SciELO - Scientific Electronic Library Online

 
vol.46 issue1Chest tube simulator: development of low-cost model for training of physicians and medical students.Trend of hospitalizations and mortality from surgical causes in Brazil, 2008 to 2016. author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

Share


Revista do Colégio Brasileiro de Cirurgiões

Print version ISSN 0100-6991On-line version ISSN 1809-4546

Rev. Col. Bras. Cir. vol.46 no.1 Rio de Janeiro  2019  Epub Jan 31, 2019

http://dx.doi.org/10.1590/0100-6991e-20192068 

Artigo Original

Análise comparativa do polimorfismo genético da glutationa transferase, do Helicobacter pylori e do vírus Epstein-Barr entre a área do tumor e as margens de ressecção proximal e distal do câncer gástrico.

Thais Messias Maccormick1 

Carlos Eduardo Souza Carvalho1 

Guilherme Pinto Bravo Neto, TCBC-RJ2 

Maria da Gloria da Costa Carvalho1 

1 Universidade Federal do Rio de Janeiro, Departamento de Patologia, Rio de Janeiro, RJ, Brasil.

2 Universidade Federal do Rio de Janeiro, Departamento de Cirurgia, Rio de Janeiro, RJ, Brasil.

RESUMO

Objetivo:

comparar o polimorfismo dos genes Glutationa S-transferase teta 1 (GSTT1) e Glutationa S-transferase mu 1 (GSTM1) da área do tumor com as margens proximal e distal de espécimes de estômago ressecados de pacientes com câncer gástrico, e investigar a presença do DNA do vírus Epstein-Barr (EBV) e Helicobacter pylori.

Métodos:

coletamos prospectivamente amostras teciduais da área do tumor e das margens de ressecção proximal e distal dos estômagos de dez pacientes com adenocarcinoma gástrico submetidos à gastrectomia com linfadenectomia D2 e submetemos esses espécimes à extração de DNA. Comparamos a área do tumor com as margens proximal e distal dos estômagos ressecados para o polimorfismo dos genes GSTT1 e GSTM1 e investigamos a presença de DNA do EBV e H. pylori. Utilizamos o exon 5 do gene p53 como controle interno da reação de PCR multiplex.

Resultados:

em um paciente, detectamos genótipos GSTT1 e GSTM1 nulos na área do tumor, em contraste com a presença de ambos os genes nas margens proximal e distal. Encontramos DNA do EBV e H. pylori na área do tumor e também nas margens proximal e distal. Em outro paciente, a margem proximal foi negativa para GSTT1 e o DNA do EBV foi negativo na margem distal. Em três pacientes, o EBV-DNA foi negativo apenas na margem distal.

Conclusão:

este é o primeiro relato em que diferentes genótipos, infecção por EBV-DNA e H. pylori foram observados no mesmo paciente, indicando provável deleção desses genes em resposta à progressão tumoral e heterogeneidade intratumoral.

Descritores: Glutationa Transferase; Polimorfismo Genético; Neoplasias Gástricas; Helicobacter pylori; Infecções por Vírus Epstein-Barr

INTRODUÇÃO

Câncer gástrico (GC) ainda é uma importante causa de morte por câncer em todo o mundo. No Brasil é a terceira neoplasia maligna mais comum entre os homens e a quinta entre as mulheres1. No entanto, a via genética para desenvolvimento e progressão deste tumor permanece incerta. É uma doença multifatorial que resulta de predisposição genética individual e de fatores ambientais, como dieta, consumo de álcool, tabagismo e infecção crônica por Helicobacter pylori ou pelo vírus Epstein-Barr (EBV)2-4. O vírus Epstein-Barr pertence ao gênero linfocryptovirus da família do gama-herpesvírus humano e infecta mais de 90% da população adulta mundial5. É um herpesvírus onipresente classificado como carcinógeno do grupo 1 pela Agência Internacional de Pesquisa sobre o Câncer. O EBV está associado a várias doenças malignas, como linfoma de Burkitt, linfoma de Hodgkin, carcinoma de nasofaringe, linfoma de células natural killer e, também, com câncer gástrico2,6. O vírus Epstein-Barr e a infecção concomitante por H. pylori estão positivamente associados à gastrite grave em pacientes pediátricos e com câncer gástrico3,4,7,8.

Glutationa S-transferases (GST; EC 2.5.1.18), uma família de supergenes de enzimas de desintoxicação de fase II, parece formar um mecanismo de proteção contra carcinogênese química9. A glutationa S-transferase mu 1 (GSTM1) e a glutationa S-transferase teta 1 (GSTT1) são enzimas críticas para a desintoxicação de carcinógenos endógenos e ambientais. O gene GSTT1 está localizado no cromossomo 22 e o GSTM1 no cromossomo 110. Deleções homozigotas ou ausência do genótipo dos genes GSTT1 e GSTM1 podem estar associadas ao aumento do risco de câncer11. O termo “polimorfismo” é usado em genética para descrever as múltiplas formas de um gene existente em um indivíduo ou em um grupo de indivíduos. As isoenzimas GSTM1 e GSTT1 exibem polimorfismos de deleção, resultando em falta de atividade, e os genótipos nulos têm sido associados a um aumento significativo no risco de câncer gástrico12.

Nosso estudo tem como objetivo comparar o polimorfismo dos genes GSTT1 e GSTM1, na área tumoral, com as margens de ressecção proximal e distal de estômagos ressecados de pacientes com câncer gástrico e investigar infecção concomitante de EBV e H. pylori.

MÉTODOS

Estudamos prospectivamente dez pacientes com adenocarcinoma gástrico submetidos à gastrectomia com linfadenectomia D2 no Hospital Universitário Clementino Fraga Filho da Universidade Federal do Rio de Janeiro. Extraímos o DNA genômico do tecido tumoral fresco e das margens de ressecção proximal e distal (Figura 1). Nós o isolamos por digestão em 500µl contendo 10mM Tris-HCl, pH 7,5, 10mM NaCl, SDS a 2%, 10mM EDTA, pH 8,0 e 15µl de proteinase K a 10mg/ml a 60ºC durante 2h. Posteriormente, adicionamos um volume igual de fenol: clorofórmio 1:1 (v/v), seguido de agitação vigorosa e centrifugação. A fase aquosa foi separada e o DNA precipitado com dois volumes de etanol absoluto a -20 durante a noite. Após centrifugação, lavamos os pellets com etanol a 70% e ressuspendemos o DNA em água Milli-Q. Submetemos o DNA genômico extraído à PCR para confirmar a integridade do DNA usando primers do gene exon 5 p53, gerando um produto de 274pb, como relatado por Pestaner et al.13. Detectamos genótipos GSTM1 e GSTT1 por reação em cadeia pela polimerase (PCR) multiplex com o exon 5 do gene p53 como controle interno para o sucesso da reação de amplificação. Os iniciadores (primers) usados ​​para GSTM1, GSTT1 e p53 estão descritos na tabela 1.

Figura 1 Peças cirúrgicas de gastrectomia dos pacientes 1 e 5 que mostram a área do tumor (T), a margem proximal de ressecção (PM) e a margem distal de ressecção (DM) 

Tabela 1 Lista dos iniciadores utilizados. 

Genes Sequência dos iniciadores senso (F) E antissenso (R) Tamanho do produto (bp*)
GSTM1** (F) 5' GAACTCCCTGAAAAGCTAAAGC 3' 220
(R) 5' GTGGGCTCAAATATACGGTGG 3'
GSTT1*** (F) 5' TTCCTTACTGGTCCTCACATCTC 3´ 450
(R) 5' TCACCGGATCATGGCCAGCA 3'
p53 (exon 5) (F) 5' GCAACCAGCCCTGTCGTGTCTCCA 3' 274
(R) 5' GGAATTCTGTTCACTTGTGCCCTGACTTTCAAC3'
EBV-TC67# 5' CAG GCT TCC CTG CAA TTT TAC AAG CGG 3' 288
EBV-TC69# 5' CCCAGAAGTATACGTGGTGACGTAGA 3'
glmM17 (F) 5'GGA TAA GCT TTT AGG GGT GTT AGG GG3' 140
(R) 5'GCA TTC ACA AAC TTA TCC CCA ATC3'

*bp: pares de bases;

**GSTM1: Glutationa S-transferase mu 1;

***GSTT1:Glutationa S-transferase teta 1;

#TC67/TC69: iniciadores de consenso; Espinoza et al.17.

As condições da PCR incluíam desnaturação inicial a 94oC durante cinco minutos seguido por 30 ciclos a 95oC durante 1min, 64oC durante 1min, 72oC durante 1 min. A extensão final foi a 72ºC por 5min14. Após a amplificação, separamos os produtos da PCR em eletroforese em gel de poliacrilamida a 10% e os visualizamos com nitrato de prata. Realizamos a coloração do gel da seguinte forma: uma etapa inicial da fixação do DNA usando solução de etanol a 10% e ácido acético a 0,37% por 10min, um passo de impregnação com solução de nitrato de prata a 0,2% por 10min seguido por enxágue com água destilada durante 30s, e um passo final com 3% de NaOH e 0,4% de formaldeído até as bandas de DNA serem claramente visíveis. Usamos a solução inicial para parar a reação15.

Detecção do vírus Epstein-Barr (EBV) e de Helicobacter pylori.

Nós avaliamos a presença do DNA do EBV e de H. pylori nas amostras usando PCR. Para detectar o DNA-EBV, empregamos os iniciadores de consenso TC67 e TC6916, cujo produto é um fragmento de 288pb. Para a detecção do DNA de H. pylori, foram utilizados pares de iniciadores para o gene glmM, conforme descrito por Espinoza et al.17 para obter um tamanho de produto de PCR de 140pb. Realizamos a amplificação para o EBV-DNA da seguinte forma: 95ºC por 1min, seguido por 40 ciclos a 94ºC por 1min, 55ºC por 2min, 72ºC por 1min e uma etapa final de extensão de 5min a 72ºC. Os parâmetros para a amplificação do DNA de H. pylori foram: 5min para a desnaturação inicial a 96ºC, depois 35 ciclos a 95ºC, 55ºC e 72ºC, sendo 1min para cada temperatura durante os ciclos, e um passo de alongamento final a 72ºC durante 7min. Armazenamos os produtos resultantes da amplificação do DNA (amplicons) a 4ºC até o uso, quando os analisamos em 10% de gel de poliacrilamida corado com prata15. Usamos linhagens de células de Raji e uma amostra positiva para infecção por H. pylori como controles de reação positiva para EBV e H. pylori, respectivamente. Os controles negativos foram amostras contendo apenas a mistura de reação sem DNA.

Esta pesquisa está em conformidade com as diretrizes para estudos em humanos e regulamentos de bem-estar animal. O comitê de pesquisa em seres humanos do nosso instituto (Comitê de Ética em Pesquisa) aprovou o protocolo do estudo (CAAE 43698915.6.0000.5257) e todos os pacientes assinaram o termo de consentimento livre e esclarecido.

RESULTADOS

As idades variaram de 51 a 75 anos; seis pacientes eram do sexo masculino e quatro do sexo feminino. A tabela 2 mostra as características do tumor, os achados cirúrgicos e patológicos, bem como, o estadiamento.

Tabela 2 Características tumorais, achados cirúrgicos e histopatológicos e estadiamento. 

Paciente Idade Sexo Localização do tumor Tipo histológico Cirurgia Margens de ressecção Estadiamento
1 51 M Cardia III Pouco diferenciado/ tipo difuso Gastrectomia total Negativa T3N3aM1
2 75 M Corpo Moderadamente diferenciado/ tipo intestinal Gastrectomia subtotal Negativa T2N0M0
3 71 M Antro Moderadamente diferenciado/ tipo intestinal Gastrectomia subtotal Negativa T3N1M0
4 53 M Cardia III Pouco diferenciado/tipo difuso Gastrectomia total Positiva T3N2M0
5 56 F Antro Moderadamente diferenciado/ tipo intestinal Gastrectomia subtotal Negativa T3N3aM0
6 53 F Fundo Pouco diferenciado/tipo difuso Gastrectomia total Negativa T3N1M0
7 52 F Antro Bem diferenciado/ tipo intestinal Gastrectomia subtotal Negativa T1aN0M0
8 69 M Antro Pouco diferenciado/tipo difuso Gastrectomia subtotal Negativa T3N2M0
9 61 M Corpo + Antro Moderadamente diferenciado/ tipo intestinal Gastrectomia total Negativa T3N1M0
10 58 F Antro Pouco diferenciado/tipo difuso Antrectomia Negativa T3N0M0

A tabela 3 mostra o polimorfismo para GSTT1 e GSTM1 da área tumoral (T), da margem distal (MD) e da margem proximal (MP).

Tabela 3 Genótipos glutationa S-transferase mu 1 (GSTM1) e glutationa S-transferase teta 1 (GSTT1).  

Genes GSTT1 GSTM1
Pacientes MD* T MP MD* T MP
1 POS NEG POS POS NEG POS
2 POS POS POS POS POS POS
3 POS POS POS NEG NEG NEG
4 POS POS POS POS POS POS
5 POS POS NEG POS POS POS
6 NEG NEG NEG POS POS POS
7 POS POS POS NEG NEG NEG
8 POS POS POS POS POS POS
9 POS POS POS POS POS POS
10 POS POS POS POS POS POS

MD*: margem distal;

T: área tumoral;

MP: margem proximal;

POS: positivo; NEG: negativo.

A tabela 4 mostra a presença ou ausência do vírus Epstein-Barr (EBV) ou de H.pylori associado ao câncer gástrico.

Tabela 4 Pesquisa de DNA de EBV e de H. pylori

EBV H.pylori
Pacientes MD* T MP MD* T MP
1 POS POS POS POS POS POS
2 NEG NEG NEG NEG NEG NEG
3 POS POS POS POS POS POS
4 NEG NEG NEG NEG NEG NEG
5 NEG POS POS POS POS POS
6 NEG NEG NEG POS POS NEG
7 NEG NEG NEG POS POS POS
8 POS POS POS POS POS POS
9 NEG POS POS NEG NEG NEG
10 NEG POS POS POS POS POS

MD*: margem distal;

T: área tumoral;

MP: margem proximal;

POS: positivo; NEG: negativo.

Detectamos produtos dos genes GSTT1 e GSTM1 nas margens proximal e distal do paciente 1, mas observamos genótipos nulos na área do tumor. No paciente 5, a margem proximal foi negativa para GSTT1. A presença de produto de amplificação para o gene p53 em todas as amostras indica o controle interno da reação. Nos outros oito pacientes analisados, não observamos tal desequilíbrio (Figura 2).

Figura 2 PCR multiplex dos genes GSTM1 e GSTT1 e do exon 5 do gene codificante da proteína p53 (Tp53), 100 pares de bases ladder (bp) controle negativo (C-). Paciente 1: DNA do fragmento tumoral (T) mostrando genótipo nulo (ausência de 480 e 215 pb) para GSTT1 e GSTM1. PM e DM correspondem às margens do tumor proximal e distal, mostrando amplificação para GSTT1 e GSTM1. O exon 5 do p53, usado como controle interno, é detectado em todas as amostras. Paciente 5: GSTT1 ausente apenas na PM 

Encontramos o DNA do EBV na área do tumor e também nas margens proximal e distal dos pacientes 1, 3 e 8, mas não na margem distal dos pacientes 5, 9 e 10. Observamos infecção concomitante por H. pylori e EBV em 5/10 (50%) dos casos (tabela 4).

DISCUSSÃO

Revisão de Knuutila et al.18,19 descreve muitas aberrações cromossômicas, como perdas e ganhos de sequências de DNA tumoral, que ocorrem em vários tumores malignos. A instabilidade cromossômica e amplificações/exclusões heterogêneas de genes estão associadas a muitas malignidades20-23. Para o câncer gástrico, Noguchi et al.24 não detectaram exclusões cromossômicas dos genes GSTM1 e GSTT1 em seu trabalho. Os autores, ao compararem seus resultados com os realizados com a população japonesa25, observaram diferenças no padrão de aberrações cromossômicas entre pacientes europeus e de populações de alto risco, como no Japão, sugerindo diferentes gêneses tumorais nessas populações. Em nosso estudo, em pacientes brasileiros com adenocarcinoma gástrico, notamos um genótipo nulo para GSTT1 e GSTM1 apenas na área tumoral de um paciente, e um genótipo nulo para GSTT1 na margem proximal em outro. Estes resultados refletem uma heterogeneidade intratumoral para os genes estudados. Em um dos nossos outros estudos, uma PCR multiplex foi realizada para os genes GSTT1 e GSTM1 usando amostras de três áreas distintas de uma neoplasia pseudopapilar sólida do pâncreas. Os resultados mostraram um genótipo nulo para GSTT1 nas áreas tumorais 1 e 3 quando comparado com a área 2. O genótipo nulo para GSTT1 nas áreas 1 e 3 do tumor indica heterogeneidade tumoral26. Este é o primeiro relato em que diferentes genótipos para GSTT1 e GSTM1, DNA do EBV e infecção por H. pylori foram observados no mesmo paciente, indicando uma provável deleção desses genes em resposta à progressão tumoral e heterogeneidade intratumoral.

A heterogeneidade intratumoral tem sido descrita como uma característica inerente à maioria dos cânceres humanos27. Uma das principais causas de heterogeneidade genética no câncer é a instabilidade genômica27. A instabilidade genômica inclui frequências aumentadas de mutação de par de bases, instabilidade de microssatélites, variações, como o número de cromossomos ou mudanças de estrutura, que também são chamadas de instabilidade cromossômica28,29.

O vírus Epstein-Barr está associado a vários tumores humanos e, em 1990, os genomas do EBV foram detectados em carcinomas gástricos30. Wu et al.31 demonstraram que a DNase do EBV pode induzir a instabilidade genômica através de dois mecanismos: diretamente, por dano ao DNA, e indiretamente, pela inibição do reparo do DNA. As infecções por H.pylori e EBV são fatores de risco bem estabelecidos para o desenvolvimento do câncer gástrico. H. pylori causa gastrite em humanos, com inflamação crônica. Acredita-se que esta inflamação crônica seja a causa da instabilidade genômica32. O H. pylori é classificado como um carcinógeno do grupo I, uma vez que essa bactéria é responsável pela maior taxa de mortes relacionadas ao câncer em todo o mundo33.

Em nosso estudo, apenas os espécimes dos pacientes 2 e 4 estavam livres de infecção por EBV ou H. pylori. Provavelmente, outros fatores de risco, como idade, sexo, tabagismo, consumo de álcool ou fatores dietéticos, estão presentes nesses pacientes. A interação entre EBV e H. pylori na mucosa gástrica pode ter efeitos sinérgicos no desenvolvimento do câncer gástrico32. Nosso estudo sugere que a infecção concomitante entre H. pylori e EBV pode ser um dos fatores responsáveis pelo surgimento do câncer gástrico. A instabilidade genômica em resposta à infecção por EBV ou H. pylori pode também ser responsável pelos genótipos nulos de GSTM1 e GSTT1 encontrados no presente estudo.

Fonte de financiamento: Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq).

REFERÊNCIAS

1 Oliveira MM, Malta DC, Guauche H, Moura L, Silva GA. Estimativa de pessoas com diagnóstico de câncer no Brasil: dados da Pesquisa Nacional de Saúde, 2013. Rev Bras Epidemiol. 2015;18(suppl 2):146-57. [ Links ]

2 Böger C, Krüger S, Behrens HM, Bock S, Haag J, Kalthoff H, et al. Epstein-Barr virus-associated gastric cancer reveals intratumoral heterogeneity of PIK3CA mutations. Ann Oncol. 2017;28(5):1005-14. [ Links ]

3 Herrera V, Parsonnet J. Helicobacter pylori and gastric adenocarcinoma. Clin Microbiol Infect. 2009;15(11):971-6. [ Links ]

4 Cárdenas-Mondragón MG, Carreón-Talavera R, Camorlinga-Ponce M, Gomez-Delgado A, Torres J, Fuentes-Pananá EM. Epstein Barr virus and Helicobacter pylori co-infection are positively associated with severe gastritis in pediatric patients. PLoS One. 2013;8(4):e62850. [ Links ]

5 Saha A, Kaul R, Murakami M, Robertson ES. Tumor viruses and cancer biology: modulating signaling pathways for therapeutic intervention. Cancer Biol Ther. 2010;10(10):961-78. [ Links ]

6 de Aquino PF, Carvalho PC, da Gama Fischer JS, de Souza AQ, Viana JS, Chalub SR, et al. Epstein-Barr virus DNA associated with gastric adenocarcinoma and adjacent non-cancerous mucosa in patients from Manaus, Brazil. Genet Mol Res. 2012;11(4):4442-6. [ Links ]

7 Buzás GM, Konderák J. Co-infection with Helicobacter pylori and Epstein-Barr virus in benign upper digestive diseases: an endoscopic and serologic pilot study. United European Gastroenterol J. 2016;4(3):388-94. [ Links ]

8 Polakovicova I, Jerez S, Wichmann IA, Sandoval-Bórquez A, Carrasco-Véliz N, Corvalán AH. Role of microRNAs and exosomes in Helicobacter pylori and Epstein-Barr virus associated gastric cancers. Front Microbiol. 2018;9:636. [ Links ]

9 Hayes JD, Pulford DJ. The glutathione S-transferase supergene family: regulation of GST and the contribution of the isoenzymes to cancer chemoprotection and drug resistance. Crit Rev Biochem Mol Biol. 1995;30(6):445-600. [ Links ]

10 Coggan M, Whitbread L, Whittington A, Board P. Structure and organization of the human theta-class glutathione S-transferase and D-dopachrome tautomerase gene complex. Biochem J. 1998;334(Pt 3):617-23. [ Links ]

11 Chen ZH, Xian JF, Luo LP. Association between GSTM1, GSTT1, and GSTP1 polymorphisms and gastric cancer risk, and their interactions with environmental factors. Genet Mol Res. 2017;16(1). [ Links ]

12 Palli D, Saieva C, Gemma S, Masala G, Gomez-Miguel MJ, Luzzi I, et al. GSTT1 and GSTM1 gene polymorphisms and gastric cancer in a high-risk italian population. Int J Cancer. 2005;115(2):284-9. [ Links ]

13 Pestaner JP, Bibbo M, Bobroski L, Seshamma T, Bagasra O. Potential of the in situ polymerase chain reaction in diagnostic cytology. Acta Cytol. 1994;38(5):676-80. [ Links ]

14 Silva MM, Da Fonseca CO, Moura-Neto R, Carvalho JF, Quirico-Santos T, Carvalho MG. Influence of GSTM1 and GSTT1 polymorphisms on the survival rate of patients with malignant glioma under perillyl alcohol-based therapy. Genet Mol Res. 2013;12(2):1621-30. [ Links ]

15 Rosenbaum V, Riesner D. Temperature-gradient gel electrophoresis. Thermodynamic analysis of nucleic acids and proteins in purified form and in cellular extracts. Biophys Chem. 1987;26(2-3):235-46. [ Links ]

16 Saito I, Servenius B, Compton T, Fox RI. Detection of Epstein-Barr virus DNA by polymerase chain reaction in blood and tissue biopsies from patients with Sjogren's syndrome. J Exp Med. 1989;169(6):2191-8. [ Links ]

17 Espinoza MG, Vazquez RG, Mendez IM, Vargas CR, Cerezo SG. Detection of the glmM gene in Helicobacter pylori isolates with a novel primer by PCR. J Clin Microbiol. 2011;49(4):1650-2. [ Links ]

18 Knuutila S, Björkqvist AM, Autio K, Tarkkanen M, Wolf M, Monni O, et al. DNA copy number amplifications in human neoplasms: review of comparative genomic hybridization studies. Am J Pathol. 1998;152(5):1107-23. [ Links ]

19 Knuutila S, Autio K, Aalto Y. Online access to CGH data of DNA sequence copy number changes. Am J Pathol. 2000;157(2):689. Erratum in: Am J Pathol. 2000;157(4):1413. [ Links ]

20 Mizuguchi A, Takai A, Shimizu T, Matsumoto T, Kumagai K, Miyamoto S, et al. Genetic features of multicentric/multifocal intramucosal gastric carcinoma. Int J Cancer. 2018;143(8):1923-34. [ Links ]

21 Maleki SS, Röcken C. Chromosomal instability in gastric cancer biology. Neoplasia. 2017;19(5):412-20. [ Links ]

22 Kurkalang S, Banerjee A, Ghoshal N, Dkhar H, Chatterjee A. Induction of chromosome instability and stomach cancer by altering the expression pattern of mitotic checkpoint genes in mice exposed to areca-nut. BMC Cancer. 2013;13:315. [ Links ]

23 Grade M, Difilippantonio MJ, Camps J. Patterns of chromosomal aberrations in solid tumors. Recent Results Cancer Res. 2015;200:115-42. [ Links ]

24 Noguchi T, Wirtz HC, Michaelis S, Gabbert HE, Mueller W. Chromosomal imbalances in gastric cancer. Correlation with histologic subtypes and tumor progression. Am J Clin Pathol. 2001;115(6):828-34. [ Links ]

25 Koizumi Y, Tanaka Si, Mou R, Koganei H, Kokawa A, Kitamura R, et al. Changes in DNA copy number in primary gastric carcinomas by comparative genomic hybridization. Clin Cancer Res. 1997;3(7):1067-76. [ Links ]

26 Chagas VLA, Ribeiro BSP, Silva MSM, Forny DN, Rosman FC, Carvalho MGC. Epigenetics of solid pseudopapillary neoplasm of the pancreas. J Pancreas. 2018;19(4):223-7. [ Links ]

27 Burrell RA, McGranahan N, Bartek J, Swanton C. The causes and consequences of genetic heterogeneity in cancer evolution. Nature. 2013;501(7467):338-45. [ Links ]

28 Al-Sohaily S, Biankin A, Leong R, Kohonen-Corish M, Warusavitarne J. Molecular pathways in colorectal cancer. J Gastroenterol Hepatol. 2012;27(9):1423-31. [ Links ]

29 Roschke AV, Kirsch IR. Targeting karyotypic complexity and chromosomal instability of cancer cells. Curr Drug Targets. 2010;11(10):1341-50. [ Links ]

30 Burke AP, Yen TS, Shekitka KM, Sobin LH. Lymphoepithelial carcinoma of the stomach with Epstein-Barr virus demonstrated by polymerase chain reaction. Mod Pathol. 1990;3(3):377-80. [ Links ]

31 Wu CC, Liu MT, Chang YT, Fang CY, Chou SP, Liao HW, et al. Epstein-Barr virus DNase (BGLF5) induces genomic instability in human epithelial cells. Nucleic Acids Res. 2010;38(6):1932-49. [ Links ]

32 Singh S, Jha HC. Status of Epstein-Barr virus coinfection with Helicobacter pylori in gastric cancer. J Oncol. 2017;2017:3456264. [ Links ]

33 Chmiela M, Karwowska Z, Gonciarz W, Allushi B, Staczek P. Host pathogen interactions in Helicobacter pylori related gastric cancer. World J Gastroenterol. 2017;23(9):1521-40. [ Links ]

Recebido: 17 de Novembro de 2018; Aceito: 30 de Dezembro de 2018

Endereço para correspondência: Maria da Gloria da Costa Carvalho E-mail: gloria@gcarvalho.org

Conflito de interesse: nenhum.

Creative Commons License Este é um artigo publicado em acesso aberto (Open Access) sob a licença Creative Commons Attribution, que permite uso, distribuição e reprodução em qualquer meio, sem restrições desde que o trabalho original seja corretamente citado.