SciELO - Scientific Electronic Library Online

 
vol.39 issue5ANALYSIS OF Rhizoctonia sp. GROWTH, INCIDENCE AND ANTIXENOSIS EFFECT FOR LEAF-CUTTING ANT Atta sexdens rubropilosa F. IN CLONES OF Eucalyptus grandis x Eucalyptus urophylla TREATED WITH GIBBERELLINCORRELATION BETWEEN VOLUMETRY OF EUCALYPTUS FORESTS AND PRODUCTIVITY AND COSTS OF WOOD HARVESTING MACHINES author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

Share


Revista Árvore

Print version ISSN 0100-6762On-line version ISSN 1806-9088

Rev. Árvore vol.39 no.5 Viçosa Sept./Oct. 2015

http://dx.doi.org/10.1590/0100-67622015000500015 

Article

DIVERSIDADE CULTURAL, MORFOLÓGICA E GENÉTICA DE DIAZOTRÓFICOS ISOLADOS DE NÓDULOS DE BRACATINGA1

CULTURAL, MORPHOLOGICAL AND GENETIC DIVERSITY OF DIAZOTROPHICS ISOLATED FROM NODULES OF BRACATINGA

Natalia Carolina Moraes Ehrhardt-Brocardo2 

Priscila Stocco3 

Antonio Luiz Tramontin4 

Luís Carlos Iuñes Oliveira Filho5 

Julio Cesar Pires Santos6 

2Universidade do Estado de Santa Catarina, Centro Agroveterinário, Mestrado em Manejo do Solo, Lages, SC - Brasil. E-mail:<biosapos@gmail.com>.

3Universidade do Estado de Santa Catarina, Centro Agroveterinário, Programa de Pós-Graduação em Manejo do Solo, Lages, SC - Brasil. E-mail:<stocco.priscila@gmail.com>.

4Universidade do Estado de Santa Catarina, Centro Agroveterinário, Mestrado em Manejo do Solo, Lages, SC - Brasil. E-mail:<biosolos@gmail.com>.

5Universidade do Estado de Santa Catarina, Centro Agroveterinário, Doutorado em Manejo do Solo, Lages, SC - Brasil. E-mail:<iunes1981@gmail.com>.

6Universidade do Estado de Santa Catarina, Centro Agroveterinário, Departamento de Solos e Recursos Naturais, Lages, SC - Brasil. E-mail:<bijagica@gmail.com>.

RESUMO

O nitrogênio é um dos macronutrientes essenciais aos seres vivos, o que o torna um dos fatores limitantes para o crescimento vegetal. Apenas uma parcela dos procariotos, os diazotróficos, possui a capacidade de reduzir o nitrogênio atmosférico para outras formas disponíveis às plantas. A bracatinga é uma espécie arbórea de importância econômica capaz de estabelecer simbiose mutualística com organismos diazotróficos, sendo os seus principais usos: produção de energia, madeira, forragem, indústria química de produtos naturais, apicultura, paisagismo e sombreamento e recuperação de áreas degradadas e zonas ripárias. Este estudo objetivou estabelecer relação entre a diversidade cultural e morfológica e a variabilidade genética dos isolados nodulantes em bracatinga de diferentes condições edafoclimáticas. Coletaram-se nódulos radiculares retirados ao acaso em sete áreas compreendidas entre o Vale do Itajaí, Planalto Sul e Meio-Oeste do Estado de Santa Catarina. Foi observada ampla diversidade cultural entre os diazotróficos presentes, havendo predomínio de isolados de rápido crescimento, de colônia com coloração branca leitosa, formato circular, borda lisa e superfície mucoide. Entre os parâmetros avaliados, a transparência da colônia, a produção de muco e a alteração do pH foram considerados relevantes para a diferenciação dos isolados. A caracterização taxonômica dos isolados foi realizada por comparação dos fragmentos sequenciados, sendo as espécies isoladas deste conjunto amostral pertencentes aos gêneros Burkholderia, Pantoea, Pseudomonas e Rhizobium.

Palavras-chave: Mimosa scabrella (Benth.); FBN; Endofíticos

ABSTRACT

Nitrogen is one of the essential macronutrients for living beings, which makes it one of the limiting factors for plant growth. Only a portion of the prokaryotes, the diazotrophics, has the ability to reduce atmospheric nitrogen to otherforms available to plants. Bracatinga is an economically important arboreal species capable of establishing mutualistic symbiosis with diazotrophic organisms. Its main uses are: energy production, wood, forage, chemical industry of natural products, beekeeping, landscaping and shadowing and recovery of degraded areas and riparian zones. The present study aimed to establish relationship between cultural and morphological diversity and genetic variabilityfrom nodules of bracatinga isolated in different edaphoclimatic conditions. Root nodules randomly collectedfrom seven areas between the Vale do Itajaí, Plateau South and Midwest of the State of Santa Catarina. Broad cultural diversity was observed among the present diazotrophics, and there was a predominance of fast-growing isolates of colony with milky white coloration, round shape, flat edge and mucoid surface. Among the evaluated parameters, transparency of the colony, mucus production and pH modification were considered relevant to the differentiation of isolates. Taxonomic characterization of the isolates was performed by comparison of the sequenced fragments, being the isolated species of this sample setfrom the genera Burkholderia, Pseudomonas, Pantoea and Rhizobium.

Keywords: Mimosa scabrella (Benth.); BNF; Endophytes.

1. INTRODUÇÃO

Inúmeras espécies arbóreas de interesse econômico são conhecidas dentro da família Leguminosae (Fabaceae) (AUER; SILVA, 1992). A bracatinga é uma leguminosa arbórea que apresenta capacidade de estabelecer simbiose mutualística com microrganismos do solo, notadamente com os fixadores de nitrogênio, sendo uma característica desejável para uma espécie com significativo número de usos.

Características como o rápido crescimento e elevada produtividade em altas densidades, fazem da bracatinga uma espécie que apresenta múltiplas possibilidades de uso. No noroeste do planalto catarinense, aproximadamente metade da renda dos agricultores em assentamentos de reforma agrária deve-se ao manejo de bracatingais, sobretudo na produção de lenha e carvão (STEENBOCK et al., 2011). A madeira é utilizada para vigamentos, escoras para a construção civil, móveis, caixotaria, embalagens leves, compensados, laminados e aglomerados (CARVALHO, 1994). Segundo Carvalho (1981), por ser um a espécie heliófita, perenifólia e pouco exigente quanto às condições físicas e químicas do solo, proporciona rápida cobertura de áreas de solos alterados ou degradados em que suas populações ocorrem. Regensburger et al. (2008) mencionam a utilização da espécie para recuperação de áreas degradadas pela atividade antrópica da mineração, sendo observado que a bracatinga, durante o seu desenvolvimento, auxilia no sombreamento e proteção do solo. Na indústria de produtos naturais, Petkowicz et al. (2011) descrevem o uso de sementes de bracatinga para a obtenção de galactomananas, polissacarídeos hidrossolúveis que apresentam propriedades espessantes e diversas aplicações biológicas e industriais.

O estudo da diversidade de bactérias fixadoras de nitrogênio que nodulam leguminosas tem aplicações agrícolas significativas. Em termos de manejo cultural, visa promover a sobrevivência de populações mais eficientes e específicas, e a obtenção de genótipos mais adaptados aos tipos de solo e tolerantes aos diferentes estresses ambientais.

O gênero Mimosa pode nodular com uma ampla variedade de espécies de diazotróficos, dentre os quais, representantes das α-proteobacteria. Conforme Oyaizu et al. (1993), estirpes obtidas de M. invisa e M. pudica, isoladas nas Filipinas, foram descritas como Rhizobium leguminosarum, Rhizobium sp. e Bradyrhizobium japonicum. Em Wang et al. (1999), isolados de nódulos radiculares de M. affinis, uma leguminosa nativa do México, foram identificados como Rhizobium etli. Entretanto, observou-se que se tratava de um grupo restrito de linhagens com baixa diversidade genética dentro da espécie, onde os isolados de M. affinis diferiam das estirpes de Rhizobium etli originadas a partir de plantas de feijão (P. vulgaris). Deste modo, foi proposto dentro de Rhizobium etli o bv. mimosae.

Vandamme et al. (2002) estudaram a taxonomia de isolados obtidos a partir de nódulos radiculares das leguminosas tropicais M. pudica e M. diplotricha em Taiwan. Os resultados mostraram que os isolados pertenciam a quatro espécies distintas: Burkholderia caribensis, B. cepacia gen. VI, e as novas espécies B. tuberum e B. phymatum. Outras estirpes do gênero Burkholderia foram isoladas de nódulos radiculares de M. pigra, M. casta e M. pudica, na ilha de Barro Colorado, no Panamá. Entre os 51 isolados, 44 pertenciam a estirpes de Burkholderia, enquanto os demais foram inseridos nos gêneros Rhizobium, Mesorhizobium e Bradyrhizobium (BARRETT; PARKER, 2005).

Chen et al. (2005) em estudo com bactérias nodulantes em Mimosa na América do Sul, corroboraram que estirpes de Burkholderia podem estabelecer de maneira eficaz uma interação simbiótica com as leguminosas. Para isso, isolaram estirpes oriundas de nódulos radiculares de espécies do gênero Mimosa situadas no Brasil (M. acutistipula, M. bimucronata, M. camporum, M. caesalpiniaefolia, M. flocculosa, M. laticifera, M. pigra, M. scabrella e M. tenuiflora) e na Venezuela (M. pigra). As estirpes foram classificadas como pertencentes ao gênero Burkholderia e estavam intimamente relacionadas com outras espécies nodulantes desse gênero, como B. caribensis, B. phymatum e B. tuberum.

A necessidade de se incluir o uso de essências nativas no programa de reflorestamento brasileiro estimulou a pesquisa sobre processos microbiológicos associados à essas plantas e que permitem o seu estabelecimento a baixo custo (AUER; SILVA, 1992). Devido à alta eficiência do processo de fixação biológica de nitrogênio, pesquisas que incrementem as informações sobre a fixação em espécies arbóreas possibilitam uma redução significativa dos custos energéticos e financeiros, quando comparados com a utilização de adubos minerais, uma vez que, consiste em uma alternativa que preconiza a manutenção do equilíbrio dinâmico dos ecossistemas.

O presente estudo objetivou estabelecer relação entre a diversidade cultural e morfológica e a variabilidade genética dos isolados nodulantes em bracatinga de diferentes ambientes edafoclimáticos do Estado brasileiro de Santa Catarina.

2. MATERIAL E MÉTODOS

2.1. Caracterização Cultural e Morfológica dos Isolados de Diazotróficos

O levantamento da variabilidade de bactérias fixadoras de nitrogênio em bracatinga foi realizado por meio da coleta de nódulos radiculares em sete áreas de diferentes condições edafoclimáticas, compreendidas entre o Vale do Itajaí, Planalto Sul e Meio-Oeste do Estado de Santa Catarina. Amostras de solo das áreas de coleta de nódulos radiculares de bracatinga foram analisadas no Laboratório de Análises de Solo da Universidade do Estado de Santa Catarina (UDESC-Cav) (Tabela 1).

Tabela 1 Análise de solo das áreas de coleta de nódulos radiculares de bracatinga. 

Table 1 Soil analysis of the collection areas of root nodules of bracatinga. 

Isolado Município Coordenadas (UTM) Altitude (m) Atributos Químicos do Solo
pH (H2O) Ca* Mg* Al* Na** K** P**
A12 Lages J 0573844 L 974 4,2 0 0,3 3,65 4 160 6,2
6925943 S
A31 Lages J 0574032 L 957 4,1 2 0,57 2,35 5 195 10,2
A32 6923043 S
A42 Painel J 0583532 L 1128 4,7 4 1,6 0,55 5 73 11,3
6914676 S
A52 Dona Emma J 0612441 L 563 4,3 1 0,61 0,95 5 97 9,1
7016195 S
A61 Rancho Queimado J 0693333 L 717 4,6 2 0,76 0,75 9 198 11,5
A62 6935529 S
A8 Urupema J 0613050 L 1539 4,4 4 1,51 0,89 3 170 12,4
6909807 S
A91 São Cristovão do Sul J 0563147 L 1126 4,2 4 0,99 1,2 4 87 5,5
A92 6975450 S

*Valores em cmolc/dm3;Values in cmolc/dm3

**Valores em mg/dm3;Values in mg/dm3

Os procedimentos para o isolamento e obtenção de culturas de diazotróficos foram realizados utilizando-se a metodologia descrita em Vincent (1970). De cada área de coleta, seis nódulos ao acaso foram destacados do sistema radicular. Após o isolamento, procedeu-se à caracterização cultural e morfológica conforme Martins et al. (1997). A estirpe Br3454 - Burkholderia mimosarum (CHEN et al., 2006), cedida pela Embrapa Agrobiologia (Seropédica, RJ - Brasil), foi incluída na análise como referência para comparação das características culturais e morfológicas. As colônias foram avaliadas aos três e aos sete dias de crescimento quanto aos parâmetros: tempo de crescimento; diâmetro; cor; transparência; forma; borda; elevação; superfície; volume, consistência e aparência do muco. Com a incorporação do indicador de pH azul de bromotimol no meio de cultura, a partir do quinto dia de crescimento, observou-se a coloração do meio de acordo com a natureza ácida, alcalina ou neutra dos metabólitos produzidos.

As características culturais e morfológicas dos isolados foram convertidas em uma matriz binária de presença ou ausência, agrupando-se os isolados em um Dendrograma de Similaridade, gerado por meio do aplicativo computacional PAST (Paleontological Statistics Software Package for Education and Data Analysis), utilizando o Coeficiente de Similaridade de Jaccard (HAMMER et al., 2001).

2.2. Caracterização Genética dos Isolados de Diazotróficos

A caracterização genética dos isolados foi realizada na Universidade Federal de Santa Maria (RS). Os isolados foram incubados em frascos contendo o meio líquido YM (VINCENT, 1970), por 72 horas a 28°C e 120 rpm. As etapas para o sequenciamento do gene 16S rDNA iniciaram com a extração do DNA a partir da utilização do kit ZR Fungal/Bacterial DNA MiniPrep(tm) conforme as instruções e protocolo fornecidos pelo fabricante (Zymo Research Corporation). Em seguida, procedeu-se à amplificação da região codificadora por técnica de PCR, empregando-se os conjuntos: 27F (5'AGAGTTTGATCCTGGCTCAG3') e 1492R (5'GGTTACCTTGTTAC GACTT3') (LANE, 1991). Os produtos da amplificação foram submetidos à eletroforese em gel de agarose a 1% em cuba horizontal com tampão TBE 1x. As amostras foram coradas com Blue Green (LGC Biotecnologia) em transiluminador de luz ultravioleta e documentadas com equipamento de fotografia digital. Para a realização do sequenciamento completo do gene ribossomal 16S, o produto da reação de PCR foi purificado com as instruções e protocolo do kit GenEluteTM PCR CleanUp (Sigma- Aldrich). Posteriormente à reação, as amostras foram encaminhadas para o sequenciamento na ACTGene Análises Moleculares Ltda.

2.3. Classificação Taxonômica dos Isolados de Diazotróficos

A classificação taxonômica dos isolados obtidos iniciou com a leitura e análise dos fragmentos sequenciados utilizando-se o aplicativo computacional

Staden Package (STADEN et al., 2003). A partir disso, a sequência consensual resultante foi inserida no banco de dados do NCBI (National Center for Biotechnology Information) na plataforma de recursos populares BLAST (Basic Local Alignment Search Tool).

3. RESULTADOS

3.1. Caracterização Cultural e Morfológica dos Isolados de Diazotróficos

A partir do isolamento de diazotróficos nodulantes em bracatinga nativos de diferentes ambientes edafoclimáticos, foram obtidos nove isolados que juntamente à estirpe referência (Br3454), foram submetidos a caracterização cultural e morfológica (Tabela 2).

Tabela 2 Características culturais e morfológicas dos diazotróficos nativos de diferentes ambientes edafoclimáticos e estirpe referência (Br3454) em Meio YMA (VINCENT, 1970

Table 2 Cultural and morphological characteristics ofnative diazotrophics of different edaphoclimatic conditions and reference strain (Br3454) Medium YMA (VINCENT, 1970). 

Isolado Município TC1 pH2 DC3 CC2 TC5 FC6 BC7 EC8 SC9 VM10 CAM11
A12 Lages R Al Ma B O C Li Conv M Me V
A32 Lages R Ac Ma B O C Li Conv M Me F
A42 Painel R Ac Ma B T C Li A S - -
A52 Dona Emma R N Ma B T C Li A S - -
A61 Rancho Queimado R Ac Ma B T C Li Conv M Mui A
A62 R N Ma B O C Li Conv S - -
A8 Urupema R Ac Ma B O C Li Conv M Mui G
A91 São Cristovão do Sul R Ac Ma B O C Li Conv S - -
A92 R Ac Ma B T C Li Conv M Me A
Br Não Especificado R Al Ma A T C Li A M P A

1Tempo de Crescimento (R:rápida; I:intermediária; L:lenta; MT:muito lenta); 2Alteração do pH do Meio (Ac:acidificam; Al:alcalinizam; N:não alteram); 3Diâmetro da Colônia (Ma:maior 1,0mm; Me:menor 1,0mm); 4Cor da Colônia (B:branca; A:amarela; R:rósea; V:vermelha); 5Transparência da Colônia (O:opaca; T :translúcida); 6Forma da Colônia (P:puntiforme; C:circular; I:irregular); 7Borda da Colônia (Li:lisa; Lo:lobada); 8Elevação da Colônia (Conv:convexa; Con:cônica: A:achatada); 9Superfície da Colônia (S:seca; M:mucóide); 10Volume de Muco (P:pouco; Me:médio; Mui:muito; A:abundante); 11Consistência e Aparência do Muco (V:viscosa; F:floculosa; A:aquosa; G:gomosa; B:butírica).

A estirpe referência (Br3454) apresentou como características culturais e morfológicas das colônias: rápido crescimento (até três dias), alcalinizar o meio, diâmetro maior que 1,0 mm, coloração amarela, translúcidas, formato circular e borda lisa, elevação achatada, superfície mucoide mas com pouca quantidade de muco, consistência viscosa e aparência aquosa.

Para todos os isolados o tempo de crescimento foi considerado rápido (até três dias). Com relação a algumas características coloniais, todos os isolados apresentaram colônia com diâmetro maior que 1,0 mm, formato circular e borda lisa. Quanto à coloração da colônia, todos os isolados obtidos foram de coloração branca leitosa. Para os parâmetros elevação e transparência da colônia, sete isolados apresentaram elevação convexa e três elevação achatada, e ainda, cinco foram colônias opacas e cinco foram colônias translúcidas.

Dentre os isolados que apresentaram superfície da colônia mucóide, três foram avaliados como possuindo um volume intermediário de muco, colônias com muito muco foram obtidas em dois isolados, e apenas a estirpe referência apresentou pouco volume de muco. O volume de muco abundante não teve representante. Quanto à consistência e aparência do muco, um isolado apresentou consistência e aparência viscosa, um com consistência viscosa e aparência floculosa, três com consistência viscosa e aparência aquosa, e um com consistência viscosa e aparência gomosa. Não foram obtidos representantes com muco de consistência e aparência butírica.

Com a incorporação do indicador de pH azul de bromotimol, a partir do quinto dia de crescimento, observou-se a coloração do meio de cultura de acordo com a natureza ácida, alcalina ou neutra dos metabólitos produzidos. Dentre os isolados, seis acidificaram o meio, dois alcalinizaram e os outros dois isolados não alteraram o pH do meio.

Foi observada uma ampla diversidade cultural e morfológica (Figura 1) entre os diazotróficos presentes nos nódulos de bracatinga, havendo um predomínio de isolados de rápido crescimento, de colônia com coloração branca leitosa, de formato circular, borda lisa e superfície mucóide.

Figura 1 Dendrograma de similaridade entre os diazotróficos nativos e estirpe referência (Br3454) com base em parâmetros culturais a 70% de similaridade 

Figure 1 Dendrogram of similarity between native diazotrophics and reference strain (Br3454) based on the cultural parameters of 70% similarity. 

3.2. Classificação Taxonômica dos Isolados de Diazotróficos

A partir dos conjuntos de bases obtidos pelo sequenciamento do gene ribossomal 16S e comparação no banco de dados do NCBI, os isolados de diazotróficos foram distribuídos em quatro gêneros de α, β e γ-proteobacteria. Por meio da classificação taxonômica, constatou-se que as sequências de α-proteobacteria pertencem ao gênero Rhizobium, as sequências de β- proteobacteria alinharam - se com o gênero Burkholderia e as sequências de γ-proteobacteria foram similares aos gêneros Pantoea e Pseudomonas (Figura 1).

4. DISCUSSÃO

O gênero Burkholderia foi criado por Yabuuchi et al. (1992), para adequar o antigo grupo rRNA II de Pseudomonas (P. solanacearum, P. pickettii, P. cepacia, P. gladiolos, P. mallei, P. caryophylli) e que, posteriormente, foram excluídas as espécies P. pickettii e P. solanacearum, pois foram transferidas para o gênero Ralstonia. Membros do gênero Burkholderia são organismos versáteis que ocupam uma grande variedade de nichos ecológicos. O estudo destas bactérias tem aplicabilidade na área da biorremediação, na fixação biológica de nitrogênio, na promoção do crescimento vegetal, e ainda as espécies B. mallei e B. pseudomallei, como causadoras de infecções em seres humanos, sobretudo em pacientes com fibrose cística. Tanto no ecossistema natural quanto em ecossistemas manejados, este gênero de bactérias habita comumente a rizosfera ou tecidos internos das plantas. Compant et al. (2008) considera que o grupo de bactérias com maior diversidade e adaptabilidade ambiental que realizam simbiose com plantas pertence ao gênero Burkholderia. Assim, o desenvolvimento de trabalhos que confirmem estas premissas, tem estimulado um interesse crescente no isolamento e experimentação do gênero Burkholderia na agricultura.

Na classificação taxonômica dos isolados de diazotróficos de bracatinga, houve predomínio de β-proteobacteria com ocorrência de indivíduos do gênero Burkholderia. Conforme Coenye e Vandamme (2003), esta condição pode ser explicada pela capacidade de adaptação a diferentes condições edafoclimáticas, o que garante ampla distribuição geográfica e ambiental deste gênero, quando comparado a isolados pertencentes às classes de α e γ-proteobacteria.

A estirpe referência (Br3454) incluída nas análises para comparação das características culturais e morfológicas, foi descrita no trabalho realizado por Chen et al. (2006). Neste, foram obtidos 14 isolados oriundos de nódulos radiculares de plantas da espécie Mimosa pigra situadas em Taiwan e na Venezuela e ainda da espécie Mimosa scabrella nativa do Brasil. Com base na sequência do gene 16S rRNA, todos os isolados demonstraram-se intimamente relacionados entre si e foram classificados como representantes de uma nova espécie, para os quais se denominou Burkholderia mimosarum sp. nov.

O isolado A32, oriundo do município de Lages, apresentou 99% de similaridade com Burkholderia unamae, originalmente isolada no México em plantas de café, cana-de-açúcar e milho (CABALLERO-MELLADO et al., 2004).

O isolado A8, oriundo do município de Urupema, apresentou 99% de similaridade com Burkholderia nodosa, isolada de nódulos radiculares de Mimosa bimucronata e Mimosa scabrella coletados no Brasil (CHEN et al., 2007).

O isolado A91, oriundo do município de São Cristovão do Sul, apresentou 99% de similaridade com Burkholderia caledonica, isolada do solo com videira na Escócia (COENYE et al., 2001) e com Burkholderia phytofirmans, isolada de raízes de cebola no Canadá; da rizosfera de milho, de gramíneas e do solo na Holanda (SESSITSCH et al., 2005).

O isolado A92, oriundo do município de São Cristovão do Sul, apresentou 97% de similaridade com Burkholderia bryophila, isolada de Sphagnum rubellum na Alemanha; de pastagem permanente na Holanda; e de solo agrícola no Reino Unido (VANDAMME et al., 2007) e com Burkholderia unamae, isolada de café, de cana-de-açúcar e de milho no México (CABALLERO-MELLADO et al., 2004).

O trabalho de Benhizia et al. (2004) foi precursor no relato de que estirpes pertencentes à classe γ-proteobacteria poderiam ocupar nódulos. Nesse estudo, foram identificadas estirpes pertencentes aos gêneros Pantoea e Pseudomonas a partir de nódulos radiculares de três espécies da leguminosa nativa Hedysarum em diferentes condições edafoclimáticas na Argélia. Posteriormente, no trabalho de Muresu et al. (2008) isolaram-se nódulos de espécies selvagens oriundos da Sardenha e Argélia. A partir da análise do gene 16S rRNA por PCR diretamente dos nódulos, constatou-se que a maioria destes continham diazotróficos simbiontes como população predominante, entretanto, foi registrada a presença de outras estirpes não nodulíferas pertencentes aos gêneros Pantoea e Pseudomonas.

O grupo de enterobactérias do gênero Pantoea compreende membros isolados a partir de uma grande variedade de ambientes, incluindo superfície de plantas, sementes, solo, água, animais, sangue e urina humana (BERGEY; HOLT, 1994). Na maioria das vezes, são encontrados associados com uma ampla gama de hospedeiros vegetais, como não patogênicos endófitos ou epífitos, colonizando folhas, caules e raízes (DELÉTOILE et al., 2009). Neste contexto, algumas estirpes de Pantoea podem ser benéficas para a planta hospedeira, contribuindo para a promoção do crescimento através de processos como a produção de hormônio do crescimento, solubilização do fosfato ou fixação de nitrogênio e ainda fornecendo proteção contra várias bacterioses, doenças fúngicas e podridões pós-colheita. No entanto, estirpes de Pantoea também tem sido relatadas como agentes patogênicos oportunistas em seres humanos, principalmente devido à exposição a materiais hospitalares contaminados e patógenos secundários complicando doenças pré-existentes. Os vários nichos ecológicos ocupados por espécies de Pantoea são indicativos de uma extensa diversificação dentro do gênero (MAAYER et al., 2012).

No estudo de Ibáñez et al. (2009), foi isolado o gênero Pseudomonas, pertencente à classe γ-proteobacteria, a partir de nódulos de plantas de amendoim (Arachis hypogaea L.). O isolado ao ser reinoculado não foi capaz de formar nódulos, contudo, quando coinoculado com Bradyrhizobium sp. (SEMIA 6144), considerada uma estirpe eficiente, foi detectado colonizando internamente os nódulos. A partir disso, evidenciou-se que esta estirpe, pertencente à classe γ-proteobacteria, é considerada oportunista. A capacidade de membros do gênero Pseudomonas nodularem leguminosas foi descrita no trabalho de Shiraishi et al. (2010). Neste estudo, raízes de Robinia pseudoacacia (falsa-acácia) foram coletadas de uma floresta costeira e de uma Estação Experimental da Universidade de Tóquio, no Japão. Os testes de inoculação e estudos histológicos revelaram que Pseudomonas sp. e Burkholderia sp. formaram nódulos.

Devido à qualidade do material, o baixo número de bases sequenciadas produziu alinhamento significativo do isolado A12, oriundo do município de Lages, com uma variedade de estirpes inseridas no banco de dados. O isolado apresentou 99% de similaridade com Pantoea agglomerans, isolada de sangue no Zimbábue; de cereais no Canadá; de cebola na África do Sul; e de Wisteria floribunda no Japão (DELÉTOILE et al., 2009); Pantoea ananatis, isolada de abacaxi no Brasil; e de eucalipto e cebola na África do Sul (BRADY et al., 2009); Pantoea eucalypti, isolada de eucalipto no Uruguai (BRADY et al., 2009); Pantoea vagans, isolada de eucalipto na Uganda, Uruguai e Argentina; e de milho na África do Sul (BRADY et al., 2009); Pantoea dispersa, isolada de solo no Japão; de sorgo na Índia; e de rosa selvagem na Holanda (BRADY et al., 2009); e Pantoea brenneri, isolada de expectoração e uretra humana nos EUA (BRADY et al., 2010).

O isolado A61, oriundo do município de Rancho Queimado, apresentou 98% de similaridade com Pantoea agglomerans e com Pantoea vagans.

Do mesmo modo, devido ao baixo número de bases sequenciadas, o isolado A62, oriundo do município de Rancho Queimado, obteve 92% de similaridade com Pantoea agglomerans; Pantoea ananatis; Pantoea eucalypti e com Pantoea vagans.

O isolado A52, oriundo do município de Dona Emma, apresentou 97% de similaridade com Pseudomonas aeruginosa.

Os organismos do gênero Rhizobium são caracteristicamente capazes de invadir os pêlos radiculares de leguminosas tropicais, tornando-se simbiontes intracelulares (BERGEY; HOLT, 1994). Conforme Martínez-Romero et al. (1991), a partir dos primeiros trabalhos que consideravam os membros do gênero Rhizobium nodulantes nas raízes de leguminosas, os diazotróficos que infectavam ervilhas, trevos e o feijão comum, eram agrupados em uma única espécie, Rhizobium leguminosarum, com três biovares (Rhizobium leguminosarum biovar viciae; Rhizobium leguminosarum biovar trifolii e Rhizobium leguminosarum biovar phaseoli). À medida que foram surgindo trabalhos relatando o isolamento de espécies de Rhizobium em simbiose com outros gêneros de leguminosas, a classificação deste grupo foi se modificando. Conforme mencionado, os estudos de Oyaizu et al. (1993), Wang et al. (1999), Barrett e Parker (2005) e Liu et al. (2007) descrevem espécies de Rhizobium nodulantes no gênero Mimosa.

O isolado A42, oriundo do município de Painel, apresentou 99% de similaridade com Rhizobium lusitanum, isolado de nódulos radiculares de Phaseolus vulgaris em Portugal; e de Macroptilium atropurpureum e Leucaena leucocephala (VALVERDE et al., 2006); Rhizobium tropici; e com Rhizobium leucaenae, isolado de nódulos radiculares de Leucaena leucocephala, Leucaena esculenta, Gliricidia sepium e Phaseolus vulgaris.

5. CONCLUSÃO

Observou-se ampla diversidade cultural e morfológica entre os diazotróficos presentes nos nódulos de bracatinga (Mimosa scabrella Benth.), havendo um predomínio de isolados de rápido crescimento, de colônia com coloração branca leitosa, de formato circular, borda lisa e superfície mucoide. Dentre os parâmetros avaliados, a transparência da colônia, a produção de muco e a alteração do pH foram considerados relevantes para a diferenciação dos isolados.

Os gêneros de bactérias mais frequentes em nódulos da leguminosa Mimosa scabrella (Benth.) oriundos de diferentes condições edafoclimáticas foram Burkholderia, Pantoea, Pseudomonas e Rhizobium. Destes gêneros, algumas espécies são sabidamente diazotróficas e outras podem ser endofíticas de nódulos.

6. REFERÊNCIAS

AUER, C.G.; SILVA, R. Fixação de nitrogênio em espécies arbóreas. In: CARDOSO, E.J.B.N. et al. Microbiologia do solo. Campinas: SBCS, 1992. p.157-172. [ Links ]

BARRETT, C.F.; PARKER, M.A. Prevalence of Burkholderia sp. nodule symbionts on four mimosoid legumes from Barro Colorado Island, Panama. Systematic and Applied Microbiology, v.28, n.1, p.57-65, 2005. [ Links ]

BENHIZIA, Y.; BENHIZIA, H.; BENGUEDOUAR, A.; MURESU, R.; GIACOMINI A.; SQUARTINI, A. Gamma proteobacteria can nodulate legumes of the genus Hedysarum. Systematic and Applied Microbiology, v.27, p.462-468, 2004. [ Links ]

BERGEY, D.H.; HOLT, J.C. Bergey's manual of determinative bacteriology. 9th. ed. Baltimore: Williams e Wilkins, 1994. 787p. [ Links ]

BRADY, C. L.; VENTER, S. N.; CLEENWERCK, I.; ENGELBEEN, K.; VANCANNEYT, M.; SWINGS, J.; COUTINHO, T. A. Pantoea vagans sp. nov., Pantoea eucalypti sp. nov., Pantoea deleyi sp. nov. and Pantoea anthophila sp. nov. International Journal of Systematic Bacteriology, v.59, p.2339-2345, 2009. [ Links ]

BRADY, C. L.; CLEENWERCK, I.; VENTER, S. N.; ENGELBEEN, K.; DE VOS, P.; COUTINHO, T. A. Emended description of the genus Pantoea, description of four species from human clinical samples, P. septica sp. nov., P. eucrina sp. nov., P. brenneri sp. nov. and P. conspicua sp. nov., and transfer of Pectobacterium cypripedii (Hori 1911) Brenner et al. 1973 emend. Hauben et al. 1998 to the genus as Pantoea cypripedii comb. nov. International Journal of Systematic Bacteriology, v.60, p.2430-2440, 2010. [ Links ]

CABALLERO-MELLADO, J.; MARTÍNEZ-AGUILAR, L.; PAREDES-VALDEZ, G.; ESTRADA DE LOS SANTOS, P. Burkholderia unamae sp. nov., an N2-fixing rhizospheric and endophytic species. International Journal of Systematic and Evolutionary Microbiology, v.54, p.1165-1172, 2004. [ Links ]

CARVALHO, P.E.R.; COSTA, J.M. Comportamento de essências florestais em condições de arboreto em quatro locais de estado de Paraná:"Bracatinga, uma alternativa para reflorestamento" In: SEMINÁRIO SOBRE ATUALIDADES E PERSPECTIVAS FLORESTAIS, Curitiba: Embrapa-URPFCS, 1981. p.161-170. [ Links ]

CARVALHO, P.E.R. Mimosa scabrella Bentham. In: ARVALHO, P.E.R. Espéciesflorestais Brasileiras: recomendações silviculturais, potencialidades e uso da madeira. Colombo: Embrapa-CNPF: Brasília: Embrapa- SPI, 1994. [ Links ]

CHEN, W. M.; FARIA, S. M.; JAMES, E. K.; ELLIOTT, G. N.; LIN, K. Y.; CHOU, J. H.; SHEU, S. Y.; CNOCKAERT, M.; SPRENT, J. I.; VANDAMME, P. Burkholderia nodosa sp. nov., isolated from root nodules of the woody Brazilian legumes Mimosa bimucronata and Mimosa scabrella. International Journal of Systematic and Evolutionary Microbiology, v.57, p.1055-1059, 2007. [ Links ]

CHEN, W. M.; FARIA, S. M.; STRALIOTTO, R.; PITARD, R. M.; SIMÕES-ARAÚJO, J. L.; CHOU, J. H.; CHOU, Y. J.; BARRIOS, E.; PRESCOTT, A.; ELLIOTT, G. N.; SPRENT, J. I.; YOUNG, J. P. W.; JAMES, E. K. Proof that Burkholderia strains form effective symbioses with legumes: a study of novel Mimosa-nodulating strains from South America. Applied and Environmental Microbiology, v.71, p.7461-7471, 2005. [ Links ]

CHEN, W. M.; JAMES, E. K.; COENYE, T.; CHOU, J. H.; BARRIOS, E.; de FARIA, S. M.; ELLIOTT, G. N.; SHEU, S. Y.; SPRENT, J. I.; VANDAMME, P. Burkholderia mimosarum sp nov., isolated from root nodules of Mimosa spp. from Taiwan and South America. International Journal of Systematic and Evolutionary Microbiology, v.56, p.1847-1851, 2006. [ Links ]

COENYE, T.; LAEVENS, S.; WILLEMS, A.; OHLÉN, M.; HANNANT, W.; GOVAN, J. R. W.; GILLIS, M.; FALSEN, E.; VANDAMME, P. Burkholderia fungorum sp. nov. and Burkholderia caledonica sp. nov., two new species isolated from the environment, animals and human clinical samples. International Journal of Systematic and Evolutionary Microbiology, v.51, p.1099-1107, 2001. [ Links ]

COENYE, T.; VANDAMME, P. Minireview - Diversity and significance of Burkholderia species occupying diverse ecological niches. Environmental Microbiology, v.5, p.719-729, 2003. [ Links ]

COMPANT, S.; NOWAK, J.; COENYE, T.; CLÉMENT, C.; BARKA, E. A. Review Article - Diversity and occurrence of Burkholderia spp. in the natural environment. FEMS Microbiology Reviews, v,32, n.4, p.607-626, 2008. [ Links ]

DELÉTOILE, A.; DECRÉ, D.; COURANT, S.; PASSET, V.; AUDO, J; GRIMONT, P.; ARLET, G.; BRISSE, S. Phylogeny and identification of Pantoea species and typing of Pantoea agglomerans strains by multilocus gene sequencing. Journal of Clinical Microbiology, v.47, n.2, p.300-310, 2009. [ Links ]

HAMMER, O.; HARPER, D. A. T.; RYAN, P. D. Past: Paleontological statistics software package for education and data analysis. Paleontologia Eletrônica, v.4, n.1, p.1-9, 2001. [ Links ]

IBAÑEZ, F.; ANGELINI, J.; TAURIAN, T.; TONELLI, M. L.; FABRA, A. Endophytic occupation of peanut root nodules by opportunistic Gammaproteobacteria. Systematic and Applied Microbiology, v.32, n.1, p.49-55, 2009. [ Links ]

LIU, X. Y.; WANG, E. T.; LI, Y.; CHEN, W. X. Diverse bacteria isolated from root nodules of Trifolium, Crotalaria and Mimosa grown in the subtropical regions of China. Archives of Microbiology, v.188, n.1, p.1-14, 2007. [ Links ]

MAAYER, P.; CHAN, W. Y.; BLOM, J.; VENTER, S. N.; DUFFY, B.; SMITS, T. H. M.; COUTINHO, T. A. Research Article - The large universal Pantoea plasmid LPP-1 plays a major role in biological and ecological diversification. 2012. Disponível online: http://www.biomedcentral.com/1471-2164/13/625. [ Links ]

MARRA, L. M.; SOARES, C. R. F. S.; OLIVEIRA, S. M.; FERREIRA, P. A. A.; SOARES, B. L.; CARVALHO, R. F.; LIMA, J. M.; MOREIRA, F. M. S. Biological nitrogen fixation and phosphate solubilization by bacteria isolated from tropical soils. Plant and Soil, v.357, p.289-307, 2012. [ Links ]

MARTÍNEZ-ROMERO, E.; SEGOVIA, L.; MERCANTE, F. M.; FRANCO, A. A.; GRAHAM, P.; PARDO, M. A. Rhizobium tropici, a novel species nodulating Phaseolus vulgaris L. beans and Leucaena sp. trees. International Journal of Systematic Bacteriology, v.41, n.3, p.417-426, 1991. [ Links ]

MARTINS, L. M. V.; XAVIER, G. R.; NEVES, M. C. P.; RUMJANEK, N. G. Características relativas ao crescimento em meio de cultura e a morfologia de colônias de rizóbio. Brasília: Embrapa, 1997. 14p. [ Links ]

MURESU, R.; POLONE, E.; SULAS, L.; BALDAN, B.; TONDELLO, A.; DELOGU, G.; CAPPUCCINELLI, P.; ALBERGHINI, S.; BENHIZIA, Y.; BENHIZIA, H.; BENGUEDOGUAR, A.; MORI, B.; CALAMASSI, R.; DAZZO, F.; SQUARTINI, A. Coexistence of predominantly nonculturable rhizobia with diverse, endophytic bacterial taxa within nodules of wild legumes. FEMS Microbiology Ecology, v.63, p.383-400, 2008. [ Links ]

OYAIZU, H.; MATSUMOTO, S.; MINAMISAWA, K.; GAMOU, T. Distribution of rhizobia in leguminous plants surveyed by phylogenetic identification. Journal of General and Applied Microbiology, v.39, p.339-354, 1993. [ Links ]

PETKOWICZ, C. L. O.; BOCHICCHIO, R.; REICHER, F.; SILVEIRA, J. L. M. Mimosa scabrella. In: CORADIN, L.; SIMINSKI, A.; REIS, A. Espécies Nativas da Flora Brasileira de valor econômico atual ou potencial: plantas para o futuro - Região Sul. Brasília: Ministério do Meio Ambiente, 2011. p.656-662. [ Links ]

REGENSBURGER, B.; COMIN, J. J.; AUMOND, J. J. Integração de técnicas de solo, plantas e animais para recuperar áreas degradadas. Ciência Rural, v.38, n.6, p.1773-1776, 2008. [ Links ]

SESSITSCH, A.; COENYE, T.; STURZ, A. V.; VANDAMME, P.; AIT BARKA, E.; SALLES, J. F.; VAN ELSAS, J. D.; FAURE, D.; REITER, B.; GLICK, B. R.; WANG-PRUSKI, G.; NOWAK, J. Burkholderia phytofirmans sp. nov., a novel plant-associated bacterium with plant-beneficial properties. International Journal of Systematic and Evolutionary Microbiology, v.55, p.1187-1192, 2005. [ Links ]

SHIRAISHI, A.; MATSUSHITA, N.; HOUGETSU, T. Nodulation in black locust by the Gammaproteobacteria Pseudomonas sp. and Betaproteobacteria Burkholderia sp. Systematic and Applied Microbiology, v.33, p.269-274, 2010. [ Links ]

STADEN, R.; JUDGE, D.P.; BONFIELD, J.K. Analysing Sequences Using the Staden Package and EMBOSS. In: KRAWETZ, S.A.; WOMBLE, D.D. (Ed.) Introduction to Bioinformatics: A theoretical and practical approach. Ottawa: Human Press, 2003. [ Links ]

STEENBOCK, W.; SIMINSKI, A.; FANTINI, A. C.; REIS, M. S. Ocorrência da Bracatinga (Mimosa scabrella BENTH.) em Bracatingais manejados e em florestas secundárias na região do Planalto Catarinense. Revista Árvore, v.35, n.4, p.845-857, 2011. [ Links ]

VALVERDE, A.; DELVASTO, P.; PEIX, A.; VELÁZQUEZ, E.; SANTA-REGINA, I.; BALLESTER, A.; RODRÍGUEZ-BARRUECO, C.; GARCÍA-BALBOA, C.; IGUAL, J. M. Burkholderia ferrariae sp. nov., isolated from na iron ore in Brazil. International Journal of Systematic and Evolutionary Microbiology, v.56, p.2421-2425, 2006. [ Links ]

VANDAMME, P.; GORIS, J.; CHEN, W. M.; DE VOS, P.; WILLEMS, A. Burkholderia tuberum sp. nov. and Burkholderia phymatum sp. nov., Nodulate the Roots of Tropical Legumes. Systematic and Applied Microbiology, v.25, p.507-512, 2002. [ Links ]

VANDAMME, P.; OPELT, K.; KNÖCHEL, N.; BERG, C.; SCHÖNMANN, S.; DE BRANDT, E.; EBERL, L.; FALSEN, E.; BERG, G. Burkholderia bryophila sp. nov. and Burkholderia megapolitana sp. nov., moss-associated species with antifungal and plant-growth-promoting properties. International Journal of Systematic and Evolutionary Microbiology, v.57, p.2228-2235, 2007. [ Links ]

VINCENT, J.M.A. Manual for the practical study of root-nodule bacteria. Oxford: Blackwell, 1970. 164p. (International Biological Programme Handbook, 15). [ Links ]

WANG, E. T.; ROGEL, M. A.; GARCÍA-DE LOS SANTOS, A.; MARTÍNEZ-ROMERO, J.; CEVALLOS, M. A.; MARTÍNEZ-ROMERO, E. Rhizobium etli bv. mimosae, a novel biovar isolated from Mimosa affinis. International Journal of Systematic Bacteriology, v.49, p.1479-1491, 1999. [ Links ]

YABUUCHI, E.; KOSAKO, Y.; OYAIZU, H.; YANO, I.; HOTTA, H.; HASHIMOTO, Y.; EZAKI, T.; ARAKAWA, M. Proposal of Burkholderia gen nov. and transfer of seven species of the genus Pseudomonas homology group II to the new genus, with the type species Burkholderia cepacia (Palleroni and Holmes 1981) comb. nov. Microbiology and Immunology, v.36, p.1251-1275, 1992. [ Links ]

Recebido: 25 de Fevereiro de 2014; Aceito: 07 de Julho de 2015

Creative Commons License Este é um artigo publicado em acesso aberto (Open Access) sob a licença Creative Commons Attribution, que permite uso, distribuição e reprodução em qualquer meio, sem restrições desde que o trabalho original seja corretamente citado.