SciELO - Scientific Electronic Library Online

 
vol.28 número10Associação entre os polimorfismos HaeIII e MspI do gene para o receptor alfa de estrogênio e densidade mamográfica em mulheres após a menopausaGravidez e parto após embolização arterial para tratamento de leiomioma uterino índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Journal

Artigo

Indicadores

Links relacionados

Compartilhar


Revista Brasileira de Ginecologia e Obstetrícia

versão impressa ISSN 0100-7203versão On-line ISSN 1806-9339

Rev. Bras. Ginecol. Obstet. v.28 n.10 Rio de Janeiro out. 2006

http://dx.doi.org/10.1590/S0100-72032006001000004 

ARTIGOS ORIGINAIS

 

Expressão dos protooncogenes c-fos, c-myc e c-jun em miométrio normal e mioma humanos

 

Expression of the protooncogenes c-fos, c-myc and c-jun in human normal miometrium and leiomyoma

 

 

Ana Luiza FerrariI; Maria Flávia Marques RobeiroII; Mateus RecheIII; Ilma S. BrumIV; Maria Beatriz KohekV; Helena von Eye CorletaVI; Edison CappVI

IMestranda , Faculdade de Medicina, Universidade Federal do Rio Grande do Sul – UFRGS – Porto Alegre (RS), Brasil
IIMestranda do Programa de Pós-graduação em Ciências Biológicas, Departamento de Fisiologia, Instituto de Ciências Básicas da Saúde, Universidade Federal do Rio Grande do Sul – UFRGS – Porto alegre (RS), Brasil
IIIAcadêmico da Faculdade de Medicina, Universidade Federal do Rio Grande do Sul – UFRGS – Porto Alegre (RS), Brasil; Bolsista de Iniciação Científica da Fundação de Amparo à Pesquisa do Rio Grande do Sul – FAPERGS – Porto Alegre (RS), Brasil
IVProfessor do Programa de Pós-graduação em Ciências Biológicas, Departamento de Fisiologia, Instituto de Ciências Básicas da Saúde, Universidade Federal do Rio Grande do Sul – UFRGS – Porto Alegre (RS), Brasil
VProfessora da Disciplina de Fisiologia, Fundação Faculdade Federal de Ciências Médicas – FFFCMPA – Porto Alegre (RS), Brasil
VIProfessor do Departamento de Ginecologia e Obstetrícia, Faculdade de Medicina, Universidade Federal do Rio Grande do Sul – UFRgS – Porto Alegre (RS), Brasil; Bolsista de produtividade em pesquisa do Conselho Nacional de Desenvolvimento Científico e Tecnológico – CNPq – Brasília (DF), Brasil

Correspondência

 

 


RESUMO

OBJETIVO: Comparar a expressão gênica (mRNA) e protéica dos protooncogenes c-fos, c-myc e c-jun em miométrio normal e mioma humanos.
MÉTODOS: Foi realizado um estudo do tipo caso-controle. O material foi coletado de 12 pacientes submetidas a histerectomia no Hospital de Clínicas de Porto Alegre. A expressão do mRNA específico para c-myc, c-fos, c-jun e b-microglobulina foi avaliada pela técnica de RT-PCR, utilizando primers específicos para cada gene. A expressão protéica destes protooncogenes foi avaliada através de Western blot com anticorpos específicos.
RESULTADOS: Não houve diferença significativa para expressão gênica desses protooncogenes entre miométrio normal e mioma (c-myc: 0,87 ± 0,08 vs 0,87 ± 0,08, p = 0,952; c-fos: 1,10 ± 0,17 vs 1,01 ± 0,11, p = 0,21; c-jun: 1,03 ± 0,12 vs 0,96 ± 0,09, p = 0,168, respectivamente). Não houve diferença significativa para expressão protéica desses protooncogenes entre miométrio normal e mioma (c-myc: 1,36 ± 0,48 vs 1,53 ± 0,29, p = 0,569; c-fos: 8,85 ± 5,5 vs 6,56 ± 4,22, p = 0,434; e c-jun: 6,47 ± 3,04 vs 5,42 ± 2,03, p = 0,266, respectivamente).
CONCLUSÃO: A expressão gênica (transcrição) e a expressão protéica (tradução) dos protooncogenes c-myc, c-fos e c-jun em mioma e miométrio normal são semelhantes.

Palavras-chave: Miométrio; Leiomioma; Mioma; Proto-oncogenes; Expressão gênica


ABSTRACT

Uterine myomas are common benign tumors of the female genital tract. The expression of growth factor signal transduction cascade components including the protooncogenes c-myc, c-fos, and c-jun seem to be involved in the development of myomas.
PURPOSE: To compare the gene (mRNA) and protein expression of the protooncogenes c-fos, c-myc, and c-jun in human normal myometrium and leiomyoma.
METHOD: A case-control study was performed. Samples were collected from 12 patients submitted to hysterectomy at the Hospital de Clínicas at Porto Alegre. The expression of the specific mRNA for c-myc, c-fos, c-jun, and b-microglobulin was assessed through the RT-PCR technique, using specific primers to each gene. The protein expression of these protooncogenes was evaluated through the Western blot technique with specific antibodies.
RESULTS: No statistically significant difference was observed in the gene expression for these protooncogenes between normal myometrium and leiomyoma (c-myc: 0,87 ± 0,08 vs 0,87 ± 0,08, p = 0,952; c-fos: 1,10 ± 0,17 vs 1,01 ± 0,11, p = 0,21; c-jun: 1,03 ± 0,12 vs 0,96 ± 0,09, p = 0,168, respectively). No statiscally significant difference was observed for the protein expression of these protooncogenes between normal myometrium and leiomyoma (c-myc: 1,36 ± 0,48 vs 1,53 ± 0,29, p = 0,569; c-fos: 8,85 ± 5,5 vs 6,56 ± 4,22, p = 0,434; e c-jun: 6,47 ± 3,04 vs 5,42 ± 2,03, p = 0,266, respectively).
CONCLUSION: No difference was observed in the gene expression (transcription) nor in the protein expression (translation) of the protooncogenes c-myc, c-fos, and c-jun between leiomyoma and myometrium.

Keywords: Myometrium; Leiomyoma; Myoma; Growth factors; Proto-oncogenes; Genic expression


 

 

Introdução

Miomas ou leiomiomas são os tumores mais comuns do trato genital feminino e acometem de 20 a 40% das mulheres em idade reprodutiva1. Geralmente são benignos, mas podem causar distúrbio hemorrágico, dor pélvica e, não raro, abortamento recorrente e infertilidade2,3. O fato de miomas aparecerem durante o tempo de vida reprodutiva, aumentarem durante a gestação e regredirem após a menopausa sugere que eles dependem dos hormônios ovarianos.4,5.

Há evidências crescentes de que insulina, fatores de crescimento (IGF-1, EGF, VEGF), seus receptores e cascatas de transdução do sinal estejam envolvidos na transformação tumoral de tecidos dependentes de hormônios peptídicos (mama e trato gastrintestinal) e de tecidos não dependentes de hormônio (cérebro, medula, rins)6-8. A cascata de transdução de sinal destes hormônios peptídicos envolve quinases (que fosforilam resíduos de tirosina, serina e treonina), fosfatases e protooncogenes9.

Protooncogenes são genes celulares normais, conhecidos como genes regulatórios precoces, cuja ativação ocorre dentro de alguns minutos até uma hora após o estímulo. Os protooncogenes têm papel importante na coordenação de eventos que levam a proliferação e diferenciação em células normais. Em resposta a fatores de crescimento e hormônios esteróides, a expressão de protooncogenes (como fos, myc e jun) é alterada rapidamente e de maneira coordenada10.

O objetivo deste trabalho foi identificar e comparar a expressão dos protooncogenes c-fos, c-myc e c-jun em miométrio normal e miomas humanos.

 

Métodos

Foi realizado um estudo do tipo caso-controle, no qual foram incluídas 12 mulheres em idade reprodutiva, as quais foram a histerectomia por indicação não relacionada com o protocolo desta pesquisa no Serviço de Ginecologia do Hospital de Clínicas de Porto Alegre. Foram excluídas as pacientes que utilizavam medicação hormonal ou que tinham diabete melito. Leiomiomas com diâmetro < 1 cm ou > 5 cm não foram utilizados para evitar a contaminação por miométrio normal e minimizar a probabilidade de necrose e degeneração tecidual, respectivamente. As pacientes foram informadas e autorizaram a utilização de parte do material para estudo da expressão dos protooncogenes c-fos, c-myc e c-jun.

O material obtido foi imediatamente congelado em nitrogênio líquido e armazenado a -80 ºC até ser preparado por técnicas efetivas no estudo da atividade da expressão dos protooncogenes c-fos, c-myc e c-jun.

Este estudo foi submetido e aprovado pelo Comitê de Ética em Pesquisa do Grupo de Pesquisa e Pós-Graduação do Hospital de Clínicas de Porto Alegre (03-208).

Extração do RNA e Síntese do cDNA

Para extração de RNA e a síntese de cDNA, a amostras de miométrio e mioma foram homogeneizadas em fenol-isotiocianato de guanidina (Trizol, Gibco BRL, Gaithersburg, MD, USA). O RNA total foi extraído com clorofórmio e precipitado com isopropanol por centrifugação a 12.000 g a 4º C. O pellet do RNA foi lavado duas vezes com etanol e ressuspendido em água tratada com dietilpirocarbonato e quantificado por espectrofotometria a 260 nm. O primeiro molde de cDNA foi sintetizado a partir de 2 µg do total de RNA, usando o Sistema de Pré-amplificação SuperScript (Gibco BRL, Gaithersburg).

Transcrição Reversa e Reação de Polimerase em Cadeia (RT-PCR)

RT-PCR foi realizada em um volume final de 50 µl. Dois µl da primeira reação de síntese da fita (com ca. 4 ng de cDNA) foram desnaturados (94º C, 1 min) em presença de Tris-HCl (20 mM), pH 8,4, KCl (50 mM) e MgCl2 (1,5 mM). Depois do aquecimento inicial, adicionou-se Taq DNA polimerase (1,25 U) à mesma solução tampão Tris-HCl, MgCl2 (1,5 mM), primers (0,4 µM) sense e antisense e dNTP mix (0,2 mM). Foram usadas seqüências de primers específicos para c-myc (sense 5’CAAGAGGCGAACACACAACGTCT3’, antisense 5’AACTGTTCTCGTCGTTTCCGCAA3’, 218 pb), c-fos (sense 5’AGCTCTGCTTCACAGCGC3’, antisense 5’GGCCTCCTGTCATGGTCTT3’, 442 pb), c-jun (sense 5’GGAAACGACCTTCTATGACGATGCCCTCAA3’, antisense 5’GAACCCCTCCTGCTCATCTGTCACGTTCTT3’, 315 pb) e b2m (sense 5’ATCCAGCGTACTCCAAAGATTCAG3’, antisense 5’AAATTGAAAGTTAACTTATGCACGC3’, 623 bp)11,12. O número de ciclos foi ajustado para cada primer de acordo com estudos prévios11,12. Todos os reagentes foram adquiridos da Gibco BRL (SuperScript Preamplification System for First Strand cDNA Synthesis). Uma amostra do PCR (15 µl) foi separada por eletroforese em gel com 1,5% de agarose, corado com brometo de etídio e visualizado sob luz ultravioleta. As bandas foram quantificadas por densitometria, utilizando um sistema para processamento de imagem (ImageMaster VDS, Pharmacia Biotech, Uppsala, Sweden).

Western blots

Aproximadamente 0,5 g de tecido foi homogeneizado individualmente em um ultra-turrax por 30 s em velocidade 3, a 4° C, em presença de uma solução tampão (500 µl) contendo Hepes (50 mM), pH 7,5, fluoreto de fenilmetilsulfonila (PMSF, 1 mM), fluoreto de sódio (NaF, 100 mM), pirofosfato decahidrato de sódio (Na4P2O7; 10 mM) e vanadato de sódio (NaVO4, 2 mM), Triton X-100 (0,1%). O material foi solubilizado por 16 h e depois foi centrifugado (30 min, 4° C, 12.000 g). Foi realizada dosagem de proteínas no sobrenadante através do método de Bradford13. Proteína total (50 µg) de cada amostra foi desnaturada em solução de Laemmli (glicerol (30%), SDS (10%); Tris (62,5 mM), ditiotreitol (750 mg) e azul de bromofenol (0,001%)) a 95° C por 10 min. As proteínas foram separadas em SDS-PAGE (12%).

Após a eletroforese, as proteínas foram transferidas para uma membrana de nitrocelulose. As membranas de nitrocelulose foram incubadas durante uma hora em solução bloqueadora contendo: NaCl (150 mM), EDTA (5 mM), Tris (50 mM), Triton X-100 (0,05%), pH 7,4 (NET), leite em pó desnatado (5%). Após bloqueio dos sítios inespecíficos, as membranas foram incubadas por 16 h, sob agitação constante a 4° C, com os anticorpos específicos anti-fos, anti-myc e anti-jun (Upstate Biotechnology) suspensos em NET. As membranas foram então lavadas com NET e leite desnatado (2%, 5 vezes, 10 min). Em seguida, as membranas foram incubadas com o 2° anticorpo (c-fos com goat antimouse IgG conjugate; c-myc e c-jun com goat antirabbit IgG conjugate, Bio-Rad Laboratories) por 1 h e lavadas novamente com NET e leite (5 vezes, 10 min). Após a incubação com solução para quimioluminescência, as membranas foram colocadas em contato com o filme fotográfico (Kodak X-Omat) por ca. 1 min. Depois da revelação seguiram-se a visualização e a análise dos resultados. Como normalizador para a quantificação utilizou-se a coloração de Ponceau. A densidade óptica das bandas obtidas foi medida através de um sistema para processamento de imagem (Image-Master VDS Pharmacia Biotech).

Análise estatística

Os resultados são apresentados em termos de média ± desvio padrão. As expressões dos níveis de mRNA e de proteínas c-myc, c-fos e c-jun foram comparadas usando o teste t de Student. Valores de p < 0,05 foram considerados significantes.

 

Resultados

As Figuras 1A, 1B e 1C apresentam a expressão gênica dos protooncogenes c-myc, c-fos e c-jun, respectivamente. Não houve diferença significativa quanto à expressão gênica destes protooncogenes entre miométrio normal e mioma. Na densitometria as bandas observadas em miométrio normal e mioma foram 0,80 ± 0,08 e 0,80 ± 0,08 para c-myc (p = 0,95); 1,1 ± 0,17 e 1,0 ± 0,11 para c-fos (p = 0,2); e 1,0 ± 0,12 e 0,9 ± 0,09 para c-jun (p = 0,16), respectivamente.

 

 

As Figuras 2A, 2B e 2C apresentam a expressão protéica (por Western blot) dos protooncogenes c-myc, c-fos e c-jun, respectivamente. Não houve diferença significativa na expressão protéica destes protooncogenes entre miométrio normal e mioma. Na densitometria as bandas observadas em miométrio normal e mioma foram 1,3 ± 0,48 e 1,5 ± 0,29 para c-myc (p = 0,56); 8,8 ± 5,5 e 6,5 ± 4,2 para c-fos (p = 0,43); e 3,82 ± 3,21 e 4,27 ± 4,10 para c-jun (p = 0,77), respectivamente.

 

 

Discussão

Os protooncogenes c-fos, c-myc e c-jun têm função importante na transdução do sinal de fatores de crescimento, bem como de hormônios esteróides, e eles representam uma interação/convergência destas duas vias de sinalização. Neste estudo, os níveis de mRNA e a expressão protéica dos protooncogenes c-fos, c-myc e c-jun em miométrio normal e mioma humanos foram comparados, tendo se mostrado semelhantes.

A modulação no crescimento de miomas parece ocorrer através da interação entre hormônios esteróides sexuais e fatores de crescimento14. A expressão e atividade dos receptores de IGF-1 e insulina em miométrio e mioma humanos foi recentemente estudada9,15, 16.

O estrogênio é considerado responsável pela proliferação destas células. Exerce seus efeitos fisiológicos nas células-alvo, através de ligação com receptores nucleares específicos17. A participação da progesterona também parece ser importante na formação deste tumor benigno através da estimulação de atividade mitótica e proliferação celular18. Recentemente foi observado que fármacos antagonistas da ação de progestágenos em seus receptores (mifepristona) diminuem o volume dos miomas19.

Níveis elevados de c-myc foram descritos em tumores de mama, cólon e pulmão, e estão associados a um mau prognóstico20. Contudo, assim como foi observado em nossos resultados, a expressão de mRNA para c-myc em fibroadenomas de mama, e tumores benignos (como os miomas) é semelhante à expressão em tecido mamário normal21.

O gene c-fos não é necessário para promoção de tumor, mas parece ter um papel essencial na progressão de tumor benigno para maligno. É possível que os níveis de c-fos, semelhantes em mioma e miométrio (como encontrado em nosso estudo) ou diminuídos nos miomas (em relação ao miométrio), possam explicar a baixa freqüência de malignização neste tipo de tecido22. A transformação maligna de miomas é um evento raro e a baixa expressão de c-fos faz parte deste fenótipo benigno, que impediria a progressão para tumor maligno23.

Não encontramos diferença na expressão de c-jun comparando mioma e miométrio. O miométrio normal pode apresentar uma elevação transitória em c-jun no início do trabalho de parto24. c-jun e c-fos são os produtos que interagem formando o complexo AP-1 no núcleo e iniciam a cascata de eventos que leva ao crescimento e proliferação celular. Em outros tumores (adenomas de glândula salivar e adenocarcinoma de cólon) a expressão protéica destes protooncogenes também não está alterada25.

A expressão gênica (transcrição) e a expressão protéica (tradução) dos protooncogenes c-myc, c-fos e c-jun não foram diferentes em mioma e miométrio normal. É possível que outros protooncogenes estejam envolvidos no surgimento e crescimento destes tumores (Ha-ras, erb-A e src). Outros estudos para identificar potenciais mediadores da proliferação e regulação do crescimento celular, bem como para esclarecer a interação entre hormônios esteróides, peptídicos e protooncogenes, deverão ser realizados.

 

Referências

1. Stewart EA. Uterine fibroids. Lancet. 2001;357 (9252):293-8.        [ Links ]

2. Giudice LC, Irwin JC, Dsupin BA, Pannier EM, Jin IH, Vu TH, et al. Insulin-like growth factor (IGF), IGF binding protein (IGFBP), and IGF receptor gene expression and IGFBP synthesis in human uterine leiomyomata. Hum Reprod. 1993;8(11):1796-806.        [ Links ]

3. Lee BS, Margolin SB, Nowak RA. Pirfenidone: a novel pharmacological agent that inhibits leiomyoma cell proliferation and collagen production. J Clin Endocrinol Metab. 1998;83(1):219-23.        [ Links ]

4. De Leo V, la Marca A, Morgante G, Severi FM, Petraglia F. Administration of somatostatin analogue reduces uterine and myoma volume in women with uterine leiomyomata. Fertil Steril. 2001;75(3):632-3.        [ Links ]

5. Schwartz SM. Epidemiology of uterine leiomyomata. Clin Obstet Gynecol. 2001;44(2):316-26.        [ Links ]

6. Corleta HE, Capp E, Corleta OC. Insulin receptor tyrosine kinase activity in colon carcinoma. Braz J Med Biol Res. 1996;29(12):1593-7.        [ Links ]

7. Kellerer M, von Eye Corleta H, Muhlhofer A, Capp E, Mosthaf L, Bock S, et al. Insulin- and insulin-like growth-factor-I receptor tyrosine-kinase activities in human renal carcinoma. Int J Cancer. 1995;62(5):501-7.        [ Links ]

8. Wei JJ, Zhang XM, Chiriboga L, Yee H, Perle MA, Mittal K. Spatial differences in biologic activity of large uterine leiomyomata. Fertil Steril. 2006;85(1):179-87.        [ Links ]

9. Orcy RB, Brum I, da Silva RS, Kucharski LC, Corleta HE, Capp E. Insulin receptor tyrosine kinase activity and substrate 1 (IRS-1) expression in human myometrium and leiomyoma. Eur J Obstet Gynecol Reprod Biol. 2005;123(1):107-10.        [ Links ]

10. Schuchard M, Landers JP, Sandhu NP, Spelsberg TC. Steroid hormone regulation of nuclear proto-oncogenes. Endocr Rev. 1993;14(6):659-69.        [ Links ]

11. Silva IS, Morsch DM, Urnauer L, Spritzer PM. Androgen-induced cell growth and c-myc expression in human non-transformed epithelial prostatic cells in primary culture. Endocr Res. 2001;27(1-2):153-69.        [ Links ]

12. Rossi D, Del Giacco L, Doneda L, Nicolini U, Acaia B, Brioschi D, et al. Expression pattern of c-sis, c-fos and c-jun in human placenta and embryofetal organs. Gynecol Obstet Invest. 1996;42(1):1-7.        [ Links ]

13. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248-54.        [ Links ]

14. Maruo T, Ohara N, Wang J, Matsuo H. Sex steroidal regulation of uterine leiomyoma growth and apoptosis. Hum Reprod Update. 2004;10(3):207-20.        [ Links ]

15. Martin Chaves EB, Brum IS, Stoll J, Capp E, Corleta HE. Insulin-like growth factor 1 receptor mRNA expression and autophosphorylation in human myometrium and leiomyoma. Gynecol Obstet Invest. 2004;57(4):210-3.        [ Links ]

16. Toscani GK, Chaves EM, Cervi FL, Tavares MB, Silva IS, von Eye Corleta H, et al. Gene expression and tyrosine kinase activity of insulin receptor in uterine leiomyoma and matched myometrium. Arch Gynecol Obstet. 2004;270(3):170-3.        [ Links ]

17. Andersen J, Barbieri RL. Abnormal gene expression in uterine leiomyomas. J Soc Gynecol Investig. 1995;2(5):663-72.        [ Links ]

18. Maruo T, Matsuo H, Samoto T, Shimomura Y, Kurachi O, Gao Z, et al. Effects of progesterone on uterine leiomyoma growth and apoptosis. Steroids. 2000;65(10-11):585-92.        [ Links ]

19. Eisinger SH, Bonfiglio T, Fiscella K, Meldrum S, Guzick DS. Twelve-month safety and efficacy of low-dose mifepristone for uterine myomas. J Minim Invasive Gynecol. 2005;12(3):227-33.        [ Links ]

20. Garte SJ. The c-myc oncogene in tumor progression. Crit Rev Oncog. 1993;4(4):435-49.        [ Links ]

21. Cericatto R, Pozzobon A, Morsch DM, Menke CH, Brum IS, Spritzer PM. Estrogen receptor-alpha, bcl-2 and c-myc gene expression in fibroadenomas and adjacent normal breast: association with nodule size, hormonal and reproductive features. Steroids. 2005;70(3):153-60.        [ Links ]

22. Swartz CD, Afshari CA, Yu L, Hall KE, Dixon D. Estrogen-induced changes in IGF-I, Myb family and MAP kinase pathway genes in human uterine leiomyoma and normal uterine smooth muscle cell lines. Mol Hum Reprod. 2005;11 (6):441-50.        [ Links ]

23. Lessl M, Klotzbuecher M, Schoen S, Reles A, Stockemann K, Fuhrmann U. Comparative messenger ribonucleic acid analysis of immediate early genes and sex steroid receptors in human leiomyoma and healthy myometrium. J Clin Endocrinol Metab. 1997;82(8):2596-600.        [ Links ]

24. Roh CR, Lee BL, Oh WJ, Whang JD, Choi DS, Yoon BK, et al. Induction of c-jun mRNA without changes of estrogen and progesterone receptor expression in myometrium during human labor. J Korean Med Sci. 1999;14(5):552-8.        [ Links ]

25. Birek C, Lui E, Dardick I. c-fos oncogene underexpression in salivary gland tumors as measured by in situ hybridization. Am J Pathol. 1993;142(3):917-23.        [ Links ]

 

 

Correspondência:
Edison Capp
Rua Dr. Barros Cassal, 411/22
90035-003 – Porto Alegre – RS
e-mail: edcapp@ufrgs.br

Recebido em: 15/09/2006
Aceito com modificações em: 24/10/2006
Apoio financeiro: Fundo de Incentivo à Pesquisa do Hospital de Clínica de Porto Alegre (RS), Brasil.

Creative Commons License Todo o conteúdo deste periódico, exceto onde está identificado, está licenciado sob uma Licença Creative Commons