Phakopsora pachyrhizi is the major pathogen associated with soybean rust in Colombia

Phakopsora pachyrhizi is the major pathogen associated with soybean rust in Colombia

ABSTRACT

Soybean crops grown in the plains of eastern Colombia have been affected by the incidence of rust. This disease, still officially regarded as American soybean rust (caused by Phakopsora meibomiae) by the Colombian Department of Agriculture (ICA), causes serious damage to soybean growing areas. Symptoms of rust, such as reddish-brown lesions, have been observed since 2004 in the upper half of plants during vegetative stages. In 2005 and 2018, infected leaf tissues and uredinospores were collected from an experimental area and from commercial soybean fields. Once morphological identification and Koch’s postulates confirmed the presence of Phakopsora spp., molecular characterization was performed to identify the pathogen associated with the disease to species level. This was based on standard procedures using internal transcribed spacer (ITS) regions of rDNA and PCR amplification with specific primers for Phakopsora meibomiae and P. pachyrhizi. The obtained sequences were BLASTed against GenBank/NCBI data bank. Results indicated that P. pachyrhizi Sydow is in fact the causative agent of soybean rust in Colombia, considering the samples collected in 2005 and 2018. The ITS-rDNA sequences of P. pachyrhizi were deposited at GenBank under the accession numbers MK933723 to MK933731. This finding was reported to ICA, so that they could officially update the phytosanitary status of this soybean pathogen in Colombia.

Keywords
Glycine max ; Phakopsora spp. phenotyping; phylogenetic analyses; maximum likelihood method; nucleotide sequencing; ITS region

RESUMO

As culturas de soja produzidas nas planícies do leste da Colômbia vem sendo afetadas pela incidência de ferrugem. A doença, ainda considerada oficialmente, pelo Departamento de Agricultura da Colômbia (ICA) como ferrugem americana (ocasionada pelo fungo Phakopsora meibomiae), causa sérios danos à produção nas áreas de cultivo da soja. Os sintomas têm sido observados desde 2004 na metade superior das plantas durante os estágios vegetativos, como lesões marrom-avermelhadas. Em 2005 e 2018, tecidos foliares infectados e uredinosporos foram coletados em uma área experimental e cultivos comerciais dessa cultura. Uma vez que a identificação morfológica e os postulados de Koch confirmaram a presença de Phakopsora spp., foi realizada uma caracterização molecular para se identificar, a nível de espécie, o patógeno associado à ferrugem da soja. Estes foram baseados em procedimentos padrão com espaçadores de transcrição internos (ITS) do rDNA e amplificação por PCR com primers específicos para P. meibomiae e P. pachyrhizi. As sequências obtidas foram verificados por meio do Blast no site do GenBank/NCBI. Os resultados indicaram que Phakopsora pachyrhizi Sydow é, de fato, o agente causal da ferrugem da soja na Colômbia, considerando-se as amostras coletadas em 2005 e 2018. As sequências do ITS-rDNA de P. pachyrhizi foram depositadas com os números de acesso do GenBank MK933723 até MK933731. A informação foi repassada ao ICA, para que atualize oficialmente a situação fitossanitária desse patógeno da soja na Colombia.

Palavras-chave
Glycine max ; fenotipagem de Phakopsora spp; análises filogenéticas; método de máxima verossimilhança; sequenciamento de nucleotídeos; região ITS

Since 2004, rust has caused severe damages to more than 22,500 ha of Colombian soybean fields. Although there is a certain broad array of lands suitable for growing soybean in Colombia, the crop is currently mostly cultivated in the eastern plains (¹¹). Only small scattered soybean crops remain on the best soils available at Valle del Cauca, where soybean cultivation once flourished. Besides, the Colombian soybean area shrank to 22,500 ha from more than 36,000 ha grown until 2004 (⁴) due to production constrains, such as the cost devoted to control rust. Flat or slightly sloping savannas, in “Orinoquia” region, characterize the land on the eastern plains. The soils there are poor, contain low organic material, are very acid (pH around 4.6 – 5.4) and present high aluminum levels. Climate is typically neo-tropical with a bi-modal rainfall pattern (mean 2,800 mm/yr) and a major dry season from December to March. The environment (high humidity and air temperatures above 24^oC) across the crop season is highly conducive to the disease.

Soybean rust typically shows reddish-brown and tan-colored lesions (¹²), starting at vegetative stages (V3 – V4), from the lower canopy up. The disease rapidly progresses upward on the plant, until all leaves present some level of the disease or become completely defoliated, under favorable conditions. Pustule-like structures called uredinia are soon observed developing on the affected tissues. Uredinia harm the leaf tissue, causing drops in soybean yields of 30% to 80% (¹⁷).

Two closely related species of Phakopsora cause soybean rust (¹⁵). Phakopsora pachyrhizi Sydow was considered restricted to Australasia, Japan, the Philippines, and Taiwan until 1990. In South America, Central America and the Caribbean, only P. meibomiae (Arthur) Arthur was reported causing rust until 2000. However, in 1992, P. pachyrhizi was first reported causing soybean rust in Hawaii (¹⁵); similarly, in 2002, it was first reported affecting soybean in Brazil (¹³), Paraguay and Argentina (¹⁶).

Despite several reports on the supposed occurrence of P. pachyrhizi in Colombia (³, ⁶, ⁷, ¹⁴, ²³), soybean rust is still officially associated with P. meibomiae by the Colombian Department of Agriculture, ICA (⁸). This is based only on morphological characteristics of the telia of Phakopsora spp. (², ¹⁵). ICA’s official statement about the Phakopsora species associated with soybean rust does not recognize as valid the phenotyping of two isolates (CO 04-1C and CO 04-1D) analyzed and stored in the USDA-ARS Foreign Disease-Weed Science Research Unit (FDWSRU) at Ft. Detrick, Frederick, MD, which were shipped independently by a local farmer from Caicedonia, Valle del Cauca (4.3433333’ N, 75.8136111’ W). Therefore, in the absence of a scientific study based on a systematic sampling, the official status of the soybean rust pathogen species remains as previously designated by ICA.

A number of different molecular markers have been implemented for Phakopsora population analyses and used elsewhere (⁵, ¹⁸, ²¹, ²², ²³). These include both classical and real-time PCR assays.

Nucleotide sequences of the ITS1 and ITS2 regions of P. pachyrhizi and P. meibomiae isolates, which ranged in size from 196 to 199 nucleotides for P. pachyrhizi isolates and 218 nucleotides for P. meibomiae isolates, were gathered, showing more than 98.0% sequence identity between isolates (⁵). A comparison between P. pachyrhizi and P. meibomiae ITS1 regions revealed nucleotide differences representing 77.5% sequence identity between the two Phakopsora species. ITS2 region ranged from 199 to 206 nucleotides for P. pachyrhizi and from 203 to 205 nucleotides for P. meibomiae. Within species, identity was over 95.0% among sequences from P. pachyrhizi isolates and higher than 99.0% among sequences from P. meibomiae isolates. Comparisons between ITS2 regions of P. pachyrhizi and P. meibomiae revealed approximately 68.5% nucleotide sequence identity between these species. Ten nucleotide differences or gaps were found among P. pachyrhizi isolates (resulting in more than 95.0% identity), while only two additional nucleotides were found for P. meibomiae isolates (resulting in more than 99.0% identity). Frederick et al. (⁵) deposited the nucleotide sequences of ITS1 - 5.8S - ITS2 regions from P. pachyrhizi and P. meibomiae as GenBank Accession Numbers AF333488 to AF333502.

Since nucleotide sequence comparisons revealed significant divergence between species, Frederick et al. (⁵) selected sequence sites to design PCR primers that were useful for distinguishing between Phakopsora species. The PCR primers Ppa1, Ppa2, Ppa3 and Ppa4 were specifically designed for P. pachyrhizi, while Pme1 and Pme2 targeted the specific amplification of P. meibomiae. Furthermore, primers Ppm1 and Ppm2 were designed with the aim of discriminating between specific sites in the 5.8S rDNA region, which is conserved in these two species.

Considering the epidemiological behavior of soybean rust in the field, particularly its rapid spread at early vegetative stages and the severe damage caused to leaf tissues, the present study tested new approaches to resolving a relevant etiological issue about the actual Phakopsora species causing soybean rust in Colombia. The study was conducted based on ITS-rDNA molecular markers, which allow specific identification and discrimination between P. meibomiae and P. pachyrhizi.

MATERIALS AND METHODS

The soybean rust pathogen samples used for this study were obtained at two stages: in 2005, after rust lesions were observed in soybean trap plots at AGROSAVIA La Libertad Experimental Center, and in 2018, after widespread occurrence of the disease on commercial fields was documented. The collected source cultivars were ‘Williams’, ‘Soyica P34’, ‘Corpoica Orinoquia 3’, and ‘Corpoica La Libertad 4’ for the first sampling, besides ‘Panorama 29’, ‘Corpoica Achagua 8’, ‘Sloan’, ‘Soy Sk-7’, and ‘BRS Serena’ for the second sampling (Table 1).

Table 1
Sample source and origin for the 2018 sampling of rust-like isolates.

Municipality	County	Latitude	Longitude	Altitude	Cultivar
Puerto Gaitán	Alto Neblinas	4.32436	-72.02012	198	Panorama 29i
Puerto López	Remolinos	4.21191	-72.64508	204	Panorama 29i
Puerto López	Yurimena	4.18436	-72.59759	214	Panorama 29i
Puerto López	Remolinos	4.20729	-72.66458	202	Panorama 29i
Puerto Gaitán	Alto Neblinas	4.32436	-72.02012	198	Achagua 8
Puerto López	Yurimena	4.18436	-72.59759	214	Achagua 8
Villavicencio	La Reforma	4.03286	-73.28107	355	Sloan
Villavicencio	Pompeya Bajo	4.00078	-73.37435	243	Soy - SK7
Puerto Gaitán	La Cristalina	4.27685	-71.7261	241	BRS- Serena

In 2005, pale yellow-brown to colorless urediniospore samples were collected from 2–5mm-diameter individual lesions on the lower leaf surface of plants (Figure 1) by using a pump-driven spore collector (Cyclone surface sampler, Burkard Manufacturing Co. Ltd. Rickmansworth, UK). The spores were then kept dry on Eppendorf (1.5ml) tubes until lab processing. For the 2018 sampling, infected leaves were collected from the field; then, tissue sections showing erumpent lesions were placed on Petri dishes with humidified filter paper. Afterwards, the morphometric characters of collected spores were confirmed based on the procedures reported by Ono et al. (¹⁵) for Phakopsora spp.; pathogenicity tests were also performed.

Figure 1
Sub-epidermal (left) and erumpent pale yellow-brown to colorless uredia (right, 0.4mm diameter).

The first set of spore samples (2005 sampling) was placed on Petri dishes containing sterile water for germination and subsequent DNA extraction. Uredinospores from the second sampling (2018 sampling) were kept in Eppendorf tubes added of 1ml sterile water on glycerin at -20ºC, until processing. PCR amplification, sequencing and GenBank/NCBI database search procedures were similar for both batches of samples. Specimen collection was conducted with the permit granted to AGROSAVIA by the Colombian National Environmental Licensing Authority (ANLA’s Resolution No. 1466 of December 03, 2014).

DNA extraction was performed from both mycelial growth on sterile water (Figure 2) and urediniospore lysis at 95ºC for 8 min using a thermocycler (PTC- 100 MJ Research, Inc., Watertown, MA, USA). DNA extraction followed the PowerSoil DNA Isolation Kit protocol. DNA concentrations were adjusted to over 200 ng/µL, after the initial DNA concentration of samples was determined with a NanoDrop 2000c spectrophotometer (Thermo Scientific, Wilmington, DE, USA). PCR amplification was performed on 25µL final volumes of 9 DNA samples composed of the following aliquots: 12.5 µL Go Taq Green Master Mix; 2 µL each primer (forward and reverse, 10 µM); 5.5 µL sterile water; and 3 µL extracted DNA samples.

Figure 2
Mycelial growth on sterile water.

Nucleotide sequencing of the internal transcribed spacer (ITS) region (2018 sampling only).

The ITS regions from P. pachyrhizi and P. meibomiae isolates were PCR-amplified from nine selected Phakopsora spp. isolates. This was done with the primers ITS4 (5’-TCCTCCGCTTATTGATATGC-3’) and ITS5 (5’-GGAAGTAAAAGTCGTAACAAGG-3’), according to the protocols of Udayanga et al. (²⁰). Primers ITS4 and ITS5 were initially denaturized at 96°C for 2 min (35 cycles), followed by denaturation at 96°C for 1 min, alignment at 55°C for 1 min, and extension at 72°C for 2 min. Finally, extension was programmed at 72°C for 10 min.

Phylogenetic analysis by Maximum Composite Likelihood method.

The phylogenetic distances of the isolates’ sequences and phylogenetic trees were inferred according to the Maximum Composite Likelihood (MCL) method and Kimura 2-parameter model (⁹). The phylogenetic tree with the highest log likelihood (-1218.66) was built with the percentage of trees in which the associated taxa clustered together (next to the branches). Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated based on the MCL approach, and then selecting the topology with superior log likelihood value. The tree was drawn to scale, with branch lengths measured by the number of substitutions per site and bootstrap value (confidence) labels. The performed analysis involved 32 nucleotide sequences. The included codon positions were 1^st + 2^nd + 3^rd + noncoding. Phylogenetic analyses were conducted in MEGA X (¹⁰).

Identification of Phakopsora species with specific primers.

Four pairs of oligonucleotide PCR primers selected for their specificity to P. pachyrhizi (Ppa1/Ppa2, Ppa3/Ppa4, Ppm1/Ppa2, and Ppm1/Ppa4) were used to discriminate P. pachyrhizi from the isolates sampled in 2005. Only Ppa1/Ppa2 oligonucleotide set was used for the isolates collected from commercial crops in 2018. The specific oligonucleotide PCR primers (Pme1/Pme2 and Ppm1/Pme2), designed to amplify products from P. meibomiae but not from P. pachyrhizi, were used to discriminate the causative organism from the 2005 sampling. Ppm1/Pme2 oligonucleotide primer set that amplified a 79-bp PCR product from both P. pachyrhizi isolate TW72-1 and P. meibomiae was used for the isolates collected in 2018.

Oligonucleotide primers were Ppm1 (5’-GCAGAATTCAGTGAATCATCAAG-3’) and Pme2 (5’-GCACTCAAAATCCAACATGC-3’) for P. meibomiae; Ppm1 (5’-GCACTCAAAATCCAACATGC-3’) and Ppa2 (5’-GCAACACTCAAAATCCAACAAT-3’); Ppa3 (5’-CCCATTTAATTGGCTCATTG-3’) and Ppa4 (5’-TCAAAATCCAACAATTTCCC-3’) for P. pachyrhizi. PCR conditions were as follows: Initial denaturalization at 95°C for 3 min; followed by denaturalization at 95°C for 1 min (35 cycles); annealing at 55°C for 30s; extension at 72°C for 1 min, and final extension at 72°C for 10 min. The amplified products were observed on 2% agarose gel (⁵).

Analysis and editing of sequences from the ITS region and from the cloning of isolates by specific primers were performed with Geneious v 8.1.9 software. The consensus sequences generated from the assembly of the sequenced reactions were analyzed by running the Basic Local Alignment Search Tool (BLAST) at NCBI database to determine their homology to nucleotide sequences (Table 2).

Table 2
Sequence and BLAST output of the ITS4 and ITS5 amplified regions of an isolate from the cultivar ‘Soy - SK7’, Pompeya Bajo County, Villavicencio, Colombia.

Species: Phakopsora pachyrhizi; identity: 100%

Sequence: AGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATAAAAAGCTAAAGAGTGCACTTTATT- GTGGCTCAAAACTAAACTTTTTAATAAACCCATTTAATTGGCTCATTGATTGATAAGATCTTTGGGCAATGGTAGCTTT- GAAAAAAGCTGCAACCCACCTATTAATCATAATCTTTTTTTTTTAACTCAAAGTCAAATAGAATGTTTTATAAATTTAAATA- TATATATAACTTTTAACAATGGATCTCTAGGCTCTCATATCGATGAAGAACACAGTGAAATGTGATAATTAATGTGAATTG- CAGAATTCAGTGAATCATCAAGTTTTTGAACGCACCTTGCACCTTTTGGTATTCCAAAAGGTACACCTGTTTGAGTGTCAT- GAAATCTTCTCAACATTATTTCTTTTTAAAGGAAATTGTTGGATTTTGAGTGTTGCTGTTGCTTTTTTTGCAGCTCACTTTAAA- TAAATAAATATATATAAGTTTCAGTATATTTTGATGTAATAATAAAATCATTTCATCAAAAAAATAAATATATGTGAGATT- TATTATAACATTAATTGAATGTAATTTTTTTTTTTAAGACCTCAAATCAGGTGAGACTACCCACTGAACTTAAGCATATCAA

RESULTS AND DISCUSSION

Comparison of P. pachyrhizi and P. meibomiae sequenced ITS regions

Nucleotide alignment from amplified sequences of the Internal transcribed spacer (ITS) conserved regions: ITS4 (5-`TCCTCCGCTTATTGATATGC’-3) and ITS5 (5-`GGAAGTAAAAGTCGTAACAAGG’-3 using BLAST searching engine at NCBI libraries indicated 98%–100% agreement with P. pachyrhizi for the 9 sequenced Colombian rDNAs (Table 3). Molecular weights (625–880bp) were within the expected size frame (641–668bp) of the ITS’s linear DNA reported by Frederick et al. (⁵), which were deposited as GenBank Accession Number AF333488 to AF333502.

Table 3
Colombian isolates’ DNAs for 2018 sampling, ITS GenBank accessions and sequence identity with Phakopsora pachyrhizi from a BLAST search.

Isolate	County	Accession No.	Identity (%)/size (bp)
SUB5621774 009_P._pachyrhizi_COLOMBIA SUB5621774 008_P._pachyrhizi_COLOMBIA SUB5621774 007_P._pachyrhizi_COLOMBIA SUB5621774 006_P._pachyrhizi_COLOMBIA SUB5621774 005_P._pachyrhizi_COLOMBIA SUB5621774 004_P._pachyrhizi_COLOMBIA SUB5621774 003_P._pachyrhizi_COLOMBIA SUB5621774 002_P._pachyrhizi_COLOMBIA SUB5621774 001_P._pachyrhizi_COLOMBIA	La Cristalina Pompeya La Reforma 1 Yurimena Alto Neblinas Remolinos Yurimena Remolinos Alto Neblinas	MK933723 MK933724 MK933725 MK933726 MK933727 MK933728 MK933729 MK933730 MK933731	99/626 100/648 99/654 100/880 100/641 99/661 99/654 99/657 98/656

• ¹
  AGROSAVIA La Libertad Research Station, geographical coordinates: 4.0614402’N 73.5031149’W; 338.46 MAMSL

Evolutionary analysis by the Maximum Likelihood method

The phylogenetic tree built after MCL showed 3 well-defined clades (Figure 3). Distances, related to 0.1 substitutions per site scale, show that the majority (8 out of 9) of Colombian isolates’ sequences clustered at clade I (bootstrap 90), together with the isolate sequences reported by Frederick’s et al. (⁵), which were obtained based on a final dataset of 397 positions. One isolate (MK933726) clustered with several USA isolates at clade III (bootstrap 99), and no sequence was aligned to sequences at clade II, which groups P. meibomiae isolates from Puerto Rico and Panama (bootstrap 99). Clade I shows a somehow well-defined subset of isolates organized in three sub-clades, while clades II and III are unanimously single. Topology distance between clades II and I indicates a clear separation of P. pachyrhizi from P. meibomiae. Isolate MK933726, at clade III, joined a set of highly predominant A5 and T5 genotypes, found at 23.0% and 55.7% frequencies, respectively, in samples of rain collected across the USA between 2005 and 2006 (¹). All but one isolate (EU436718) belongs to genotypes T5, grouped together at clade III. T genotypes were named according to one single nucleotide polymorphism in thymine substitution at the 3´-end of ITS1 region plus a number indicating the variation in TA repeats. On the other hand, A genotypes were named based on one adenine substitution at the 3´-end of ITS1 plus the same number related to variations in TA repeats.

Figure 3
Maximum Likelihood sequence distance trees output from Colombian Phakopsora pachyrhizi DNA’s ITS samples related to Frederick et al. (⁴) accessions. Bootstrap values (after 10000 replicates) are indicated at the nodes.

Identification of Phakopsora species with specific primers

All 9 PCR-amplified DNA samples of isolates collected in 2018 and the 5 samples obtained in 2005 had negative results for P. meibomiae (no fragments amplified) using specific nucleotide primers Ppm1/Pme2 and Pme1/Pme2. A positive fragment (136bp) was observed after amplification with oligonucleotide primers specific to P. pachyrhizi, Ppm1/Ppa4, in 2018 sampling (Figure 4). DNA amplifications from 2005 sampling were all positive for P. pachirhizi. The size of nucleotide fragments with oligonucleotide primers Ppm1/Ppa2 was 141bp, while that with Ppm1/Ppa4 was 136bp (Figure 5). On the other hand, Ppa1/Ppa2 returned a 332bp fragment, and Ppa3/Ppa4 showed 347bp. Both results confirmed the identity of the isolate sequences as belonging to P. pachyrhizi (Figure 6).

Figure 4
Agarose gel (1.8% w/v) with DNA amplification products of specific oligonucleotide primers (Ppm1/Ppa4) for Phakopsora pachyrhizi. Lanes M: DNA Ladder (100 bp). Lanes 1-9: DNA from 2018 samples. Lane 10: negative control. (Sybr safe stain).

Figure 5
Agarose gel (1.8% w/v) with DNA amplification products of specific primers (Ppm1/Ppa2) and (Ppm1/Ppa4) for Phakopsora pachyrhizi. Lane M: DNA Ladder (100 bp). Lanes 2-5 and 8-11: DNA sampled from infected cultivars ‘Williams’, ‘Soyica P34’, ‘Corpoica Orinoquia 3’ and ‘Corpoica La Libertad 4’ in 2005. Lanes 5 and 12: positive reaction control. Lanes 6 and 13: negative control.

Figure 6
Agarose gel (1.8% w/v) with DNA amplification products of specific primers (Ppa1/Ppa2) and (Ppa3/Ppa4) for Phakopsora pachyrhizi. Lane M: DNA Ladder (100 bp). Lanes 1-4 and 8-11: DNA sampled from infected cultivars ‘Williams’, ‘Soyica P34’, ‘Corpoica Orinoquia 3’ and ‘Corpoica La Libertad 4’ in 2005. Lanes 5 and 12: positive reaction control. Lanes 6 and 13: negative control.

These results indicate that the amplified PCR products from 2005 and 2018 samplings, which ranged in size from 136 to 367bp with specific oligonucleotide primers (Ppm1/Ppa2; Ppm1/Ppa4, and Ppa1/Ppa2), corroborate the DNA amplification sizes reported for P. pachyrhizi isolates by Frederick et al. (⁵). The same was stated for the isolates CO 04-1C and CO 04-1D by Zhang et al. (²²) and all Colombian isolates grouped in clades with P. pachyrhizi isolates from several countries. Moreover, as specific primers Ppm1/Pme2 and Pme1/Pme2 yielded no product from P. meibomiae, it is straightforwardly confirmed that P. pachyrhizi is the causative agent of soybean rust in Colombia and, to our understanding, this pathogen has been present in Colombian soybean fields since at least 2004.

New insights into the pathotyping of microorganisms subject to benzimidazole pressure, such as P. pachirhizi, have been proposed (¹⁹). Thus, Phakopsora species would be better discriminated by means of sequencing nucleotides of β-tubulin gene (Pp tubB), associated with benzimidazole resistance, as reported for the closely related model organisms Aspergillus nidulans and Neurospora crassa. However, the usefulness of Pp tubB for phylogeographic discrimination of P. pachyrhizi at seven commercial soybean fields in Brazil proved to be poorly adequate for phylogenetic analysis and should be disregarded, in contrast with reports of high level of sequence identity between Pp TUB and β-tubulins of the previously mentioned model organisms. Nevertheless, there is a still clear relationship between amino acid substitutions at given sites and benzimidazole resistance. The presence of only four polymorphic sites after Pp tubB testing led to the conclusion that the amino acid substitutions in β-tubulin were absent in P. pachyrhizi sequences. Therefore, identification of Phakopsora species using specific primers and sequencing of ITS regions are still regarded as the most useful and powerful approach to discriminate between P. pachyrhizi and P. meibomiae.

ACKNOWLEDGEMENTS

The authors thank the Colombian Agricultural Research Corporation (AGROSAVIA) for funding this study, which was carried out within the framework of the project “Soybean cultivars for the Altillanura” (Agreement 1914 derived from the M504 Framework Agreement with the Colombian National Federation of Cereal and Legume Producers - FENALCE). The authors also acknowledge the infrastructure and support of the Molecular Biology Laboratory of Colombian Agriculture Institute (ICA) at Tibaitatá Headquarters in Bogotá for the molecular analyses of the 2005 sampling. All photographs were provided by the authors.

The present study deals with newly approaches to type Phakopsora populations collected from Colombian soybean fields at different times. Using ITSs and specific primers as molecular markers, the current study demonstrated that the soybean rust pathogen, P. pachyrhizi, is present since the beginning of the XXI Century. Thus, the status of rust pathogen must be officially given to P. pachyrhizi instead of P. meibomiae by the phytosanitary authorities. Phenotyping Phakopsora populations with molecular markers allows better understanding the disease and more adequate epidemiological surveillance of the pathogen. This will provide more useful information to improve the efficiency of the disease management strategies, such as the use of resistant varieties and chemical control.

REFERENCES

• ¹
  Barnes, C. W., Szabo, L. J., Bowersox, V. C. Identifying and quantifying Phakopsora pachyrhizi spores in rain. Phytopathology Minnesota, USA. v. 99, n. 4, p. 328–338. 2009.
• ²
  Buriticá, P., Pardo-Cardona, V. M. Flora uredineana colombiana. Revista de La Academia Colombiana de Ciencias Exactas, Físicas y Naturales Bogotá, Colombia. v. 20, n. 77, p. 183–236. 1996.
• ³
  CORPOICA. Soya [glycine Max (l.) Merril] Alternativa Para Los Sistemas de Produccion de la Orinoquia Colombiana Bogotá, Colombia. p. 217. 2006.
• ⁴
  Ferreira Maciel, T. E., Menezes Freire, M. C., de Almeida, Á. M. R., Oliveira, L. O. de. Molecular characterization of beta-tubulin from Phakopsora pachyrhizi, the causal agent of Asian soybean rust. Genetics and Molecular Biology Rio de Janeiro, Brazil. v. 33, n. 2, p. 354–358. 2010.
• ⁵
  Frederick, R. D., Snyder, C. L., Peterson, G. L., Bonde, M. R. Polymerase chain reaction assays for the detection and discrimination of the soybean rust pathogens Phakopsora pachyrhizi and P. meibomiae. Phytopathology Minnesota, USA. v. 92, n. 2, p. 217–227. 2002.
• ⁶
  Godoy, C. V., Seixas, C. D. S., Soares, R. M., Marcelino-Guimarães, F. C., Meyer, M. C., Costamilan, L. M. Asian soybean rust in Brazil: past, present, and future. Pesquisa Agropecuária Brasileira Brasilia, Brazil. v. 51, p. 407–421. 2016.
• ⁷
  Hepperly, P. R., Victoria, J. Soybean rust on soybean. FAO Plant Protection Bulletin v. 28, n. 2, p. 77. 1980.
• ⁸
  Instituto Colombiano Agropecuario. Resolución número 00106 del 13 de septiembre de 2004. Diario Oficial n. 45.677 Santiago de Cali, Colombia. 2004.
• ⁹
  Kimura, M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution New York, USA. v. 16, n. 2, p. 111–120. 1980.
• ¹⁰
  Kumar, S., Stecher, G., Li, M., Knyaz, C., Tamura, K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Oxford, UK. Molecular Biology and Evolution v. 35, n. 6, p. 1547. 2018.
• ¹¹
  Miles, M. R., Bonde, M. R., Nester, S. E., Berner, D. K., Frederick, R. D., Hartman, G. L. Characterizing resistance to Phakopsora pachyrhizi in soybean. Plant Disease Idaho, USA. v. 95, n. 5, p. 577–581. 2011.
• ¹²
  Ministerio de Agricultura y Desarrollo Rural. Soya. Dirección de Cadenas Agrícolas y Forestales Bogotá, Colombia. 2019. https://sioc.minagricultura.gov.co/AlimentosBalanceados/Documentos/2019-03-30 Cifras Sectoriales Soya.pdf
  » https://sioc.minagricultura.gov.co/AlimentosBalanceados/Documentos/2019-03-30 Cifras Sectoriales Soya.pdf
• ¹³
  Morel, P. W. Anais II Congresso Brasilero de Soja e Mercosoja Foz de Iguazu, Brazil. 2002.
• ¹⁴
  Murillo-Williams, A., Esker, P., Allen, T., Stone, C., Frederick, R. First report of Phakopsora pachyrhizi on soybean in Costa Rica. Plant Disease Idaho, USA. v. 99, n. 3, p. 418. 2015.
• ¹⁵
  Ono, Y., Buriticá, P., Hennen, J. F. Delimitation of Phakopsora, Physopella and Cerotelium and their species on Leguminosae. Mycological Research UK. v. 96, n. 10, p. 825–850. 1992.
• ¹⁶
  Pasiecznik, N. M., Smith, I. M., Watson, G. W., Brunt, A. A., Ritchie, B., Charles, L. M. F. CABI/EPPO distribution maps of plant pests and plant diseases and their important role in plant quarantine. Eppo Bulletin UK. v. 35, n. 1, p. 1–7. 2005.
• ¹⁷
  Rossi, R. L. First report of Phakopsora pachyrhizi, the causal organism of soybean rust in the province of Misiones, Argentina. Plant Disease Idaho, USA. v. 87, n. 1, p. 102. 2003. https://doi.org/10.1094/PDIS.2003.87.1.102A
  » https://doi.org/10.1094/PDIS.2003.87.1.102A
• ¹⁸
  Rupe, J., Sconyers, L. Soybean rust. The plant health instructor. American Phytopathology Society Minnesota, USA. 2008. https://doi.org/10.1094/PHI-I-2008-0401-01
  » https://doi.org/10.1094/PHI-I-2008-0401-01
• ¹⁹
  Sousa, P. F. C., Alves, E., Castro, H. A. de, Souza, P. E. de, Almeida, Á. M. R. de, Hochenbach, S. R. Distribuição e identificação de Phakopsora pachyrhizi, agente causal da ferrugem da soja no Estado de Minas Gerais. Ciência e Agrotecnologia Londrina, Brazil. v. 31, p. 672–677. 2007. https://doi.org/10.1590/S1413-70542007000300011
  » https://doi.org/10.1590/S1413-70542007000300011
• ²⁰
  Udayanga, D., Castlebury, L. A., Rossman, A. Y., Chukeatirote, E., Hyde, K. D. The Diaporthe sojae species complex: Phylogenetic re-assessment of pathogens associated with soybean, cucurbits and other field crops. Fungal Biology UK. v. 119, n. 5, p. 383–407. 2015.
• ²¹
  Villavicencio, A., Fanaro, G. B., Araújo, M. M., Aquino, S., Silva, P. V, Mancini-Filho, J. Detection of Phakopsora pachyrhizi by polymerase chain reaction (PCR) and use of germination test and DNA comet assay after e-beam processing in soybean. Radiation Physics and Chemistry UK. v. 76, n. 11–12, p. 1878–1881. 2007.
• ²²
  Yamanaka, N., Yamaoka, Y., Kato, M., Lemos, N. G., Passianotto, A. L. de L., dos Santos, J. V. M., Benitez, E. R., Abdelnoor, R. V, Soares, R. M., Suenaga, K. Development of classification criteria for resistance to soybean rust and differences in virulence among Japanese and Brazilian rust populations. Tropical Plant Pathology Switzerland. v. 35, p. 153–162. 2010.
• ²³
  Zhang, X. C., Freire, M. C. M., Le, M. H., De Oliveira, L. O., Pitkin, J. W., Segers, G., Concibido, V. C., Baley, G. J., Hartman, G. L., Upchurch, G. Genetic diversity and origins of Phakopsora pachyrhizi isolates in the United States. Asian Journal of Plant Pathology USA. v. 6, n. 3, p. 52–65. 2012.

Publication Dates

• Publication in this collection
  03 Dec 2021
• Date of issue
  Jul-Sep 2021

History

• Received
  12 Nov 2020
• Accepted
  26 Mar 2021