SciELO - Scientific Electronic Library Online

vol.28 issue8Lamellar body count versus the shake test in the assessment of fetal lung maturity in diabeticsApplication of a levonorgestrel-releasing intrauterine device prior to in vitro fertilization cycles in women with adenomyosis author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand




Related links


Revista Brasileira de Ginecologia e Obstetrícia

Print version ISSN 0100-7203On-line version ISSN 1806-9339

Rev. Bras. Ginecol. Obstet. vol.28 no.8 Rio de Janeiro Aug. 2006 



Soroprevalência do vírus linfotrópico – T humano tipo I entre gestantes em Goiânia, GO, Brasil


Human T-cell lymphotropic virus type I seroprevalence among pregnant women in Goiânia, GO, Brazil



Sebastião Rodrigues de OliveiraI; Mariza Martins AvelinoII

IMédico Ginecologista-Obstetra da Secretaria Municipal de Saúde de Goiânia e Mestrando do Instituto de Patologia Tropical e Saúde Pública da Universidade Federal de Goiás – UFG – Goiânia (GO), Brasil
IIProfessora do Departamento de Pediatria e Puericultura da Faculdade de Medicina e do Programa de Pós-Graduação em Medicina Tropical (Doenças Infecciosas e Parasitárias) da Universidade Federal de Goiás – UFG – Goiânia (GO), Brasil





OBJETIVO: avaliar a soroprevalência do vírus linfotrópico de células-T humano tipo I (HTLV-I) entre as gestantes atendidas na rede pública municipal de saúde de Goiânia, estado de Goiás, na região Centro-Ceste do Brasil, e algumas características epidemiológicas do grupo estudado.
MÉTODOS: durante o período de setembro de 2003 a dezembro de 2004, 15.485 grávidas foram rastreadas para o HTLV-I utilizando o ensaio imunoenzimático, a partir de sangue seco em papel de filtro, e para a confirmação da infecção realizou-se a reação em cadeia de polimerase, a partir do sangue total. Foram avaliados os parâmetros epidemiológicos: idade média, idade de 30 anos ou mais, grau de instrução menor que nove anos, estado civil e número de gestações. Os parâmetros idade média, idade de 30 anos ou mais e grau de instrução menor que nove anos foram comparados entre os grupos de gestantes infectadas e não infectadas. O teste t de Student e o teste exato de Fisher foram utilizados para os cálculos estatísticos.
RESULTADOS: a prevalência encontrada foi 0,1%. Entre as gestantes infectadas a média de idade foi 26,4 anos, 43,7% delas apresentavam idade de 30 anos ou mais e 62,5% estudaram menos que nove anos. No grupo de gestantes não infectadas a média de idade foi 24,4 anos, 15,4% delas apresentavam idade de 30 anos ou mais e apenas 41,5% estudaram menos que nove anos. Só ocorreu diferença com significância estatística para os parâmetros idade de 30 anos ou mais e grau de instrução menor que nove anos.
CONCLUSÃO: esse estudo demonstra que a soroprevalência do HTLV-I entre gestantes em Goiânia no período estudado foi 0,1%. Ela foi maior em gestantes com idade de 30 anos ou mais e naquelas com grau de instrução menor que nove anos.

Palavras chave: Vírus 1 linfotrópico T humano; Transmissão vertical de doença; Gestantes; Complicações infecciosas na gravidez; Estudos soroepidemiológicos 


PURPOSE: to assess human T-cell lymphotropic virus type I (HTLV-I) seroprevalence among pregnant women attended at Public Health Units in Goiânia-Goiás and some epidemiologic characteristics of the studied group.
METHODS: from September/2003 to December/2004, 15,485 pregnant women were submitted to enzyme-linked immunoabsorbent assays (ELISA), to screen HTLV-I, using filter paper - dried blood in, and to confirm the infection, polymerase chain reaction (PCR) of whole blood was performed. The epidemiologic factors evaluated were: average age, age of 30 years and above, schooling less than nine years, marital status and number of pregnancies. The factors average age, age of 30 years and above, and schooling less than nine years were compared between the infected and non-infected pregnant group. Statistical analysis used Fisher's exact test and Student's t test.
RESULTS: the found prevalence was 0.1%. The average age among the infected pregnant group was 26.4 years, 43.7% of them being 30 years old and above, and 62.5% with schooling less than nine years. The non-infected group showed an average age of 24.4 years, 15.4% of them being ³ 30 years old and above, and only 41.5% with schooling less than nine years. Significant statistical difference was noticed only regarding age of 30 years and above and schooling less than nine years.
CONCLUSION: the study shows that HTLV-I seroprevalence among pregnant women in Goiânia during the studied period was 0.1%. It occurred more among pregnant women who were 30 years old and above and those with schooling of less than nine years.

Keywords: Human T-lymphotropic virus 1; Disease transmission, vertical; Pregnant women; Pregnancy complications, infectious; Seroepidemiologic studies




Vinte e cinco anos após o isolamento do vírus HTLV-I, vários aspectos virológicos e epidemiológicos já são conhecidos, mas a fisiopatologia das doenças associadas a esse vírus, assim como a terapêutica, ainda estão longe de serem definidas1.

O HTLV-I é um vírus da família Retroviridae, apresenta partícula viral encapsulada e o genoma constituído por fita única diplóide de RNA (ácido ribonucléico). É evidente o seu tropismo pelos linfócitos–T 2. Sua distribuição é cosmopolita e muito heterogênea, sendo que o Japão apresenta a maior taxa de soroprevalência mundial, atingindo cerca de 17% em sua região sul3. Além desse país, o Caribe, a África equatorial, as ilhas da Melanésia, as ilhas Salomão, o nordeste do Irã e a América do Sul também são áreas consideradas endêmicas3. São desconhecidas as razões para a divergência da prevalência desse vírus em áreas vizinhas, como o sul do Japão, em que é alta, e regiões próximas da Coréia, Rússia e China, nas quais é baixa4. No Brasil estima-se que haja 2,5 milhões de pessoas infectadas pelo HTLV-I, sendo mais prevalente nas regiões Norte e Nordeste5. Em estudo de triagem sorológica realizada em 26 centros urbanos do país, a prevalência dos vírus HTLV-I/II variou de 0,4/1000 em Florianópolis a 10/1000 em São Luiz e em Goiânia foi 6,6/10006.

Entre as gestantes, o Japão apresenta uma prevalência média de 3,9%7, Londres de 0,03%8 e no Brasil, observaram-se 0,8% em Salvador9 e 0,1% em Botucatu10.

Acredita-se que durante a vida, 5% dos portadores do HTLV-I desenvolverão alguma doença associada a ele após um longo período de incubação, cerca de 20 a 30 anos2. As doenças definitivamente relacionadas ao HTLV-I, até o momento, são: leucemia/linfoma de células-T do adulto, mielopatia associada ao HTLV-I/paraparesia espástica tropical e uveíte associada ao HTLV-I11. Quanto ao envolvimento desse vírus com doenças infecciosas, reumáticas e psiquiátricas ainda são necessárias mais investigações12.

Sabe-se que o indivíduo é infectado por sangue e secreções genitais contaminados e de forma vertical, principalmente pela amamentação. Os estudos mostram que a possibilidade de transmissão mãe-filho, quando a amamentação é livre, varia de 15,4 a 25%13 e o tempo de aleitamento é diretamente proporcional à possibilidade de transmissão. É possível que haja outras vias de transmissão vertical, como a transplacentária e o canal de parto, já que a taxa de infecção entre as crianças não amamentadas é de 3,3 a 12,8%14. No Japão, o simples ato de bloquear a amamentação reduziu a transmissão vertical em 80%13.

O diagnóstico da infecção pelo HTLV-I é realizado, rotineiramente, pela detecção de anticorpos específicos para componentes antigênicos de diferentes partes do vírus. Ultimamente, tem-se dado preferência a reações imunoenzimáticas (ELISA) que utilizam, como substrato antigênico, lisados virais de HTLV-I acrescidos de antígenos do HTLV-II, aumentando assim a sensibilidade do teste. São freqüentes os resultados falso-positivos dessas reações, tornando-se necessária a realização de testes confirmatórios como o Western blot ou a reação em cadeia de polimerase (PCR)15.

Quanto à profilaxia da transmissão vertical, o uso de drogas anti-retrovirais como o AZT (azidodeoxitimidina) durante a gravidez e o parto não apresentou resultados conclusivos em estudos in vitro16,17. Com relação à via de parto a ser indicada para as gestantes infectadas pelo HTLV-I, ainda não existe consenso. Poucos estudos isolados sugerem que a realização de cesariana eletiva diminui a transmissão vertical18,19.

O HTLV-I apresenta importante estabilidade do genoma, o que facilita o desenvolvimento de vacinas. Isso já está sendo explorado, mas como as medidas profiláticas são eficientes e o vírus é endêmico apenas em países pobres, exceto o Japão, o sucesso deve demorar a ser alcançado2.

Como já citado anteriormente, as conseqüências que podem advir da infecção adquirida verticalmente são graves. No Brasil, foram poucos os estudos realizados envolvendo o HTLV-I e a gestação, sendo que em Goiás, particularmente, nenhum estudo foi até agora publicado. Esse estudo visa determinar a soroprevalência do HTLV-I entre gestantes de cidade da região Centro-Oeste do Brasil e avaliar algumas características epidemiológicas dessa coorte.



Esse estudo transversal foi realizado, prospectivamente, de setembro de 2003 a dezembro de 2004, com todas as gestantes que freqüentaram o pré-natal em todas as unidades da Secretaria Municipal de Saúde de Goiânia. Participaram do estudo 15.485 gestantes que, na maioria das vezes, apresentavam baixo nível socioeconômico. Foram submetidas à coleta de sangue para a realização de vários exames da rotina pré-natal, entre eles a sorologia para o HTLV-I. Essa amostra era colocada em papel de filtro (S&S 903), corretamente identificado e deixado para secagem em pequena estante apropriada, à temperatura ambiente. Após estar seco o papel de filtro era enviado para o laboratório da APAE (Associação de Pais e Amigos dos Excepcionais) em Goiânia, onde eram retirados fragmentos circulares de 3,2 mm de diâmetro da parte do papel de filtro contendo a gota seca de sangue e um desses fragmentos era utilizado para realizar o ELISA pó meio do Kit Detect® para HTLV, fabricado por Adaltis Inc. Montreal, Quebec, Canadá. Esse kit contém peptídeos sintéticos do HTLV-I (env gp 46, gap p19 e env gp 46b) e do HTLV-II (env gp 46). O protocolo utilizado seguiu as normas orientadas pelo fabricante. Para cada bateria de testes eram utilizados três controles negativos, dois positivos e um controle do substrato. O valor de corte considerado foi a média dos controles negativos acrescida de 0,15 e os resultados com valores entre 10% acima e 10% abaixo do valor de corte eram considerados indeterminados. A sensibilidade e a especificidade do teste, descritas pelo fabricante, eram respectivamente 100 e 99,8%.

As pacientes que apresentavam sorologia positiva ou indeterminada foram convocadas para nova coleta sangue, por punção venosa, em tubo a vácuo de cinco mL contendo solução anticoagulante de EDTA (ácido etilenodiaminotetracético). Esse frasco era embalado de forma adequada e enviado ao laboratório de referência, para se realizar a PCR para a confirmação da infecção e distinção entre o HTLV-I e HTLV-II.

Os exames de PCR foram realizados utilizando o Kit GFX® da empresa Amersham e a mistura pronta para uso das empresas Eppendorf ou Promega. Os primers utilizados foram o 12P1 (5´-GCCTTCATGTATGGGTAGACACCTT-3´) e SK111 (5´-GTGGTGGATTTGCCATCGGGTTTT-3) para a ciclagem 1, ao passo que para a ciclagem 2 foram utilizados o 12P5 (5´- TGGTTGATTGTCCATAGCGCT -3´), o 1P1 (AGCCATCTCAGCTACCCAAAAGAGA-3´) e o 2P3 (CGCATCAAGCATTC TACCCA-3´). Se a banda resultante fosse de 318 pb o resultado seria positivo para o HTLV-I, ao passo que uma banda de 161 pb daria um resultado reagente para o HTLV-II. Os produtos amplificados eram analisados em gel de agarose a 2% com brometo de etídio.

Os resultados dos exames foram armazenados em um banco de dados do laboratório da APAE, em Goiânia, e depois enviados para as unidades da Secretaria Municipal de Saúde (SMS). Através desse banco de dados, o número do SISPRENATAL das gestantes infectadas pelo vírus HTLV-I foi identificado e os dados de interesse do estudo (parâmetros epidemiológicos) foram coletados, na unidade de saúde de origem, da folha padronizada pela SMS para o atendimento pré-natal, contida no prontuário médico da gestante.

Os dados epidemiológicos das gestantes não infectadas, utilizados para a comparação com os daquelas infectadas, foram obtidos de um estudo realizado em 19.658 gestantes de Goiânia, no ano de 200020, os quais foram transferidos, na mesma proporção, para as gestantes do estudo atual (n=15.484). No estudo citado anteriormente, Giglio et al.20 observaram que a média de idade entre as gestantes era de 24,4 anos, que 15,6% delas apresentavam idade de 30 anos ou mais e que 41,5% estudaram menos que nove anos. No estudo de Giglio et al.20, não foram avaliados os parâmetros paridade e estado civil, não sendo possível, portanto, a comparação desses parâmetros entre os grupos de gestantes infectadas e não infectadas. Para a análise estatística utilizou-se o teste t de Student para comparar as médias de idade e o teste exato de Fisher para os demais cálculos.

Os critérios estabelecidos para a exclusão da pesquisa foram o não comparecimento da gestante rastreada como positiva para a realização do exame confirmatório e a falta de acesso ao prontuário na unidade básica de saúde.

Esse estudo foi submetido e aprovado pelo Comitê de Ética em Pesquisa Humana e Animal do Hospital das Clínicas da Universidade Federal de Goiás.



Nesse estudo, foram avaliadas 15.485 gestantes. O rastreamento pelo ELISA mostrou 19 resultados alterados, sendo 17 reagentes e dois indeterminados. Uma paciente com resultado reagente não compareceu para a recoleta de sangue para realizar a PCR, mesmo sendo notificada por busca ativa, e foi excluída do estudo, configurando uma perda de 5,9%. O exame de PCR confirmou todos os resultados reagentes rastreados e descartou os indeterminados, resultando em prevalência de 0,1% (16/15.484) do vírus HTLV-I entre as gestantes atendidas nas unidades da SMS de Goiânia. Nenhum caso de infecção pelo HTLV-II foi diagnosticado.

A idade das pacientes infectadas variou de 16 a 37 anos, sendo que a média foi 26,4 anos e 43,7% delas (7/16) apresentavam 30 anos ou mais. Entre as gestantes não infectadas a idade média foi 24,4 anos e apenas 15,6% apresentavam 30 anos ou mais. Ao se comparar a média de idade entre os grupos, não se observou diferença com significância estatística (teste t de Student; p=0,242), mas quanto ao parâmetro idade de 30 anos ou mais, houve diferença significativa (Tabela 1).



Ao se avaliar o grau de instrução, observou-se que 62,5% das gestantes infectadas haviam estudado por um período inferior a nove anos, ao passo que naquelas não infectadas isso foi observado em apenas 41,5% delas, o que foi significativo (Tabela 2).



O número médio de gestações foi 3,3 entre as grávidas infectadas, sendo que 25% (4/16) delas eram primigestas, 18,7% (3/16) secundigestas e 56,2% (9/16) já haviam engravidado três ou mais vezes. Quanto ao estado civil, 43,7% (7/16) eram solteiras, 31,2% (5/16) amasiadas e 25% (4/16) eram casadas.



O HTLV-I é endêmico em várias partes do mundo, inclusive no Brasil, e apresenta algumas características epidemiológicas peculiares (prevalência diferenciada em um mesmo país de acordo com a área geográfica, é mais comum no sexo feminino, há incremento da soroprevalência com o avançar da idade, especialmente nas mulheres, e pode-se identificar grupos de risco definidos como usuários de drogas injetáveis, profissionais do sexo e portadores do HIV)21. Condições socioeconômicas desfavoráveis têm sido associadas a maior prevalência do vírus em áreas consideradas endêmicas22.

Os estudos de soroprevalência desse vírus em gestantes, no Brasil, são escassos e em Goiás ainda não havia sido publicada qualquer pesquisa a respeito. Nesse estudo, a prevalência obtida foi 0,1%. Esse valor é menor que 0,8% encontrado em Salvador, Bahia9, mas é similar a 0,1% relatado em Botucatu, São Paulo10. Sabe-se que, no Brasil, Salvador é a cidade que apresenta a maior soroprevalência do HTLV-I (1,5% entre os hemodoadores) e acredita-se que esse fato se deva a alta porcentagem de negros entre a população daquela capital5. É aceito que uma das vias de ingresso do HTLV-I na América do Sul tenha sido pelo tráfico de escravos africanos para o Brasil, que ocorreu durante muitas décadas15. Outra rota, mais recente, de entrada desse vírus no Brasil foi a imigração japonesa que ocorreu no início do século passado6. Goiânia, assim como Botucatu, é cidade que não apresenta uma grande proporção de negros e amarelos na sua população e, provavelmente, não sofreu intensamente essas influências raciais.

A prevalência do vírus HTLV-I aumenta com a idade. A literatura mundial refere que especialmente no sexo feminino e, principalmente, após os 40 anos é nítido o aumento da soropositividade para esse vírus em áreas endêmicas23. Nesse estudo, ficou estabelecida a associação da infecção pelo HTLV-I ao parâmetro idade de 30 anos ou mais. Com relação à média de idade, entre as infectadas ela foi de 26,4 anos, ao passo que naquelas não infectadas foi de 24,4 anos. Essa diferença não foi significativa, possivelmente, pelo fato de o tamanho da amostra de infectadas ser reduzido.

O HTLV-I é endêmico apenas em países em desenvolvimento e subdesenvolvidos, exceto o Japão. É relatada sua associação a fatores socioeconômico-culturais, como o grau de instrução. Em estudo realizado no Peru, observou-se que esse vírus foi cinco vezes mais prevalente em mulheres que estudaram por período de até sete anos quando comparadas com as que cursaram por período maior22. No nosso estudo, nível de instrução menor que nove anos foi observado em 62,5% das infectadas e em 41,5% das não infectadas, diferença que mostrou significância estatística. Esse número é muito próximo ao nível de significância estabelecido pelo teste e, portanto, pode sofrer alterações com o aumento do número de pacientes infectadas ou com a época do estudo, já que o acesso à escola no Brasil vem sendo facilitado e estimulado pelas autoridades competentes.

Apesar de em números absolutos o valor de 0,1% ser considerado pequeno, ele torna-se importante pela possibilidade de ocorrer transmissão vertical. Nesse trabalho, 56,2% das gestantes já haviam engravidado três ou mais vezes e amamentado livremente seus filhos anteriores. Como o rastreamento para o HTLV-I não era realizado na rotina pré-natal, perdeu-se a oportunidade de proporcionar melhor qualidade de atenção à saúde materno-infantil, expondo as crianças a riscos evitáveis.

Entre as gestantes infectadas, 43,7% eram solteiras, 31,2% amasiadas e 25% casadas. É conhecido que a transmissão sexual é importante via de infecção do HTLV-I. Apesar de essa via ser mais eficiente do homem para a mulher, a orientação quanto ao uso de preservativos nas relações sexuais é fundamental para todos os casos positivos, independentemente do sexo afetado2. Como é provável que a troca de parceiros sexuais entre as pessoas solteiras seja mais freqüente que entre as casadas, há maior probabilidade de disseminação do vírus nessa população, o que pode ser evitado com o diagnóstico da infecção e uso adequado do preservativo.

Durante a visita do pesquisador às unidades básicas de saúde, observou-se, entre os profissionais que lidam com as gestantes, carência de informação sobre o HTLV-I, situação que muitas vezes resultava em confusão desse vírus com o HIV. Assim, a divulgação da importância da infecção pelo HTLV-I nas gestantes poderia contribuir para melhorar a conduta na assistência ao binômio mãe-filho.

Apesar de a prevalência encontrada do HTLV-I ser relativamente pequena, o rastreamento para esse vírus durante o pré-natal se justifica, já que a possibilidade de transmissão vertical é alta e as medidas profiláticas são simples e eficientes. É importante que se estenda o ELISA para o HTLV-I aos parceiros sexuais das gestantes infectadas, com a finalidade de atenuar a disseminação do vírus. É necessário que se criem mecanismos eficientes, para que as crianças nascidas de mães portadoras do HTLV-I tenham acesso a alimentação apropriada e segura, como alternativa ao leite materno, a fim de que o seu desenvolvimento não seja comprometido. Além disso, é preciso garantir que tenham acompanhamento médico adequado objetivando diagnosticar uma possível infecção pelo HTLV-I.



1. Gallo RC. History of the discoveries of the first human retroviruses: HTLV-1 and HTLV-2. Oncogene. 2005;24(39):5926-30.        [ Links ]

2. Gessain A. Rétrovirus HTLV-1 et HTLV-2. Encycl Med Chir. 2004;1(3):203-20. [Maladies infectieuses, 8-050-D-10].        [ Links ]

3. Vrielink H, Reesink HW. HTLV-I/II prevalence in different geographic locations. Transf Med Rev. 2004;18(1):46-57.        [ Links ]

4. Proietti FA, Carneiro-Proietti AB, Catalan-Soares BC, Murphy EL. Global epidemiology of HTLV-I infection and associated diseases. Oncogene. 2005;24(39):6058-68.        [ Links ]

5. Carneiro-Proietti ABF, Ribas JGR, Catalan-Soares BC, Martins ML, Brito-Melo GEA, Martins-Filho AO, et al. Infecção e doença pelos vírus linfotrópicos humanos de células T (HTLV-I/II) no Brasil. Rev Soc Bras Med Trop. 2002;35(5):499-8.        [ Links ]

6. Catalan-Soares B, Carneiro-Proietti ABF, Proietti FA; Interdisciplinary HTLV Research Group. Heterogeneous geographic distribution of human T-cell lymphotropic viruses I and II (HTLV-I/II): serological screening prevalence rates in blood donors from large urban areas in Brazil. Cad Saúde Pública. 2005;21(3):926-31.        [ Links ]

7. Maehama T. Human T cell leukemia virus-1 in pregnancy. Int J Gynaecol Obstet. 2004;87(3):247-8.        [ Links ]

8. Ades AE, Parker S, Walker J, Edginton M, Taylor GP, Weber JN. Human T cell leukaemia/lymphoma virus infection in pregnant women in the United Kingdom: population study. BMJ. 2000;320(7248):1497-501.        [ Links ]

9. Bittencourt AL, Dourado I, Filho PB, Santos M, Valadão E, Alcântara LC, Galvão-Castro B. Human T-cell lymphotropic virus type 1 infection among pregnant women in northeastern Brazil. J Acquir Immune Defic Syndr. 2001;26(5):490-4.        [ Links ]

10. Olbrich Neto J, Meira DA. Soroprevalência de vírus linfotrópico de células T humanas, vírus da imunodeficiência humana, sífilis e toxoplasmose em gestantes de Botucatu – São Paulo – Brasil: fatores de risco para vírus linfotrópico de células T humanas. Rev Soc Bras Med Trop. 2004;37(1):28-32.        [ Links ]

11. Manns A, Hisada M, La Grenade L. Human T-lymphotropic virus type I infection. Lancet. 1999;353(9168):1951-8.        [ Links ]

12. Carneiro-Proietti AB, Catalan-Soares BC, Castro-Costa CM, Murphy EL, Sabino EC, Hisada M, et al. HTLV in the Americas: challenges and perspectives. Rev Panam Salud Publica. 2006;19(1):44-53.        [ Links ]

13. Hino S, Katamine S, Miyata H, Tsuji Y, Yamabe T, Miyamoto T. Primary prevention of HTLV-I in Japan. J Aqcuir Immune Defic Syndr Hum Retrovirol. 1996;13 Suppl 1:S199-203.        [ Links ]

14. Bittencourt AL. Vertical transmission of HTLV-I/II: a review. Rev Inst Med Trop Sao Paulo. 1998;40(4):241-50.        [ Links ]

15. Santos FLN, Lima FWM. Epidemiologia, fisiopatogenia e diagnóstico laboratorial da infecção pelo HTLV-I. J Bras Patol Med Lab. 2005;41(2):105-16.        [ Links ]

16. Macchi B, Faraoni I, Zhang J, Grelli S, Favalli C, Mastino A, et al. AZT inhibitis the transmission of human T-cell leukaemia/lymphoma virus type I to adult peripheral blood mononuclear cells in vitro. J Gen Virol. 1997;78(Pt 5):1007-16.        [ Links ]

17. Zhang J, Balestrieri E, Grelli S, Matteucci C, Pagnini V, Dagostini C, et al. Efficacy of 3'-azido 3'deoxythymidine (AZT) in preventing HTLV-1 transmission to human cord blood mononuclear cells. Virus Res. 2001;78(1-2):67-78.        [ Links ]

18. Bittencourt AL, Sabino EC, Costa MC, Pedroso C, Moreira L. No evidence of vertical transmission of HTLV-I in bottle-fed children. Rev Inst Med Trop São Paulo. 2002;44(2):63-5.        [ Links ]

19. Lin H, Kao JH, Hsu HY, Mizokami M, Hirano K, Chen DS. Least microtransfusion from mother to fetus in elective cesarean delivery. Obstet Gynecol. 1996;87(2):244-8.        [ Links ]

20. Giglio MRP, Lamounier JA, Morais Neto OL, César CC. Baixo peso ao nascer em coorte de recém-nascidos em Goiânia-Brasil no ano de 2000. Rev Bras Ginecol Obstet. 2005;27(3):130-6.        [ Links ]

21. Guimarães ML, Bastos FI, Telles PR, Galvão-Castro B, Diaz RS, Bongertz V, et al. Retrovirus infections in a sample of injecting drug users in Rio de Janeiro City, Brazil: prevalence of HIV-1 subtypes, and co-infection with HTLV-I/II. J Clin Virol. 2001;21(2):143-51.        [ Links ]

22. Sanchez-Palacios C, Gotuzzo E, Vandamme A M, Maldonado Y. Seroprevalence and risk factors for human T-cell lymphotropic virus (HTLV-I) infection among ethnically and geographically diverse Peruvian women. Int J Infect Dis. 2003;7(2):132-7.        [ Links ]

23. Tsukasaki K, Koeffler P, Tomonaga M. Human T-lymphotropic vírus type I infection. Baillieres Best Pract Res Clin Haematol. 2000;13(2):231-43.        [ Links ]



Sebastião Rodrigues de Oliveira
Alameda D-5, Qd.16, Lt. 15, Jd. Mônaco
74936.560 – Aparecida de Goiânia – GO

Recebido em: 25/05/2006
Aceito com modificações em: 24/08/2006
Trabalho desenvolvido com o apoio financeiro da APAE (Associação de Pais e Amigos do Excepcional ) e Secretaria Municipal de Saúde de Goiânia.



Instituto de Patologia Tropical e Saúde Pública da Universidade Federal de Goiás – UFG – Goiânia (GO), Brasil.

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License