SciELO - Scientific Electronic Library Online

 
vol.34 issue9Association between ovarian endometrioma and deep infiltrating endometriosisFactors associated with the use of the Papanicolaou smear screening among older women in the interior of Brazil author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Article

Indicators

Related links

  • Have no similar articlesSimilars in SciELO

Share


Revista Brasileira de Ginecologia e Obstetrícia

Print version ISSN 0100-7203

Rev. Bras. Ginecol. Obstet. vol.34 no.9 Rio de Janeiro Sept. 2012

http://dx.doi.org/10.1590/S0100-72032012000900007 

ARTIGO ORIGINAL

 

Prevalência de infecção por Chlamydia trachomatis em mulheres candidatas à fertilização in vitro em serviço público de referência do Estado de São Paulo

 

Prevalence of Chlamydia trachomatis infection among women candidates for in vitro fertilization at a public institution of the State of São Paulo, Brazil

 

 

Márcia PantojaI; Elisabete Aparecida CamposII; Denise da Rocha PittaII; José Erbolatto GabiattiI; Maria Valéria BahamondesI; Arlete Maria dos Santos FernandesI

IDepartamento de Tocoginecologia da Faculdade de Ciências Médicas da Universidade Estadual de Campinas - UNICAMP - Campinas (SP), Brasil
IILaboratório Clínico Especializado do Centro de Atenção Integral à Saúde da Mulher - CAISM - da Universidade Estadual de Campinas - UNICAMP - Campinas (SP), Brasil

Correspondência

 

 


RESUMO

OBJETIVO: Avaliar a prevalência de infecção por Chlamydia trachomatis (CT) e Neisseria gonorrhoeae (NG) em mulheres candidatas ao tratamento tópico e de fertilização in vitro (FIV) em serviço público de referência da Região Sudeste do Brasil.
MÉTODOS: Mulheres que tiveram indicação de FIV, no período de 1º de abril de 2008 a 31 de outubro de 2009, foram admitidas sequencialmente no estudo. Foi aplicado um questionário sobre antecedentes ginecológicos e obstétricos e coletada amostra de swab endocervical para pesquisa de CT e NG através de captura híbrida e PCR. As variáveis estudadas foram: faixa etária, cor, escolaridade, tempo de infertilidade, número de gestações e filhos vivos, antecedentes de aborto, gestação ectópica, número de parceiros, Doença Inflamatória Pélvica (DIP), cirurgia pélvica, manipulação de cavidade uterina, tabagismo e uso de drogas ilícitas. As mulheres foram distribuídas segundo presença ou não de infecção por clamídia e a análise foi descritiva.
RESULTADOS: Entre as 176 mulheres estudadas a prevalência de infecção por CT foi de 1,1%, não houve infecção por NG. Dois terços das mulheres tinham idade >30 anos, escolaridade >8 anos, <5 anos de infertilidade e 56,2% não tinham filhos. Os principais antecedentes foram cirurgia pélvica (77,8%), manipulação de cavidade uterina (62,5%) e DIP (27,8%). O fator tubário foi o mais prevalente, em 129 mulheres (73,3%), 37,5% com e 35,8% sem laqueadura, os demais fatores tiveram prevalência <30%.
CONCLUSÕES: As infecções por CT e NG tiveram baixa prevalência na amostra estudada e são necessários estudos em outros centros do país para confirmar a prevalência de infecções nesse grupo particular de mulheres inférteis.

Palavras-chave: Chlamydia trachomatis, Infertilidade, Fertilização in vitro, Prevalência, Reação em cadeia da polimerase


ABSTRACT

PURPOSE: To evaluate the prevalence of Chlamydia trachomatis (CT) and Neisseria gonorrhoeae (NG) among women candidates to in vitro fertilization (IVF) in a reference public service in southeastern Brazil.
METHODS: Women who were referred for IVF from April 1st, 2008 to December 31st, 2009 were enrolled sequentially in the study. A ginecological-obstetrical background questionnaire was applied and endocervical swab samples were obtained to search for CT and NG using hybrid capture and PCR. The variables studied were: age, color, education, duration of infertility, number of pregnancies and living children, history of miscarriage, ectopic pregnancy, number of sex partners, pelvic inflammatory disease (PID), pelvic surgery, manipulation of the uterine cavity, smoking, and illicit drug use. The women were distributed according to the presence/absence of confirmed chlamydia infection and descriptive analysis was employed.
RESULTS: Among 176 women tested the prevalence of CT infection was 1.1% and there was no NG infection. Two thirds of the women were >30 years old, with schooling >8 years and <5 years of infertility, and 56.2% had no children. The main background data were pelvic surgery (77.8%), manipulation of the uterine cavity (62.5%) and PID (27.8%). The tubal factor was the most prevalent, 73.3% of women (from 129), 37.5% had been sterilized, 35.8% had not been sterilized, and other factors had a prevalence <30%.
CONCLUSIONS: CT and NG infections had a low prevalence in this sample. Studies at other centers in the country are needed to confirm the prevalence of infection in this particular group of infertile women.

Keywords: Chlamydia trachomatis, Infertility, Fertilization in vitro, Prevalence, Polymerase chain reaction


 

 

Introdução

As doenças sexualmente transmissíveis (DSTs) têm grande impacto na saúde da população global, em especial nos países em desenvolvimento, onde a magnitude dessas infecções é difícil de ser determinada devido à ausência de dados a partir de notificações. Em recente avaliação utilizando pela primeira vez amostras representativas e estratificadas da população por idade, gênero e raça/etnia, realizada nos Estados Unidos, foi evidenciada tendência à diminuição da taxa nacional de prevalência de infecções por Chlamydia trachomatis (CT) entre os anos de 1999 e 2008. Entretanto, não houve diminuição nas infecções do grupo de mulheres com idade entre 14 e 25 anos e houve disparidade importante nas taxas de infecção das diferentes etnias1. No Brasil, segundo a Coordenação Nacional de DST/AIDS e estimativas da Organização Mundial de Saúde, ocorrem a cada ano 1.967.200 infecções por CT e 1.541.800 infecções por Neisseria gonorrhoeae (NG) na população sexualmente ativa2.

As taxas de prevalência das infecções por CT e NG variam amplamente segundo a população pesquisada, o sítio de onde a amostra é coletada e o teste utilizado para diagnóstico. Os testes diretos, como a pesquisa de antígenos e ácidos nucleicos, apresentam maior sensibilidade e especificidade3,4 para o diagnóstico, embora impliquem maior custo. Os indiretos, como a pesquisa de anticorpos séricos, são frequentemente utilizados para o rastreamento por se constituírem métodos fáceis para coleta e manuseio, mas têm restrições por não serem adequados para pesquisa de infecção ativa e pelos altos percentuais de reações cruzadas5.

As infecções por CT e NG no aparelho reprodutivo apresentam, em geral, sintomatologia frustra, tornando difícil o diagnóstico clínico precoce. Embora haja necessidade de estudos clínicos randomizados para determinar o risco do desenvolvimento de complicações, uma vez infectados, as mulheres tornam-se suscetíveis à sequela da obstrução tubária bilateral e os homens ao fator masculino de infertilidade6,7. Como a população jovem é a mais afetada, o rastreamento de casos assintomáticos tem sido recomendado em alguns países desde os anos de 19908,9, na maioria das vezes em populações específicas como em clínicas de DST, pré-natal e planejamento familiar. No Brasil, o rastreamento para CT e NG tem sido meta do Ministério da Saúde desde 1999 e tem sido realizado dentro da possibilidade dos serviços, em gestantes e adolescentes em atendimentos específicos como planejamento familiar, atendimento pré-natal e prevenção do câncer do colo do útero10.

Entre os estudos que utilizaram técnica direta para diagnóstico e amostras endocervicais, as medidas de prevalência em coortes de mulheres brasileiras mostraram variação 6 a 9,4% em ambientes clínicos diversos11-13. O único artigo nacional investigando população de inférteis e utilizando reação em cadeia da polimerase (PCR) em amostras endocervicais foi realizado em Manaus, Amazonas, e relatou prevalência de infecção por CT em 52,8% das 106 mulheres pesquisadas14.

Como não existem estudos sobre prevalência das infecções por CT/NG em mulheres candidatas à fertilização in vitro, (FIV), cuja característica é a história de tratamentos de infertilidade anteriores, o objetivo deste estudo foi avaliar a prevalência das infecções por CT e NG no grupo de mulheres candidatas ao procedimento, em serviço público de referência no Estado de São Paulo, Brasil.

 

Métodos

Foi um estudo de corte transversal conduzido na Unidade de Reprodução Humana, Faculdade de Ciências Médicas, Universidade Estadual de Campinas (UNICAMP). O protocolo foi aprovado pelo Comitê de Ética em Pesquisa e todas as mulheres assinaram o termo de consentimento informado. A pesquisa foi conduzida de acordo com a Declaração de Helsinque, revisada em 200815,16.

O tamanho da amostra foi baseado em prevalência de 11,4% (P) de infecções por CT17, com intervalo de confiança de 95% e um erro amostral de 5% (ε2). Para α=0,05 e distribuição normal (Z) foi utilizada a fórmula n=Z1-α/2 P(1-P)/ε2 e calculado em 155 mulheres. As mulheres foram selecionadas durante a consulta admissional ou de retorno e admitidas sequencialmente. O critério de inclusão foi a indicação de tratamento por FIV segundo os diagnósticos de fator tubário bilateral definido como obstrução bilateral confirmada através de laparoscopia e/ou antecedente de laqueadura tubária; fator masculino definido concentração como de 1-5 milhões de espermatozoides por mililitro após capacitação espermática; esterilidade sem causa aparente (ESCA) definida como infertilidade inexplicada após concluídos os testes propedêuticos de investigação do casal infértil com resultados normais e tendo realizado pelo menos três tentativas de tratamento com inseminação intrauterina homóloga (AIH) sem sucesso; e anovulatórias/más-respondedoras. Essas últimas foram consideradas aquelas mulheres que não produziram pelo menos um folículo pré-ovulatório após indução ovariana com HMG/FSH de protocolos simplificados. Foram excluídas mulheres com fator uterino ou com patologias que contraindicassem o tratamento de FIV.

Aquelas que concordaram em participar, responderam a questionário pré-testado com dados sociodemográficos, antecendentes ginecológicos e obstétricos e o diagnóstico da infertilidade que determinou a indicação de FIV, preenchido pelo médico que realizava a consulta. O exame ginecológico foi realizado fora do período menstrual para coleta através de swab de material endocervical utilizando a escova cervical DigeneTM imersa em meio coletor universal (UCM).

As variáveis estudadas foram faixa etária (<24, 25-29, 30-34 e >35 anos), cor referida pela mulher (branca e não branca), escolaridade (<8 e >8 anos), tempo de infertilidade (<5, 6-10 e >10 anos), número de gestações (0, 1-3 e >4 gestações), número de filhos vivos (0, 1-3 e >4 filhos vivos), antecedente de abortos (sim/não), gestação ectópica (sim/não), número de parceiros na vida (1-2, 3-10 e >10 parceiros), DIP (sim/não), manipulação de cavidade uterina anterior (sim/não), cirurgia pélvica (sim/não), hábitos de tabagismo (sim/não) e drogas ilícitas (sim/não). Para análise estatística foi utilizado o programa Statistical Package of Social Sciences (SPSS), 2006. O banco de dados foi submetido à análise de consistência; as mulheres foram distribuídas segundo a ter ou não infecção por CT e calculou-se a frequência de cada variável. A análise foi descritiva.

Captura híbrida e análise de PCR

A análise de CT e NG por captura híbrida foi realizada de acordo com as instruções do fabricante (Qiagen Gaithersburg Inc - USA). Resultados iguais ou superiores a 1pg/ml foram considerados positivos. Quando o teste de hibridização foi positivo a identificação do patógeno foi realizada.

Para extração de DNA uma alíquota de 200 µL foi removida e centrifugada a 13.000x g por 10 minutos. O sobrenadante foi removido e o pellet celular foi armazenado a -20ºC. Para extração do DNA, as células foram suspensas novamente em 200µL da solução de digestão (1 mM Tris, 200 µg/mL de Proteinase K, 0,5% SDS) por agitação, incubadas a 55ºC por 2 horas e a 95ºC por 5 minutos. Após a adição de 200 µL de solução de fenol:clorofórmio:álcool isoamílico (25:24:1), o tubo foi agitado vigorosamente e centrifugado a 5.000x g por 10 minutos. A fase aquosa foi removida e transferida para outro tubo ao qual foi acrescentado NaAC (acetato de sódio) 3M com pH 5,2 na proporção 1/10. Foi adicionado etanol 70% no volume de 2,5 vezes do conteúdo do tubo. Após agitação, a solução foi centrifugada a 15.000x g por 15 minutos. O sobrenadante foi removido e o pellet de DNA, após evaporação total do etanol, foi ressuspendido em 100 µL da solução de TE (1 mM Tris, 100 µM Edta, pH 8,2). O DNA foi estocado a -20ºC até a utilização. Para controle da extração do DNA, foi amplificado um fragmento de 268pb do gene da ß-globina humana.

A detecção de CT foi realizada com o conjunto de primers HL1(5'TAGAGATAGGAAACCAACTC3') e HL2 (5'CTCGGGTTAATGTTGCATGA3') que amplifica uma sequencia do plasmídio críptico gerando um fragmento de cerca de 512 pb. A reação de PCR consistiu em 20 µL da mistura de reagentes contendo 1,5 U de Taq Platinum, 200 mM desoxinucleotídeo trifosfato (dNTPs), 10% tampão PCR, 2,5 mM MgCl2, 10 pmol de cada primer e 2 uL de DNA. Na fase inicial para desnaturação a temperatura foi de 94ºC por 5 minutos. Foram realizados 40 ciclos de amplificação. Cada ciclo foi composto de 1 minuto a 94ºC para desnaturação, 1 minuto a 45ºC para ligação dos primers ao molde genômico e 1 minuto a 72ºC para extensão do amplificado. Na fase final, manteve-se a temperatura em 72ºC por 7 minutos para polimerização dos fragmentos incompletos. Os produtos amplificados foram submetidos à eletroforese em gel de agarose a 3% corado com brometo de etídio (1 µg/mL) para análise. Como controle positivo da reação foi utilizado amostra previamente conhecida como positiva para CT18.

Foram coletadas amostras no período de 1 de abril de 2008 a 31 de outubro de 2009 e todas foram submetidas a ambos os testes.

 

Resultados

Das 176 amostras coletadas, duas foram PCR positivas para CT, com prevalência de 1,1% (Tabela 1). Somente uma delas apresentou resultado positivo na hibridização para CT e nenhuma infecção por NG foi diagnosticada.

 

 

A média de idade das mulheres foi de 30,9 anos (dado não mostrado). Do total de mulheres, mais da metade tinha idade maior de 30 anos, cor branca, escolaridade maior que 8 anos e eram multigestas. Cerca de 70% tinham até 5 anos de tempo de infertilidade, 43,7% eram nulíparas e 56% não tinham filhos vivos. Em relação aos antecedentes, 11,9% tinham antecedente de abortos espontâneos, 11,4% de gestação ectópica, 54,5% referiram três ou mais parceiros durante a vida, 27,8% referiram DIP, 62,5% manipulação de cavidade uterina e 77,8% cirurgia pélvica anterior. Tinham hábito ou antecedente de tabagismo 34% das mulheres e de drogas ilícitas 4% (Tabela 1).

As mulheres com infecção por CT estavam nos extremos das faixas etárias, uma tinha menos de 24 anos e outra mais de 35 anos, eram não brancas, tinham escolaridade menor de 8 anos, tempo de infertilidade até 5 anos, eram multíparas e sem antecedente de abortos. Uma delas tinha antecedente de gestação ectópica e DIP, ambas haviam referido mais que três parceiros durante a vida. Nenhuma tinha antecedente de manipulação de cavidade uterina, hábito de fumo ou drogas. As duas mulheres tinham antecedente de cirurgia pélvica (Tabela 1). Ao exame clínico nenhuma delas apresentava ectopia cervical ou cervicite, enquanto entre as mulheres sem infecção por CT, 9% apresentavam ectopia e somente 3,4% tinham sinais clínicos de cervicite (dados não mostrados).

O fator tubário foi o mais frequente (73,3%), sendo metade dos casos devido à laqueadura tubária. A prevalência dos demais fatores foi de 26,7% (Tabela 2). Ambas as mulheres com infecção por CT apresentavam fator tubário, uma delas tinha laqueadura tubária.

 

 

Discussão

A prevalência de infecções por CT entre mulheres inférteis com indicação de FIV foi baixa, (1,1%). Esta prevalência foi menor que as taxas descritas em outros grupos de mulheres em três estudos nacionais que utilizaram técnica direta em amostras endocervicais11-13. No primeiro estudo foram incluídas 3.303 gestantes com média de idade de 23,8 anos em seis cidades brasileiras e este mostrou prevalências de infecções por CT e NG de 9,4 e 1,5%, respectivamente11. Outro estudo realizado com 781 mulheres de 18 a 40 anos em Unidades Básicas de Saúde da região metropolitana de São Paulo descreveu 8,4% de infecções por CT e 1,9% de NG, e como fator de risco a idade inferior a 20 anos12. Em clínica privada de Ginecologia da cidade de Fortaleza, entre 214 mulheres pesquisadas, foi diagnosticada infecção por CT em 6%, sendo mais da metade das infecções concentradas no grupo de mulheres com idade entre 26-30 anos13. As mulheres dessa amostra apresentaram média de idade superior aos demais grupos estudados (30,9 anos), o que é esperado em especial nos serviços públicos de referência para o tratamento de FIV. Considerando que a idade da mulher relaciona-se inversamente às taxas de prevalência de infecções por CT1, é possível que o fator idade tenha interferido na medida de prevalência, já que as mulheres candidatas a FIV chegam ao serviço público de referência com idade maior de 30 anos.

Além disso, devido à particularidade de este grupo de mulheres já ter sido submetido à propedêutica dos inúmeros fatores da infertilidade, é provável que elas tenham sido medicadas anteriormente, inclusive para infecções suspeitas e/ou diagnosticadas. Uma vez suspeita, a infecção por CT deve ser tratada e é frequente que a mulher não tenha apreendido o motivo para tal tratamento e por isso possa não referi-lo na história clínica.

Avaliando mulheres inférteis, não necessariamente candidatas a FIV, estudos internacionais que utilizaram técnica semelhante (testes diretos e material de swab endocervical) mostraram ampla variação na prevalência de infecção por CT segundo o país pesquisado. Estudos europeus relataram variação de 1% na Áustria5, 2,7% na França19 e 8,4% na Polônia20, enquanto houve variação em torno de 3% na Turquia21 e na Jordânia22 até 21% na Palestina23 e 22,7% na Índia24. A prevalência encontrada nesse estudo foi similar a estudo europeu com amostra de mulheres candidatas à FIV, 33% delas com fator tubário. Nesse estudo encontrou-se 2,7% de infecções através de PCR em swab endocervical19. Por outro lado, foi muito menor à descrita em estudo realizado em hospital universitário de Manaus com 106 mulheres inférteis que relatou prevalência 52,8% utilizando mesma técnica (PCR) e sítio de coleta endocervical14.

Algumas explicações poderiam justificar a ampla diferença encontrada nas prevalências dos dois serviços. No estudo de Manaus o critério de inclusão de mulheres foi possuir fator tubário que pudesse estar relacionado à infecção por CT, tendo excluído todos os demais fatores de infertilidade inclusive a laqueadura tubária, o que talvez tenha concentrado maior número de diagnósticos de infecção. As diferenças regionais, levando-se em conta o aspecto do acesso aos serviços de saúde, também podem ter contribuído com tamanha diferença na prevalência de infecções entre os dois centros. Além disso, o fator geográfico possivelmente interferiu nas variações das prevalências. Em estudo de base populacional, o primeiro para avaliar a prevalência e fatores de risco relacionados à infecção por CT no Brasil, com 2.071 parturientes com idade de 15-24 anos das cinco regiões do país, encontrou-se taxa de prevalência na Região Norte de 14,1%, enquanto a taxa nacional foi de 9,8%25. Apesar de a população ser constituída por gestantes jovens esse estudo mostrou que a prevalência foi maior na Região Norte em relação a todas as demais, o que pode sugerir que o número de infecções possa ser maior também em outros grupos populacionais dessa região.

Mulheres sem filhos buscaram com maior frequência tratamento de infertilidade e, apesar de uma parte delas referir gestação anterior, mais da metade não tinha filho vivo, característica comum descrita em serviços que dispensam tratamento a casais inférteis14. Com relação ao número de parceiros da amostra, a maioria das mulheres referiu até 10 parceiros durante a vida, sendo que 46% delas referiram até dois parceiros. Embora seja um dado passível de questionamento, com possibilidade de que o constrangimento possa minimizar a resposta, por outro lado, as mulheres inférteis têm muitas vezes sentimentos de responsabilidade com relação à infertilidade do casal e costumam entregar ao tratamento extrema dedicação. As duas infecções por CT foram diagnosticadas nos grupos de mulheres que referiram mais de dois parceiros sexuais durante a vida, o que concorda com a associação entre número de parceiros sexuais e infecção por CT em mulheres26.

Ao contrário do número de abortos, menor que o da população em geral em torno de 10%27, o número de mulheres com antecedentes de gestação ectópica e DIP foi alto e já esperado, ambas as patologias intrinsecamente associadas ao fator tubário28. As mulheres fumantes têm maior dificuldade para engravidar espontaneamente e durante os tratamentos de infertilidade29. Uma das orientações para mulheres inférteis é parar de fumar, o grande número de mulheres fumantes nessa amostra mostrou que há necessidade de reforçar a informação e dar medidas de suporte para a descontinuação do hábito.

A Agência Nacional de Vigilância Sanitária através da RDC/ANVISA nº 33/200630, que regulamentou o funcionamento de bancos de células e tecidos germinativos, normatizou a triagem clínica, sorológica para sífilis, hepatites B e C, HIV 1 e 2, HTLV 1 e 2 e microbiológica para CT, NG, Ureaplasma urealyticum e Mycoplasma hominis para pacientes e doadores. Através de publicação posterior, a RDC/ANVISA nº 23/201131, passou a orientar que para pacientes que realizem procedimentos com células e tecidos germinativos para uso próprio, a exigência seja triagem clínica e laboratorial, sendo obrigatória triagem microbiológica somente para as pessoas que, após utilizadas amostras para uso próprio, optem pela doação. A norma, entretanto, não padronizou os testes a serem utilizados para diagnóstico. Os serviços de reprodução assistida têm realizado, em geral, a investigação de casais inférteis candidatos a FIV através de testes sorológicos para CT, pela possibilidade de estes optarem pela doação no momento da assinatura do consentimento livre e esclarecido ou em algum momento posterior.

Não é conhecido se a presença da infecção poderia comprometer as taxas de sucesso da FIV, os dados em literatura têm sido escassos e controversos20,32. Entretanto é aconselhável que sejam utilizados testes diretos para diagnóstico de infecções por CT para que resultados confiáveis de infecção ativa sejam obtidos e possam ser comparados. Chamou atenção a maior escolaridade e o tempo de infertilidade menor de cinco anos, características de dois terços dessa amostra de mulheres, o que pode indicar que aquelas que chegam à referência ainda são as mulheres mais instruídas e com acesso à informação e cuidados em saúde reprodutiva. O acesso aos tratamentos de reprodução assistida de mulheres com características socioculturais de menor poder aquisitivo continua restrito, possivelmente até pela dificuldade em chegar aos serviços secundários para investigação da infertilidade.

Concluímos que a prevalência de infecções por CT foi baixa em candidatas à FIV neste Centro de Referência. São necessários dados de serviços em diferentes regiões do país para confirmar a baixa prevalência de infecções por CT/NG encontrada nessa população particular de mulheres.

 

Agradecimento

À instituição financiadora FAPESP, Processo n° 2007/05273-4.

 

Referências

1. Datta SD, Torrone E, Kruszon-Moran D, Berman S, Johnson R, Satterwhite CL, et al. Chlamydia trachomatis trends in the United States among persons 14 to 39 years of age, 1999-2008. Sex Transm Dis. 2012;39(2):92-6.         [ Links ]

2. Brasil. Ministério da Saúde. Coordenação Nacional de DST/AIDS. Departamento de DST, Aids e Hepatites Virais [Internet]. DST no Brasil. Brasília (DF): Ministério da Saúde; 2011 [citado 2011 Mar 18]. Disponível em: <http://www.aids.gov.br/pagina/dst-no-brasil>         [ Links ]

3. Cook RL, Hutchison SL, Østergaard L, Braithwaite RS, Ness RB. Systematic review: noninvasive testing for Chlamydia trachomatis and Neisseria gonorrhoeae. Ann Intern Med. 2005;142(11):914-25.         [ Links ]

4. Watson EJ, Templeton A, Russell I, Paavonen J, Mardh P, Stary A, et al. The accuracy and efficacy of screening tests for Chlamydia trachomatis: a systematic review. J Med Microbiol. 2002;51(12):1021-31.         [ Links ]

5. Dietrich W, Rath M, Stanek G, Apfalter P, Huber JC, Tempfer C. Multiple site sampling does not increase the sensitivity of Chlamydia trachomatis detection in infertility patients. Fertil Steril. 2010;93(1):68-71.         [ Links ]

6. Land JA, Van-Bergen JE, Morré SA, Postma MJ. Epidemiology of Chlamydia trachomatis infection in women and the cost-effectiveness of screening. Hum Reprod Update. 2010;16(2):189-204.         [ Links ]

7. Gottlieb SL, Berman SM, Low N. Screening and treatment to prevent sequelae in women with Chlamydia trachomatis genital infection: how much do we know? J Infect Dis. 2010;201(Suppl 2):S156-67.         [ Links ]

8. UK national guidelines on sexually transmitted infections and closely related conditions. Sex Transm Infect. 1999;75(Suppl 1):S2-3.         [ Links ]

9. Recommendations for the prevention and management of Chlamydia trachomatis infections, 1993. Centers for Disease Control and Prevention. MMWR Recomm Rep. 1993;42(RR-12):1-39.         [ Links ]

10. Brasil. Ministério da Saúde. Secretaria de Políticas de Saúde. Coordenação Nacional de DST e AIDS. Manual de controle das doenças sexualmente transmissíveis DST. 3a ed. Brasília (DF): Ministério da Saúde; 1999.         [ Links ]

11. Jalil EM, Pinto VM, Benzaken AS, Ribeiro D, Oliveira EC, Garcia EG, et al. Prevalence of Chlamydia and Neisseria gonorrhoeae infections in pregnant women in six Brazilian cities. Rev Bras Ginecol Obstet. 2008;30(12):614-9.         [ Links ]

12. Luppi CG, Oliveira RLS, Veras MA, Lippman SA, Jones H, Jesus CH, et al. Diagnóstico precoce e os fatores associados às infecções sexualmente transmissíveis em mulheres atendidas na atenção primária. Rev Bras Epidemiol. 2011;14(3):467-77.         [ Links ]

13. Eleutério RMN, Eleutério Junior J, Giraldo PC. Muniz AMV. Cervicite por Chlamydia trachomatis em mulheres sexualmente ativas atendidas em um serviço privado de ginecologia na cidade de Fortaleza. Rev Bras Anal Clin. 2007;39(4):287-90.         [ Links ]

14. Freitas NSL, Borborema-Santos CM, Neves DBS, Oliveira CMC, Ferreira JRD, Astolfi-Filho S. High prevalence detection of Chlamydia trachomatis by polymerase chain reaction in endocervical samples of infertile women attending university hospital in Manaus-Amazonas, Brazil. Gynecol Obstet Invest. 2011;72(4):220-6.         [ Links ]

15. World Medical Association Declaration of Helsinki: ethical principles for medical research involving human subjects [Internet]. 59th WMA General Assembly, Seoul, October 2008 [cited 2008 Nov 12]. Available from: <http://www.wma.net/en/30publications/10policies/b3/>         [ Links ]

16. Brasil. Ministério da Saúde. Conselho Nacional de Saúde [Internet]. Resolução n. 404 de 1º de agosto de 2008 [citado 2008 Set 25]. Disponível em: <http://conselho.saude.gov.br/resolucoes/2008/Reso_404.doc>         [ Links ]

17. Codes JS, Cohen DA, Melo NA, Teixeira GG, Leal AS, Silva TJ, et al. Detecção de doenças sexualmente transmissíveis em ambientes clínicos e não clínicos na cidade de Salvador, Bahia, Brasil. Cad Saúde Pública. 2006;22(2):325-34.         [ Links ]

18. Lima HE, Oliveira MB, Valente BG, Afonso DAF, Da Rocha WD, Souza MCM, et al. Genotyping of Chlamydia trachomatis from endocervical specimens in Brazil. Sex Transm Dis. 2007;34(9):709-17.         [ Links ]

19. de Barbeyrac B, Papaxanthos-Roche A, Mathieu C, Germain C, Brun JL, Gachet M, et al. Chlamydia trachomatis in subfertile couples undergoing an in vitro fertilization program: a prospective study. Eur J Obstet Gynecol Reprod Biol. 2006;129(1):46-53.         [ Links ]

20. Wilkowska-Trojniel M, Zdrodowska-Stefanow B, Ostaszewska-Puchalska I, Zbucka M, Wołczyński S, Grygoruk C, et al. Chlamydia trachomatis urogenital infection in women with infertility. Adv Med Sci. 2009;54(1):82-5.         [ Links ]

21. Guven MA, Dilek U, Pata O, Dilek S, Ciragil P. Prevalence of Chlamydia trachomatis, Ureaplasma urealyticum and Mycoplasma hominis infections in the unexplained infertile women. Arch Gynecol Obstet. 2007;276(3):219-23.         [ Links ]

22. Al-Ramahi M, Mahafzah A, Saleh S, Fram K. Prevalence of Chlamydia trachomatis infection in infertile women at a university hospital in Jordan. East Mediterr Health J. 2008;14(5):1148-54.         [ Links ]

23. El Qouqa IA, Shubair ME, Al Jarousha AM, Sharif FA. Prevalence of Chlamydia trachomatis among women attending gynecology and infertility clinics in Gaza, Palestine. Int J Infect Dis. 2009;13(3):334-41.         [ Links ]

24. Malik A, Jain S, Rizvi M, Shukla I, Hakim S. Chlamydia trachomatis infection in women with secondary infertility. Fertil Steril. 2009;91(1):91-5.         [ Links ]

25. Pinto VM, Szwarcwald CL, Baroni C, Stringari LL, Inocêncio LA, Miranda AE. Chlamydia trachomatis prevalence and risk behaviors in parturient women aged 15 to 24 in Brazil. Sex Transm Dis. 2011;38(10):957-61.         [ Links ]

26. Imai H, Nakao H, Shinohara H, Fujii Y, Tsukino H, Hamasuna R, et al. Population-based study of asymptomatic infection with Chlamydia trachomatis among female and male students. Int J STD AIDS. 2010;21(5):362-6.         [ Links ]

27. Nybo Andersen AM, Wohlfahrt J, Christens P, Olsen J, Melbye M. Maternal age and fetal loss: population based register linkage study. BMJ. 2000;320(7251):1708-12.         [ Links ]

28. Haggerty CL, Gottlieb SL, Taylor BD, Low N, Xu F, Ness RB. Risk of sequelae after Chlamydia trachomatis genital infection in women. J Infect Dis. 2010; 201(Suppl 2):S134-55.         [ Links ]

29. Practice Committee of the American Society for Reproductive Medicine. Smoking and infertility. Fertil Steril. 2008;90(5 Suppl):S254-9.         [ Links ]

30. Brasil. Ministério da Saúde. Agência Nacional de Vigilância Sanitária. Resolução da Diretoria Colegiada RDC 33 de 17 de fevereiro de 2006. Aprova o regulamento técnico para o funcionamento dos bancos de células e tecidos germinativos. Diário Oficial da União, Brasília (DF) (2006 Fev 20);Supl:1-4.         [ Links ]

31. Brasil. Ministério da Saúde. Agência Nacional de Vigilância Sanitária. Resolução da Diretoria Colegiada RDC nº 23 de 27 de maio de 2011. Dispõe sobre o regulamento técnico para o funcionamento dos bancos de células e tecidos germinativos e dá outras providências. Diário Oficial da União, Brasília (DF); 2011 Maio 30.         [ Links ]

32. Pacchiarotti A, Sbracia M, Mohamed MA, Frega A, Pacchiarotti A, Espinola SM, et al. Autoimmune response to Chlamydia trachomatis infection and in vitro fertilization outcome. Fertil Steril. 2009;91(3):946-8.         [ Links ]

 

 

Correspondência
Arlete Maria dos Santos Fernandes
Caixa Postal 6.181
CEP: 13084-971
Campinas (SP), Brasil

Conflito de interesses: não há.

Recebido 20/04/2012
Aceito com modificações 22/08/2012