SciELO - Scientific Electronic Library Online

 
vol.38 número2Transmissão experimental revela novos potenciais reservatórios do Cowpea aphid-borne mosaic virusCeratocystis fimbriata causando murcha em atemóia na região de Botucatu-SP índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Articulo

Indicadores

Links relacionados

  • No hay articulos similaresSimilares en SciELO

Compartir


Summa Phytopathologica

versión impresa ISSN 0100-5405

Summa phytopathol. vol.38 no.2 Botucatu abr./un. 2012

http://dx.doi.org/10.1590/S0100-54052012000200015 

COMUNICAÇÕES

 

Ocorrência de infecção viral mista em pimentão no estado de São Paulo

 

 

Monika Fecury Moura; Denise Nakada Nozaki; Fausto Zafallon Ferreira; Marcelo Agenor Pavan; Renate Krause-Sakate*

FCA/UNESP - Depto. de Produção Vegetal / Defesa Fitossanitária

 

 

O pimentão (Capsicum annuum) é uma das 10 hortaliças economicamente mais importantes no país. Existem cerca de vinte vírus que infectam essa espécie, sendo os mais importantes pertencentes aos gêneros Begomovirus, Potyvirus, Tobamovirus, Tospovirus e Cucumovirus. Os sintomas ocasionados pelas diferentes espécies de vírus são variados e a diagnose no campo é extremamente difícil, principalmente quando há infecções mistas. Em 2011, dez plantas de pimentão foram coletadas no Estado de São Paulo, região de Reginópolis, com sintomas de mosaico intenso, deformação foliar, necrose e amarelecimento. O objetivo foi identificar os vírus presentes nestas plantas. A identificação foi feita realizando a extração de RNA total (Bertheau et al. In: Perombelon, M.C.M.; Van Der Wolff, J.M. Methods for the detection and quantification of Erwinia carotovora subsp. atroseptica on potatoes. Scottish Crop Research Institute Occasional Publication. 1998) e de DNA total (Dellaporta et al. Plant Molecular Biology Reporter, v.1, p.19-21, 1983) de todas as amostras coletadas. Para a etapa de RT-PCR e PCR foram utilizados os seguintes pares de oligonucleotídeos iniciadores universais para tospovirus (BR60-CCCGGATCCTGCAGAGCAATTGTGTCA e BR65-ATCAAGCCTTCTGAAAGTCAT) (Eiras et al. Fitopatologia Brasileira, v.26, p.170-175, 2001); para tobamovirus (TobUNI 1- ATTTAAGTGGAGGGAAAACCACT e TobUNI 2- GTYGTTGATGAGTTCGTGGA) (Letschert et al. Journal of Virological Methods, v.106, p.1-10, 2002.); para cucumovirus (035-3- GCCGTAAGTGGATGGACAA e 038-8- TATGATAAGAARCTTGTTTCGCG) (Boari et al. Fitopatologia Brasileira, v.25, p.49-58, 2000) e para begomovirus (PAL1v1978- GCATCTGCAGGCCCACATYGTCTTYCCNGT e PAR1c496- AATACTGCAGGGCTTYCTRTACATRGG) (Rojas et al. Plant Disease, v.77, p.340-347, 1993). Na detecção de potyvirus foram utilizados os oligonucleotídeos iniciadores (PepNib- GWTSGYYGMMTTGGATGATG e PepUTR- AGTAGTACAGGAAAAGCC), desenhados para Pepper yelow mosaic virus (PepYMV) e Potato virus Y (PVY) (Moura et al. European Journal of Plant Pathology, v.131, 2011). Os produtos de RT-PCR e PCR foram submetidos ao sequenciamento direto de nucleotídeos para confirmação das espécies virais. As 10 amostras de plantas de pimentão estavam infectadas com begomovirus. Uma delas apresentou infecção dupla de potyvirus e begomovirus. Três amostras apresentaram infecção dupla de tobamovirus e begomovirus. Uma amostra apresentou infecção tripla de potyvirus, begomovirus e tobamovirus. As espécies de vírus encontradas foram: Pepper yellow mosaic virus - PepYMV (potyvirus), Tomato severe rugose virus - ToSRV (begomovirus) e Pepper mild mottle virus - PMMoV (tobamovirus). Esta é a primeira detecção de infecção tripla ocorrida naturalmente em pimentão. Em nenhuma amostra analisada foi detectada cucumovírus e tospovírus. Estes resultados indicam que nas plantações de pimentão estão ocorrendo infecções virais mistas entre vírus transmitidos por diferentes maneiras (vetores e transmissão mecânica), ocasionando sintomas distintos e drásticos na cultura.

 

Figura 1

 

 

Data de chegada: 31/01/2012
Aceito para publicação em: 13/04/2012

 

 

* Autor para correspondência: Renate Krause-Sakate (renatekrause@fca.unesp.br)