resultados obtidos neste estudo, onde foi observada total degradação de hidrocarbonetos lineares monitorados e compostos aromáticos alquilados, como dimetilnaftaleno. Apesar de ter sido observado um decaimento na área do 2,6,10-trimetil-undecano em comparação ao experimento controle, alcanos ramificados com cadeia maiores como o pristano mostraram-se mais resistentes à biodegradação.

 

CONCLUSÕES

Cinco micro-organismos foram isolados na fase final do experimento de biodegradação do diesel e identificados como Acinetobacter baumannii. A espécie A. baumannii é conhecida por seu potencial para biodegradação de compostos derivados de petróleo e sua identificação como micro-organismo autóctone da região de Porto Velho indica que pode ser utilizado em processos de bioaumentação na região. O processo de degradação por este consórcio envolveu a produção de emulsificantes com alto poder de emulsificação, característica que facilita o processo de biodegradação de derivados de petróleo. Foi observada a degradação de vários componentes de diesel, incluindo compostos aromáticos alquilados e alcanos ramificados. Em geral, os resultados obtidos neste estudo sugerem que o consórcio de micro-organismo avaliado possui características promissoras para o emprego em biorremediação de sítios contaminados por derivados de petróleo em Porto Velho - RO.

 

MATERIAL SUPLEMENTAR

As figuras contendo a localização da área de coleta da água residuária utilizada para seleção do consórcio de micro-organismos e escores oriundos da análise de componentes dos dados de diesel estão disponíveis em http://quimicanova.sbq.org.br, na forma de arquivo PDF, com acesso livre.

 

AGRADECIMENTOS

Ao CNPq pelo apoio financeiro através dos processos 476232/2004-0 e 553269/2005-4, FINEP CT-Proinfra (# 0105056700) e à Polícia Civil pelo convênio que possibilitou o uso do equipamento de CG-DIC. Ao CNPq/PIBIC/UNIR pelas bolsas concedidas à E. A. Santos, M. O. S. Santos e M. Y. Mussy. À Prof. Dra. V. H. Pellizari, ICB-USP, pelo auxilio na identificação dos micro-organismos.

 

REFERÊNCIAS

1. Danielopol, D. L.; Griebler, C.; Gunatilaka, A., Notenboom, J.; Environ. Conservation 2003, 30, 104.         [ Links ]

2. http://www.cprm.gov.br/publique/media/avali_contami.pdf, acessada em Janeiro 2010; Forte, E. J.; Azevedo, M. S.; de Oliveira, R. C.; de Almeida, R.; Quim. Nova 2007, 30, 1539.         [ Links ]

3. http://www.epa.gov/oust/cat/LTTD.HTM, acessada em Janeiro 2010.         [ Links ]

4. USEPA, 1998 USEPA Em Steam Injection for Soil and Aquifer Remediation: Ground Water Issue, EPA-540-S-97-505;         [ Links ] Davis, E. L., ed.; Office of Research and Development: Ada, 1998.         [ Links ]

5. Lee, M.; Kang, H.; Do, W.; Water Res. 2005, 39, 139.         [ Links ]

6. Watts, R. J.; Dilly, S. E.; J. Harzard. Mater. 1996, 51, 209.         [ Links ]

7. Márquez-Rocha, F. J.; Hernández-Rodri, V.; Lamela, M. T.; Water, Air, Soil Pollut. 2001, 128, 313.         [ Links ]

8. Villa, R. D.; Trovo, A. G.; Nogueira, R. F. P.; Chemosphere 2008, 71, 43.         [ Links ]

9. Lee, T. H.; Byun, I. G.; Kim, Y. O.; Hwang, I. S.; Park, T. J.; Water Sci. Technol. 2005, 96, 263.         [ Links ]

10. Bento, F. M.; Camargo, F. A. O.; Okeke, B. C.; Frankenberger, W. T.; Bioresour. Technol. 2005, 96, 1049.         [ Links ]

11. Alisi, C.; Musella, R.; Tasso, F.; Ubaldi, C.; Manzo, S.; Cremisini, C.; Sprocati, A. R.; Sci. Total Environ. 2009, 407, 3024;         [ Links ] Thomassin-Lacroix, E.; Eriksson, M.; Reimer, K.; Mohn, W.; Appl. Microbiol. Biotechnol. 2002, 59, 1432.         [ Links ]

12. Del´Arco, J. P.; França, F. P.; Int. Biodet. Biodeg. 1999, 44, 87.         [ Links ]

13. Sakata, S. K.; Taniguchi, S.; Rodrigues, D. F.; Urano, M. E.; Wandermuren, M. N.; Pellizari, V. H.; Comasseto, J. V.; J. Chromatogr., A 2004, 1048, 67.         [ Links ]

14. Jacques, R. J. S.; Santos, E. C.; Bento, F. M.; Peralba, M. C. R.; Selbach, P. A.; Sá, E. L. S.; Camargo, F. A. O.; Int. Biodet. Biodeg. 2005, 56, 143.         [ Links ]

15. Kubota, K.; Koma, D.; Matsumiya, Y.; Chung, S-Y.; Kubo, M.; Biodegradation 2008, 19, 749.         [ Links ]

16. Robert, M.; Mercade, M. E.; Bosh, M. P.; Parra, J. L.; Espuny, M. J.; Manresa, M. A.; Guinea, J.; Biotechnol. Lett. 1989, 11, 871.         [ Links ]

17. Pirôllo, M. P. S.; Mariano, A. P.; Lovaglio, R. B.; Costa, S. G. V. A. O.; Walter, V.; Hausmann, R.; Contiero, J.; J. Appl. Microbiol. 2008, 1484.         [ Links ]

18. Fleck, L. C.; Bicca, F. C.; Ayub, M. A. Z.; Biotechnol. Lett. 2000, 22, 285.         [ Links ]

19. Almeida, C. M. M.; Boas, V. L.; J. Environ. Monit. 2004, 6, 80.         [ Links ]

20. Kallio, M.; Jussila, M.; Rissanen, T.; Anttila, P.; Hartonen, K.; Reissell, A.; Vreuls, R.; Adahchour, M.; Hyotylainen, T.; J. Chromatogr., A 2006, 1125, 234;         [ Links ] Konig, W. A.; Joulain, D.; Hochmuth, D. H.; Terpenoids and Related Constituents of Essential Oils, GC/MS Library, 2006;         [ Links ] Sandercock, P. M. L.; Du Pasquier, E.; Forensic Sci. Int. 2003, 134, 1.         [ Links ]

21. R Development Core Team (2007); R: A language and environment for statistical computing; R Foundation for Statistical Computing, Vienna, Austria, URL http://www.R-project.org.         [ Links ]

22. Wilson, K. Em Current Protocols in Molecular Biology;         [ Links ] Ausubel, F. M.; Brent, R. E.; Kingston, R. E.; Moore, D. D.; Seidman, J. G.; Smith, J. A.; Struhl, K.; eds.; Wiley, John & Sons, Inc.: New York, 1989.         [ Links ]

23. Abouseud, M.; Maachi, R.; Amrane, A.; Boudergua, S.; Nabi, S.; Desalination 2008, 223, 143;         [ Links ] Mariano, A. P.; Bonotto, D. M.; Angelis, D. F.; Pirôllo, M. P. S.; Contiero, J.; Braz. J. Microbiol. 2008, 39, 133;         [ Links ] Cameotra, S. S.; Bollag, J-M.; Crit. Rev. Environ. Sci. Technol. 2003, 30, 111;         [ Links ] Calvo, C. M.; Silva-Castro, G. A.; Uad, I.; Sci. Total Environ. 2009, 407, 3634.         [ Links ]

24. Pruthi, V.; Cameron, S. S.; Biotechnol. Technol. 1995, 9, 271.         [ Links ]

25. Peters, K. E.; Walters, C. C.; Moldowan, J. M.; The biomarker guide: Biomarkers and isotopes in the enviornment and human history, 2o ed., Cambridge University Press: Cambridge, 2005, vol. 1.         [ Links ]

26. Reis, M. M.; Luz, C. C.; Reis, M. G.; Bastos, W. R.; Yamashita, M.; Quim. Nova 2010, 33, 1464.         [ Links ]

27. Leahy, L. L.; Colwell, R. R.; Microbiol. Rev. 1990, 54, 305;         [ Links ] Chaineau, C. H.; Morel, J.; Dupont, J.; Bury,E.; Oudut, J.; Sci. Total Environ. 1999, 227, 237;         [ Links ] Gallego, L. L.; Loredo, J.; Llamas, J. F.; Vazquez, J.; Sanchez, J.; Biodegradation 2001, 12, 325.         [ Links ]

28. Mishra, S.; Sarma, P. M.; Lal, B.; FEMS Microbiol. Lett. 2004, 235, 323.         [ Links ]

29. Morais, E. B.; Tauk-Tornisielo, S. M.; Arq. Inst. Biol. 2004, 71 (Supl.), 1.         [ Links ]

30. Maeng, J. H.; Sakai, Y.; Tani, Y.; Kato, N.; J. Bacteriol. 1996, 3695.         [ Links ]

 

 

Recebido em 11/5/10; aceito em 1/12/10; publicado na web em 25/2/11

 

 

* e-mail: mariza.gomesreis@agresearch.co.nz

 

 

MATERIAL SUPLEMENTAR

 

 

 

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License