SciELO - Scientific Electronic Library Online

 
vol.40 issue2Pharyngoesophageal diverticulum: evaluation of treatment resultsSpirometry evaluation in patient with tuberculosis sequelae treated by lobectomy author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

Share


Revista do Colégio Brasileiro de Cirurgiões

Print version ISSN 0100-6991

Rev. Col. Bras. Cir. vol.40 no.2 Rio de Janeiro Mar./Apr. 2013

http://dx.doi.org/10.1590/S0100-69912013000200005 

ARTIGO ORIGINAL

 

Mutação BRAF em pacientes idosos submetidos à tireoidectomia

 

 

Antonio Augusto T. Bertelli,ACBC-SPI; Antonio José Gonçalves, ACBC-SPII; Marcelo B. MenezesIII; Murilo R. MeloIV; Stefano TincaniV; Luiz Cláudio Bosco Massarollo, TCBC-SPVI

IMédico Assistente da Disciplina de Cirurgia de Cabeça e Pescoço do Departamento de Cirurgia da Faculdade de Ciências Médicas da Santa Casa de São Paulo-SP-BR
IIProfessor Adjunto, Chefe da Disciplina de Cirurgia de Cabeça e Pescoço do Departamento de Cirurgia da Faculdade de Ciências Médicas da Santa Casa de São Paulo-SP-BR
IIIProfessor Assistente da Disciplina de Cirurgia de Cabeça e Pescoço do Departamento de Cirurgia da Faculdade de Ciências Médicas da Santa Casa de São Paulo-SP-BR
IVProfessor Adjunto do Laboratório de Medicina Molecular do Departamento de Ciências Fisiológicas da Faculdade de Ciências Médicas da Santa Casa de São Paulo-SP-BR
VAcadêmico do Curso de Medicina da Faculdade de Ciências Médicas da Santa Casa de São Paulo-SP-BR
VIMédico responsável pelos Serviços de Cirurgia de Cabeça e Pescoço do Hospital Carlos Chagas e Instituto de Oncologia de Guarulhos-SP-BR

Endereço para correspondência

 

 


RESUMO

OBJETIVO: Avaliar a frequência da mutação V600E do gene BRAF em pacientes com mais de 65 anos de idade submetidos à tireoidectomia, correlacionando sua presença ou ausência com as diferentes lesões histológicas, com as variantes e com fatores prognósticos do carcinoma papilífero.
MÉTODOS: Foram avaliados 85 pacientes com mais de 65 anos de idade submetidos à tireoidectomia, analisando a mutação BRAF V600E através de reação de PCR-RT realizada após a extração do DNA dos blocos de parafina.
RESULTADOS: Detectou-se ausência ou presença da mutação BRAF V600E em 47 pacientes (55,3%). Entre os 17 carcinomas papilíferos estudados, sete apresentavam a mutação (41,2%). Demonstrou-se associação estatística entre a presença desta mutação e a variante clássica do carcinoma papilífero, além de tendência de associação com o extravasamento tireoideano.
CONCLUSÃO: A mutação BRAF nos pacientes idosos também é exclusiva do carcinoma papilífero e tem frequência expressiva. Além disso, está relacionada à variante clássica e, possivelmente, ao extravasamento tireoideano.

Descritores: Glândula tireoide. Neoplasias da glândula tireoide. Tireoidectomia. Proteínas proto-oncogênicas B-raf. Mutação.


 

 

INTRODUÇÃO

Desde a sua descoberta, as mutações BRAF têm sido relatadas em vários tipos de tumores, com frequências variáveis, sendo as mais prevalentes em melanomas e em nevus1. Um importante estudo demonstrou mutações BRAF no câncer da glândula tireóide, com prevalência apenas inferior à do melanoma2. As mutações BRAF (o gene da RAF quinase do tipo B) representam as alterações genéticas mais comuns do câncer de tireóide e esta foi a descoberta mais notável neste campo de pesquisa, nos últimos anos3. O descobrimento destas alterações criou inclusive a oportunidade do desenvolvimento de novas estratégias de tratamento para o câncer da tireóide4,5. Elas estão presentes entre 23 e 83% dos carcinomas papilíferos e são altamente específicas para este tipo histológico2,6-8. Kimura et al., em um estudo pioneiro publicado em 2003, demonstraram que a mutação BRAF ocorre em 32,8% dos carcinomas papilíferos, não ocorre em lesões benignas ou foliculares e, quando presente, não se sobrepõe com outras mutações de RAS ou de rearranjo do RET/PTC. Estes fatos apontam a via da MAP quinase como a principal responsável pela gênese do carcinoma papilífero2.

Este tumor possui algumas variantes histológicas que também foram estudadas quanto à presença da mutação BRAF. A variante clássica e a variante de células altas (relacionada com maior agressividade) parecem apresentar maior incidência da mutação BRAF. Já a variante folicular apresenta tal mutação mais raramente. Os microcarcinomas (tumores menores que 1,0cm) podem também apresentá-la, o que confirma a hipótese de que ela ocorre no início da gênese tumoral do carcinoma papilífero9.

Quanto ao prognóstico, esta mutação pode aparecer precocemente em carcinomas papilíferos pequenos, mas acredita-se que aqueles com mutações BRAF possuem fatores de pior prognóstico como variantes mais agressivas (ex: células altas), extravasamento da tireóide, estádio clínico mais avançado, metástases à distância e ainda podem estar relacionadas com o carcinoma anaplásico. Estes dados indicam que tumores com este genótipo possuem prognóstico pior6,7,9-11.

Foi demonstrada correlação entre a idade avançada e a presença da mutação BRAF em carcinomas papilíferos9,12 e baixa frequência em crianças10,13. Atualmente, nenhuma outra associação inequívoca foi estabelecida entre o genótipo e alterações clinicopatológicas do carcinoma papilífero8. Alguns estudos demonstraram correlação entre a mutação BRAF e o estadiamento avançado, metástases linfonodais, metástases à distância e recorrência do tumor5,6,9,11,14.

Xing et al. demonstraram que a mutação BRAF é um fator preditivo independente de recorrência tumoral, mesmo em pacientes com estádio I e II14. Ademais, as mutações BRAF também têm sido relacionadas com a baixa captação de iodo-131 no pós-operatório e falha do tratamento na doença recidivada15. Entretanto, Trovisco et al.12, entre outros8,16,17, não demonstraram associação da mutação BRAF com pior prognóstico. Fugazzola et al.8, estudando 260 carcinomas papilíferos, demonstraram associação com significância estatística entre a mutação BRAF e idade avançada ao diagnóstico, sem correlação com pior prognóstico ou pior evolução, em seguimento de 72 meses de acompanhamento. Ito et al., em 2009, estudaram 631 pacientes com carcinoma papilífero e seguimento médio de 83 meses, e também falharam em demonstrar pior prognóstico associado com a mutação BRAF17.

Assim, essa mutação representa importante descoberta para a pesquisa do câncer da tireoide e é a mais frequente no carcinoma papilífero. Como não existem estudos com análise multivariada, casuística expressiva e tempo de seguimento suficientes, não está claro se a mutação do BRAF está relacionada ao pior prognóstico, ou apenas ocorre em indivíduos idosos nos quais outros fatores são responsáveis por ele13,18,19. Também não existe na literatura mundial estudo da mutação BRAF específico em idosos.

O objetivo deste estudo foi avaliar a frequência da mutação V600E do gene BRAF em pacientes com mais de 65 anos de idade submetidos à tireoidectomia, correlacionando sua presença ou ausência com as diferentes lesões histológicas, com as variantes e com fatores prognósticos do carcinoma papilífero.

 

MÉTODOS

Foi realizado um estudo retrospectivo entre 1994 e 2009 selecionando todos os pacientes com mais de 65 anos de idade submetidos a qualquer tipo de operação sobre a glândula tireóide pela Disciplina de Cirurgia de Cabeça e Pescoço do Departamento de Cirurgia da Faculdade de Ciências Médicas da Santa Casa de São Paulo. Este estudo foi aprovado pelo Comitê de Ética em Pesquisa desta instituição sob o número 116/07.

Foram identificados 104 pacientes com mais de 65 anos de idade e que haviam sido submetidos a algum tipo de operação sobre a glândula tireoide. Destes, quatro foram excluídos por apresentarem tumores primários de outras regiões, como paratireoide, orofaringe e laringe, com invasão de glândula tireoide. Dos 100 restantes, 15 apresentaram dados incompletos em prontuário ou inexistência de tecido suficiente em blocos de parafina para a extração de DNA, sendo então excluídos. Assim, os prontuários de 85 pacientes foram revistos levantando informações do quadro clínico, procedimento cirúrgico realizado, tipo de lesão histopatológica e fatores prognósticos. Os dados foram transcritos para protocolo criado para este fim.

Entre os 85 pacientes, havia 78 do sexo feminino. A idade variou entre 65 e 89 anos de idade, com mediana de 70 anos. A tireoidectomia total foi realizada em 74% dos pacientes. A reação de PCR-RT realizada após a extração do DNA dos blocos de parafina conseguiu detectar a ausência ou presença da mutação BRAF V600E em 47 pacientes (55,3%). A mutação BRAF foi considerada não analisável em 38 pacientes (44,7%).

Nos 47 casos em que a mutação foi analisável, as doenças encontradas estão descritas na figura 1. Nos 22 casos de carcinoma papilífero, 17 foram analisáveis, ou seja, 77% da amostra.

 

 

Foram realizados cortes histológicos a partir dos blocos de parafina das peças das tireoidectomias para confirmar o diagnóstico e ver se o bloco possuía a lesão a ser estudada. Foram tomados cuidados para evitar contaminação de DNA utilizando-se luvas, navalhas descartáveis e manipulação dos cortes de tecido com pinça apropriada para este fim.

Foi realizada a extração de DNA, após a desparafinização utilizando xylol e etanol. O sucesso da extração foi confirmado através de espectrofotometria.

Sucedeu-se, então, a realização da PCR-ARMS (Amplification Refractory Mutation System) em tempo-real para identificação da mutação do gene BRAF no DNA extraído, utilizando controle positivo (amostra sequenciada, demonstrando a presença da mutação no gene) e negativo (sangue humano de indivíduo saudável), bem como, de reação sem a presença de DNA para garantir a ausência de amplificação inespecífica em cada placa de reação.

A utilização de equipamento de PCR em tempo-real (Applied Biosystems, ABI 7500) permite a detecção junto com a amplificação, em tubo fechado, eliminando-se a etapa pós-PCR. Com isso diminuem-se os riscos de contaminação decorrentes da manipulação de produtos amplificados. Adicionalmente, devido a que a detecção baseia-se na capacidade de um agente intercalador (SYBR Green) emitir fluorescência na presença de dupla-fita amplificada, consegue-se maior sensibilidade analítica quando se trata de produtos de PCR de tamanho inferior a 150bp.

No preparo das reações de PCR-RT, utilizou-se"solução-mãe" para cada condição estudada (normal ou mutado) (Figura 2). As temperaturas utilizadas para a PCR foram: 95ºC por 10 minutos (ativação da Taq-polimerase), seguida de 40 ciclos a 66ºC por um minuto (anelamento dos primers) e 72ºC por um minuto. Para garantir a especificidade da reação e a detecção de um único produto específico na PCR em tempo-real (PCR-RT), adicionou-se um ciclo de dissociação (desnaturação lenta) para determinação da temperatura de dissociação de cada produto da PCR (Figura 3).

 

 

 

 

Os primers utilizados foram20:

BRAFwt_s: AGGTGATTTTGGTCTAGCTACAGT;

BRAFmt_s: AGGTGATTTTGGTCTAGCTACAGA; e

BRAF_ASc: TAGTAACTCAGCAGCATCTCAGGGC

Toda reação foi avaliada inicialmente quanto à curva de amplificação (Figura 3) e, nos casos onde ela ocorreu, foi ainda verificada a curva de dissociação para garantir que a temperatura de dissociação (Tm) fosse semelhante entre os casos, com pico único de amplificação.

Nos casos cujo resultado da PCR-RT não foi analisável, optou-se por repetir todo o método para a mesma amostra, buscando resultados positivos. Nos casos de carcinoma papilífero e anaplásico, repetiu-se a extração de DNA e a PCR-RT até três vezes.

Por fim, a presença ou ausência da mutação BRAF nos casos com resultado analisável foi correlacionada com as diferentes variantes histológicas presentes (variante clássica, variante folicular e variante de células altas), assim como, com os diferentes fatores prognósticos do carcinoma papilífero (idade, presença de metástase linfonodal, presença de metástases distantes, presença de tumor multifocal, presença de extravasamento de cápsula tireoideana com invasão de estruturas adjacentes, presença de invasão vascular sanguínea ou linfática e ocorrência de recidiva local ou regional).

A análise estatística incluiu medidas de tendência central e dispersão para as variáveis quantitativas e frequências absolutas e relativas para as variáveis categóricas. Para verificar a associação entre estas variáveis, foi utilizado o teste exato de Fisher. Para a avaliação da diferença entre as médias das variáveis quantitativas (idade e tamanho do tumor), segundo o status da mutação, foi usado o teste de Mann-Whitney. Os resultados foram considerados significativos quando p <0,05 (testes bicaudais).

 

RESULTADOS

Nos 47 casos com resultado analisável, dentre as diversas lesões histológicas benignas e malignas estudadas, não se encontrou um caso sequer da mutação BRAF em lesões diferentes do carcinoma papilífero (Figura 4).

 

 

A frequência da mutação BRAF encontrada, considerando-se apenas os carcinomas papilíferos, foi 41,2% (sete casos BRAFm entre 17 com resultado analisável). Entre estes 17 pacientes, a mediana da idade foi 71 anos (média: 72,5; desvio-padrão: 6,18) e havia apenas um paciente do sexo masculino. Quanto às variantes histológicas do carcinoma papilífero, 12 (70,6%) eram da variante clássica, quatro da folicular (23,5%) e um caso de células altas (5,9%).

A mediana calculada sobre o tamanho do tumor foi 3,0cm, com média de 3,1cm e desvio-padrão de 2,32. Quanto aos demais fatores prognósticos, encontrou-se multicentricidade em oito casos, metástases linfonodais em seis, metástases distantes em um, extravasamento de cápsula em sete, invasão vascular em dez e recidiva local ou regional em dois casos.

A correlação entre a mutação BRAF e o sexo não foi significante, pelo teste exato de Fisher (p=0,412), assim como, a correlação entre a mutação BRAF e a presença de invasão vascular (p=1,0), recidiva (p=0,154), multicentricidade (p=1,0), e extravasamento da cápsula tireoideana (p=0,058). Neste último fator prognóstico, observou-se significância estatística próxima ao limite de 5%, com diferença na porcentagem de extravasamento, segundo o status da mutação BRAF (71,4% nos casos BRAFm e 28,6% nos casos BRAF-) (Tabela1).

Analisando o grupo de carcinomas papilíferos, observou-se associação com significância entre a variante clássica e o status da mutação BRAF (p=0,044) em comparação com as demais variantes histológicas agrupadas (Tabela1).

As variantes tamanho do tumor e idade foram analisadas pelo teste de Mann-Whitney não sendo encontrada associação com significância estatística, com níveis de significância estatística de 0,8066 e 0,1052, respectivamente.

Entretanto, a média e a mediana da idade do grupo de pacientes com a mutação BRAF foi 75,3 e 74 anos, respectivamente. Já no grupo de pacientes com carcinoma papilífero e ausência da mutação estudada, a média foi 70,6 e a mediana de 70 anos.

Em suma, estudando apenas indivíduos idosos, encontrou-se a presença da mutação BRAF V600E apenas em casos de carcinomas papilíferos. Entre 17 pacientes com esta lesão, sete apresentaram a mutação (41,2%). Entre 47 pacientes em que se obteve resultado analisável -17 carcinomas papilíferos, quatro outros tipos de tumores malignos e 26 lesões histológicas benignas-, nenhum outro tipo de lesão histológica apresentou a mutação. Analisando os fatores prognósticos do carcinoma papilífero, encontrou-se tendência estatística de associação entre o extravasamento e a presença da mutação BRAF, além de demonstrar associação com significância estatística entre a variante clássica do carcinoma papilífero e a presença da mutação BRAF.

 

DISCUSSÃO

A mutação pontual do BRAF tem sido bastante estudada mundialmente, com papel fundamental na gênese tumoral do câncer colorretal, melanoma e carcinoma papilífero de tireóide4. Embora muitos autores tenham demonstrado técnicas de extração de DNA a partir de tecido parafinizado, na instituição dos autores outras tentativas já haviam sido feitas com este fim, sem sucesso. Tal dificuldade era atribuída a formolização da peça e provável dano ao DNA. Finalmente, utilizando um protocolo simples de desparafinização e extração de DNA, conseguiu-se estabelecer rotina para o desenvolvimento deste estudo. Desta forma, abriu-se grande campo de pesquisa, minimizando a dependência de tecido fresco e bancos de tumores.

Houve dificuldades na extração de DNA de algumas amostras, sem qualquer correlação com a idade delas ou de seu lote. Alguns casos apresentaram PCR não analisável, sendo impossível dizer se a mutação em questão estava ou não presente, reduzindo a casuística e causando maior gasto de material, uma vez que todo o processo metodológico foi repetido.

Inicialmente este estudo foi desenvolvido para verificar a presença da mutação do BRAF em indivíduos idosos submetidos à tireoidectomia por lesões benignas e malignas. Estes resultados iniciais demonstraram a ausência desta mutação em lesões benignas e em lesões malignas diferentes do carcinoma papilífero, mesmo em indivíduos idosos, o que é corroborado pela literatura2,6-8. Xu et al., em 2003, também descreveram a presença da mutação BRAF em carcinomas papilíferos e sua ausência em bócios e lesões foliculares21.

Optou-se em pesquisar somente os casos de interesse, ou seja, carcinomas papilíferos e carcinomas anaplásicos que poderiam ter sua origem em carcinomas papilíferos. Isso explica o maior número de casos em que se teve resultado dentre os carcinomas papilíferos, quando comparados ao grupo de bócios.

A mutação BRAF está ausente em lesões benignas -bócio coloide e tireoidite de Hashimoto-, assim como em lesões malignas diferentes do carcinoma papilífero -carcinoma folicular-, em idosos. Aqueles carcinomas anaplásicos oriundos de carcinomas papilíferos podem conter a mutação22, embora neste estudo, analisou-se apenas um caso de carcinoma anaplásico que não a apresentava.

Oler e Cerutti estudaram 120 casos de carcinoma papilífero, dos quais 48% apresentaram a mutação BRAF23. Fugazzola et al., na introdução de seu estudo, cita que a prevalência mundial da mutação BRAF em carcinomas papilíferos gira em torno dos 40% (858 de 2174 casos estudados)8. Os mesmos autores, em estudo multicêntrico italiano, estudaram 260 carcinomas papilíferos e encontraram a mutação BRAF em 38% deles8. Araújo et al., em 2009, demonstraram incidência de 28,1% em carcinomas papilíferos24. Este estudo demonstra frequência um pouco acima do relatado (41,2%), o que é facilmente justificável, tendo em vista a população estudada.

A mutação BRAF também está associada à carcinomas papilíferos localmente invasivos, assim como, aos carcinomas papilíferos que apresentam extravasamento de cápsula19,25, ou mesmo à lesões não encapsuladas. Nesta casuística, encontrou-se tendência de associação com significância entre o extravasamento e a mutação BRAF (p=0,058), o que pode conferir à mutação BRAF significado prognóstico.

Lupi et al.11 estudaram 500 pacientes com carcinomas papilíferos de tireoide (230 microcarcinomas, 82 variantes clássicas, 114 variantes foliculares, 40 variantes de células altas e 34 de demais variantes). A frequência da mutação BRAF foi 43,8%, sendo mais alta na variante de células altas (80%) e na variante clássica (68,3%), e mais baixa na variante folicular (18,8%). Entre o grupo de microcarcinomas, a frequência foi 39,4%. Neste estudo, também demonstrou-se alta frequência da mutação BRAF nos carcinomas papilíferos da variante clássica (58,3%), com associação estatística entre elas. Ainda nesta série, não houve relação com significância estatística entre a idade, o sexo e a presença da mutação na análise univariada, mas houve associação estatística da mutação com invasão extratireoideana, multicentricidade, metástases linfáticas, estádio III versus estádio I e II, e ausência de cápsula tumoral. Já na análise multivariada, apenas a presença de cápsula tumoral estava associada à ausência da mutação BRAF, que, neste aspecto, sugere melhor prognóstico. Apesar da pequena casuística deste estudo, conseguiu-se demonstrar tendência de associação entre o extravasamento tireoideano e a presença da mutação BRAF, o que pode traduzir pior prognóstico.

Embora a mutação BRAF seja a anormalidade genética mais comum no carcinoma papilífero de tireoide, o seu significado prognóstico em longo prazo ainda não está bem estabelecido. Estudos contraditórios têm sido publicados, provavelmente pela heterogeneidade do carcinoma papilífero ao redor do mundo e diferentes fenótipos que se sobrepõem devido à alterações genéticas diferentes18,26.

A associação entre a variante clássica do carcinoma papilífero e a mutação BRAF já havia sido demonstrada9,12,27,28. Neste estudo, encontrou-se associação com significância entre a presença da mutação BRAF e a variante clássica do carcinoma papilífero. Mas, devido ao pequeno número de casos analisados, não se encontrou associação estatística entre os demais fatores prognósticos e o status da mutação BRAF. A associação entre a variante clássica do carcinoma papilífero e a mutação BRAF, com um fenótipo mais agressivo devido à menor expressão de genes metabolizadores de iodo, sugere a detecção da mutação BRAF como fator prognóstico, e auxiliar na escolha terapêutica em pacientes com carcinoma papilífero23.

Acredita-se que os carcinomas papilíferos com a mutação BRAF podem apresentar menor captação de iodo no pós-operatório, o que traduz fenótipo mais agressivo e maior chance de recorrência15,29,30, apontando que, nesses casos, ao menos o seguimento clínico deve ser rigoroso.

Elisei et al., publicaram a primeira série de casos com seguimento consistente para sugerir que a mutação BRAF está associada a pior prognóstico e parece ser fator independente da idade25. Em 102 pacientes com carcinoma papilífero e seguimento médio de 15 anos, a frequência da mutação foi 37,3%, mas se apresentou maior nos pacientes com mais de 60 anos de idade, o que corrobora os dados encontrados neste estudo. Demonstraram ainda, associação da mutação com estádios mais avançados, invasão vascular, e prognóstico pior25. Apesar de ter-se estudado apenas indivíduos com mais de 65 anos de idade, sabe-se que, quanto maior a idade, pior o prognóstico do carcinoma papilífero, o que motivou estudar a associação da idade com a mutação BRAF que os pacientes BRAFm possuíam com idade mais avançada.

Assim, pode se dizer que, mesmo em indivíduos idosos, a mutação BRAF foi encontrada apenas em carcinomas papilíferos, com frequência de 41,2%31. Demonstrou-se ainda a associação entre a variante clássica do carcinoma papilífero e a presença da mutação BRAF, mesmo em uma pequena casuística de pacientes idosos. Encontrou-se ainda, tendência estatística de associação entre o extravasamento tireoideano e a presença da mutação BRAF, além de maior mediana de idade neste grupo, sem significância estatística.

Entretanto, estes resultados não permitem concluir que a presença da mutação BRAF está associada com pior prognóstico, tendo em vista a pequena casuística estudada, e, mesmo porque, não interessou neste estudo o tempo de seguimento e a sobrevida destes pacientes.

Talvez, estes sejam objetivos para a continuidade deste estudo com aumento da casuística, envolvimento de outras instituições e seguimento clínico prolongado, tentando-se definir o valor prognóstico da mutação BRAF no carcinoma papilífero de tireoide.

Em conclusão, a mutação BRAF nos pacientes idosos também é exclusiva do carcinoma papilífero e tem frequência expressiva. Além disso, está relacionada à variante clássica e, possivelmente, ao extravasamento tireoideano.

Agradecimentos

À CAPES, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior, pelo apoio financeiro prestado em parte deste estudo e à Prof. Dra. Edna T. Kimura, pela gentileza de auxiliar na metodologia cedendo o controle positivo da mutação.

 

REFERÊNCIAS

1. Chiloeches A, Marais R. Is BRAF the Achilles' Heel of thyroid cancer? Clin Cancer Res. 2006;12(6):1661-4.         [ Links ]

2. Kimura ET, Nikiforova MN, Zhu Z, Knauf JA, Nikiforov TE, Fagin JA. High prevalence of BRAF mutations in thyroid cancer: genetic evidence for constitutive activation of the RET/PTC-RAS-BRAF signaling pathway in papillary thyroid carcinoma. Cancer Res. 2003;63(7):1454-7.         [ Links ]

3. Kumagai A, Namba H, Takakura S, Inamasu E, Saenko VA, Ohtsuru A, et al. No evidence of ARAF, CRAF and MET mutations in BRAFT1799A negative human papillary thyroid carcinoma. Endocr J. 2006;53(5):615-20.         [ Links ]

4. Fagin JA. How thyroid tumors start and why it matters: kinase mutants as targets for solid cancer pharmacotherapy. J Endocrinol. 2004;183(2):249-56.         [ Links ]

5. Xing M. BRAF mutation in thyroid cancer. Endocr Relat Cancer. 2005;12(2):245-62.         [ Links ]

6. Fagin JA. Challenging dogma in thyroid cancer molecular genetics-role of RET/PTC and BRAF in tumor initiation. J Clin Endocrinol Metab. 2004;89(9):4264-6.         [ Links ]

7. Knauf JA, Ma X, Smith EP, Zhang L, MitsutakeN, Liao XH, et al. Targeted expression of BRAFV600E in thyroid cells of transgenic mice results in papillary thyroid cancers that undergo dedifferentiation. Cancer Res. 2005;65(10):4238-45.         [ Links ]

8. Fugazzola L, Puxeddu E, Avenia N, Romei C, Cirello V, Cavaliere A, et al. Correlation between B-RAFV600E mutation and clinico-pathologic parameters in papillary thyroid carcinoma: data from a multicentric Italian study and review of the literature. Endocr Relat Cancer. 2006;13(2):455-64.         [ Links ]

9. Nikiforova MN, Kimura ET, Gandhi M, Biddinger PW, Knauf JA, Basolo F, et al. BRAF mutations in thyroid tumors are restricted to papillary carcinomas and anaplastic or poorly differentiated carcinomas arising from papillary carcinomas. J Clin Endocrinol Metab. 2003;88(11):5399-404.         [ Links ]

10. Kumagai A, Namba H, Saenko VA, Ashizawa K, Ohtsuru A, Ito M, et al. Low frequency of BRAFT1796A mutations in childhood thyroid carcinomas. J Clin Endocrinol Metab. 2004;89(9):4280-4.         [ Links ]

11. Lupi C, Giannini R, Ugolini C, Proietti A, Berti P, Minuto M, et al. Association of BRAF V600E mutation with poor clinicopathological outcomes in 500 consecutive cases of papillary thyroid carcinoma. J Clin Endocrinol Metab. 2007;92(11):4085-90.         [ Links ]

12. Trovisco V, Soares P, Preto A, de Castro IV, Lima J, Castro P, et al. Type and prevalence of BRAF mutations are closely associated with papillary thyroid carcinoma histotype and patients' age but not with tumour aggressiveness. Virchows Arch. 2005;446(6):589-95.         [ Links ]

13. Lima J, Trovisco V, Soares P, Máximo V, Magalhães J, Salvatore G, et al. BRAF mutations are not a major event in post-Chernobyl childhood thyroid carcinomas. J Clin Endocrinol Metab. 2004;89(9):4267-71.         [ Links ]

14. Xing M, Westra WH, Tufano RP, Cohen Y, Rosenbaum E, Rhoden KJ, et al. BRAF mutation predicts a poorer clinical prognosis for papillary thyroid cancer. J Clin Endocrinol Metab. 2005;90(12):6373-9.         [ Links ]

15. Riesco-Eizaguirre G, Gutiérrez-Martinez P, García-Cabezas MA, Nistal M, Santisteban P. The oncogene BRAF V600E is associated with a high risk of recurrence and less differentiated papillary thyroid carcinoma due to the impairment of Na+/I- targeting to the membrane. Endocr Relat Cancer. 2006;13(1):257-69.         [ Links ]

16. Fugazzola L, Mannavola D, Cirello V, Vannucchi G, Muzza M, Vicentini L, et al. BRAF mutations in an Italian cohort of thyroid cancers. Clin Endocrinol. 2004;61(2):239-43.         [ Links ]

17. Ito Y, Yoshida H, Maruo R, Morita S, Takano T, Hirokawa M, et al. BRAF mutation in papillary thyroid carcinoma in a Japanese population: its lack of correlation with high-risk clinicopathological features and disease-free survival of patients. Endocr J. 2009;56(1):89-97.         [ Links ]

18. Jarzab B, Handkiewicz-Junak D. Differentiated thyroid cancer in children and adults: same or distinct disease ? Hormones. 2007;6(3):200-9.         [ Links ]

19. Jo YS, Li S, Song JH, Kwon KH, Lee JC, Rha SY, et al. Influence of the BRAF V600E mutation on expression of vascular endothelial growth factor in papillary thyroid cancer. J Clin Endocrinol Metab. 2006;91(9):3667-70.         [ Links ]

20. Zaravinos A, Bizakis J, Spandidos DA. RKIP and BRAF aberrations in human nasal polyps and the adjacent turbinate mucosae. Cancer Lett. 2008;264(2):288-98.         [ Links ]

21. Xu X, Quiros RM, Gattuso P, Ain KB, Prinz RA. High prevalence of BRAF gene mutation in papillary thyroid carcinomas and thyroid tumor cell lines. Cancer Res. 2003;63(15):4561-7.         [ Links ]

22. Begum S, Rosenbaum E, Henrique R, Cohen Y, Sidransky D, Westra WH. BRAF mutations in anaplastic thyroid carcinoma: implications for tumor origin, diagnosis and treatment. Mod Pathol. 2004;17(11):1359-63.         [ Links ]

23. Oler G, Cerutti JM. High prevalence of BRAF mutation in a Brazilian cohort of patients with sporadic papillary thyroid carcinomas: correlation with more aggressive phenotype and decreased expression of iodide-metabolizing genes. Cancer. 2009;115(5):972-80.         [ Links ]

24. Araújo PPC. Análise da expressão do gene BRAF e suas possíveis implicações diagnósticas e prognósticas para portadores de carcinoma papilífero da tiróide [dissertação]. São Paulo: Universidade Estadual de Campinal, Faculdade de Ciências Médicas; 2009.         [ Links ]

25. Elisei R, Ugolini C, Viola D, Lupi C, Biagini A, Giannini R, et al. BRAF(V600E) mutation and outcome of patients with papillary thyroid carcinoma: a 15-year median follow-up study. J Clin Endocrinol Metab. 2008;93(10):3943-9.         [ Links ]

26. Puxeddu E, Moretti S. Clinical prognosis in BRAF-mutated PTC. Arq Bras Endocrinol Metabol. 2007;51(5):736-47.         [ Links ]

27. Kebebew E, Weng J, Bauer J, Ranvier G, Clark OH, Duh QY, et al. The prevalence and prognostic value of BRAF mutation in thyroid cancer. Ann Surg. 2007;246(3):466-70; discussion 470-1.         [ Links ]

28. Trovisco V, Vieira de Castro I, Soares P, Máximo V, Silva P, Magalhães J, et al. BRAF mutations are associated with some histological types of papillary thyroid carcinoma. J Pathol. 2004;202(2):247-51.         [ Links ]

29. Oler G, Nakabashi CD, Biscolla RP, Cerutti JM. Seven-year follow-up of a juvenile female with papillary thyroid carcinoma with poor outcome, BRAF mutation and loss of expression of iodine-metabolizing genes. Arq Bras Endocrinol Metabol. 2008;52(8):1313-6.         [ Links ]

30. Ricarte-Filho JC, Ryder M, Chitale DA, Rivera M, Heguy A, Ladanyi M, et al. Mutational profile of advanced primary and metastatic radioactive iodine-refractory thyroid cancers reveals distinct pathogenetic roles for BRAF, PIK3CA, and AKT1. Cancer Res. 2009;69(11):4885-93.         [ Links ]

31. Bertelli AAT, Melo MR, Suehara AB, Massarollo LCB, Derito CP, Gonçalves AJ, Menezes MB. Mutação BRAF em pacientes idosos com carcinoma papilífero. Rev. Bras. Cir. Cabeça Pescoço. 2011;40(4): 191-96.         [ Links ]

 

 

Endereço para correspondência:
Antonio Augusto T. Bertelli
Email: antonio.bertelli@terra.com.br

Recebido em 29/05/2012
Aceito para publicação em 03/08/2012
Conflito de interesse: nenhum
Fonte de financiamento: CAPES - Coordenação de Aperfeiçoamento de Pessoal de Nível Superior.

 

 

Trabalho realizado no Programa de Pós-Graduação em Cirurgia Geral da Faculdade de Ciências Médicas da Santa Casa de Misericórdia de São Paulo, São Paulo, SP, Brasil.

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License