SciELO - Scientific Electronic Library Online

 
vol.35 número5Volume de ressecção cirúrgica no tratamento conservador do câncer de mama em pacientes submetidas a tratamento neoadjuvanteTratamento conservador da gravidez ectópica em cicatriz de cesárea: relato de caso índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Journal

Artigo

  • Português (pdf)
  • Artigo em XML
  • Como citar este artigo
  • SciELO Analytics
  • Curriculum ScienTI
  • Tradução automática

Indicadores

Links relacionados

Compartilhar


Revista Brasileira de Ginecologia e Obstetrícia

versão impressa ISSN 0100-7203

Rev. Bras. Ginecol. Obstet. vol.35 no.5 Rio de Janeiro maio 2013

http://dx.doi.org/10.1590/S0100-72032013000500007 

ARTIGO ORIGINAL

 

Fatores de risco e prevalência da infecção pelo HPV em pacientes de Unidades Básicas de Saúde e de um Hospital Universitário do Sul do Brasil

 

Risk factors and prevalence of HPV infection in patients from Basic Health Units of an University Hospital in southern Brazil

 

 

Gisele Rodrigues de OliveiraI; Valdimara Corrêa VieiraII; Maria Fernanda Martínez BarralI; Vanessa DöwichIII; Marcelo Alves SoaresII, IV; Carla Vitola ConçalvesV; Ana Maria Barral de MartinezV

IPrograma de Pós-graduação em Ciências da Saúde, Universidade Federal do Rio Grande - FURG - Rio Grande (RS), Brasil
IIPrograma de Oncovirologia, Instituto Nacional de Câncer - INCA - Rio de Janeiro (RJ), Brasil
IIICurso de Medicina, Universidade Federal do Rio Grande - FURG - Rio Grande (RS), Brasil
IVUniversidade Federal do Rio de Janeiro - UFRJ - Rio de Janeiro (RJ), Brasil.
VFaculdade de Medicina e Programa de Pós-graduação em Ciências da Saúde, Universidade Federal do Rio Grande - FURG - Rio Grande (RS), Brasil

Endereço para correspondência

 

 


RESUMO

OBJETIVO: Determinar a prevalência e os genótipos do HPV e identificar os fatores associados à infecção em mulheres, gestantes e não gestantes HIV-1 positivas e negativas, atendidas nos Ambulatórios de Ginecologia e Obstetrícia e em Unidades Básicas de Saúde em Rio Grande, Rio Grande do Sul, Brasil.
MÉTODOS: Amostras de células cervicais de 302 mulheres foram analisadas para presença de HPV e genótipos por reação em cadeia da polimerase, aninhada e em sequenciamento. Foram calculadas as razões de prevalência associadas às variáveis estudadas por meio do teste exato de Fisher ou
χ2 e de regressão de Poisson. Foram excluídas as participantes sem material suficiente para realizar a extração de DNA.
RESULTADOS: Das 302 mulheres incluídas no estudo, o HPV foi detectado em 55 (18,2%); destas, 31 eram gestantes, apresentando uma associação significativa para a presença do HPV (p=0,04) quando comparadas às não gestantes. Os fatores de risco para infecção foram: pacientes com idades <20 anos (p=0,04), início precoce das relações sexuais (p=0,04), ausência do exame citopatológico (p=0,01), diagnóstico de citopatológico alterado (p=0,001) e contagem <349 células/mm3 (p=0,05). No entanto, a multiparidade constitui-se como fator de proteção para a infecção (p=0,01). Na análise multivariada, demonstrou-se que idade <20 anos (RP=2,8; IC95% 1,0 - 7,7, p=0,04) e diagnóstico de citopatológico alterado (RP=11,1; IC95% 3,0 - 4,1, p=0,001) persistiram associadas significativamente à infecção. O genótipo foi determinado em 47 amostras (85,4%), apresentando um por infecção: oito HPV 16 e 58; seis HPV 6; quatro HPV 18 e 33; três HPV 53 e 82; dois HPV 83 e 61; um HPV 31, 35, 45, 64, 68, 71 e 85.
CONCLUSÕES: A prevalência de detecção do HPV foi de 18,2%, os genótipos mais frequentes foram o 16 e 58, sendo que fatores sociodemográficos e ginecológicos apresentaram associação com a infecção viral.

Palavras-chave: Infecções por papillomavirus; Reação em cadeia da polimerase; Gestantes; Fatores de risco; Prevalência; Hospitais universitários; Centros de Saúde; Brasil


ABSTRACT

PURPOSE: To determine the HPV prevalence and genotypes and to identify factors associated with infection in pregnant and non-pregnant women with positive or negative HIV-1, treated in Gynecology and Obstetrics Ambulatories and in Health Primary Units, in Rio Grande, Rio Grande do Sul State, Brazil.
METHODS: Cervical cells samples from 302 patients were analyzed for HPV presence and genotypes were determined by nested and sequencing polymerase chain reaction. We calculated prevalence ratios associated with the studied variables by Fisher's exact or
χ2 tests, and Poisson's regression. Women with insufficient material were excluded from the study.
RESULTS: HPV was detected in 55 of the 302 women included in the study (18.2%); of these, 31 were pregnant, showing a significant association for HPV (p=0.04) when compared to non-pregnant ones. Risk factors for the infection were: patients aged <20 years-old (p=0.04), early initiation of sexual life (p=0.04), absence of cytological test (p=0.01), diagnosis of altered cytology (p=0.001), and counting <349 cells/mm3 (p=0.05). However, multi-parity was found to be a protective factor for the infection (p=0.01). Multivariate analysis showed that age <20 years-old (PR=2.8; 95%CI 1.0 - 7.7, p=0.04) and an altered cytological result (PR=11.1; 95%CI 3.0 - 4.1, p=0.001) were significantly associated with infection. HPV genotype was determined in 47 samples (85.4%) presenting one genotype per infection: eight HPV 16 and 58; six HPV 6; four HPV 18 and 33; three HPV 53 and 82; two HPV 83 and 61; one HPV 31, 35, 45, 64, 68, 71 and 85.
CONCLUSIONS: The prevalence of HPV detection was 18.2%, the most frequent genotypes were 16 and 58, and sociodemographic and gynecological factors were associated with viral infection.

Keywords: Papillomavirus infections; Polymerase chain reaction; Pregnant women; Risk factors; Prevalence; Hospitals, university; Health Centers; Brazil


 

 

Introdução

O papilomavírus humano (HPV) é a infecção sexualmente transmissível mais comum em todo o mundo1. Infecta o epitélio de seres humanos, podendo persistir de forma assintomática ou causar neoplasias2. No mundo estima-se que o número de mulheres infectadas pelo HPV chega a 291 milhões3. Nos EUA, um estudo estimou prevalência de 26,8% em mulheres com idades entre 14 e 59 anos4. No Brasil, a prevalência geral de infecção do colo do útero pelo HPV varia entre 13,7 e 54,3%5. Entre os mais de 140 genótipos identificados, mais de 40 infectam o trato genital dos seres humanos e estão divididos em HPV de alto e baixo risco, dependendo do seu potencial oncogênico. Os HPVs 16 e 18 são os genótipos de alto risco oncogênico, causando aproximadamente 70% dos cânceres cervicais invasivos6.

Entre os fatores de risco para a infecção pelo HPV, os mais relevantes são: ser mulher jovem sexualmente ativa, grupo este que apresenta as taxas mais altas de prevalência da infecção viral, entre 50 e 80% após dois a três anos do início da atividade sexual7; o número de parceiros sexuais durante a vida e a idade do parceiro masculino em relação à da mulher, quanto maior essa diferença, maior o risco8.

Nas gestantes, estudos demonstram haver maior frequência de infecção por HPV quando comparadas às não gestantes. Durante a gestação ocorre imunomodulação característica deste período, aumentando os casos de HPV9,10. Mulheres infectadas pelo HIV-1 são particularmente suscetíveis à infecção pelo HPV, com prevalências elevadas comparadas às gestantes HIV-1 negativas11.

A presença do HPV é condição necessária, porém não suficiente para desenvolver câncer cervical. Sabe-se que 99,7% das mulheres com câncer de colo de útero estiveram expostas ao vírus em algum momento de suas vidas12. Segundo o Instituto Nacional de Câncer (Inca)13, o câncer do colo do útero é o segundo tumor mais frequente na população feminina e a quarta causa de morte de mulheres por câncer no Brasil. Por ano, este tipo de câncer apresenta 18.430 novos casos e faz 4.800 óbitos. Para 2012 foram esperados 17.540 novos casos de câncer cervical. No Rio Grande do Sul, o risco estimado é de 14 casos a cada 100.000 mulheres. Pelas presentes circunstâncias expostas, o objetivo do presente estudo foi determinar a prevalência do HPV e os genótipos mais frequentes e identificar os fatores associados à infecção em mulheres, gestantes e não gestantes HIV-1 positivas e negativas, atendidas em Ambulatórios de Ginecologia e Obstetrícia do Hospital Universitário e em Unidades Básicas de Saúde (UBS) da região Sul do Brasil.

 

Métodos

Pacientes

Foi realizado um estudo de tipo transversal entre 2010 e 2011. Participaram do estudo 302 mulheres com mais de 14 anos que concordaram em assinar o termo de consentimento livre e esclarecido. Para participantes com menos de 18 anos, os responsáveis legais foram encarregados de assinarem o termo. Dois tipos diferentes de locais de recrutamento foram utilizados para o estudo: 149 pacientes foram atendidas nos Ambulatórios de Ginecologia e Obstetrícia e outras 153 foram recrutadas em 3 UBS. Destas, 96 eram gestantes HIV-1 negativas e 24 positivas, 162 não gestantes HIV-1 negativas e 20 positivas. Foram excluídas as mulheres cujas amostras não tinham material suficiente à extração de DNA. Todas aquelas incluídas no estudo responderam a um questionário autoaplicável padronizado a fim de conseguir informações sociodemográficas (cor da pele, idade, escolaridade, renda e estado civil) e ginecológicas (idade da primeira relação sexual, número de parceiros sexuais na vida, de gestações e de partos e realização do exame citopatológico) e dados laboratoriais, tais como resultados de exame citopatológico. Os dados sobre a carga viral no plasma e linfócitos T CD4 + em pacientes HIV-positivos foram obtidos pela análise de prontuário médico. O estudo foi aprovado pelo Comitê de Ética em Pesquisa na Área da Saúde (sob processo 2533/7-74 e pelo 013/2011).

Para que as análises sobre prevalência e fatores de risco associados tivessem poder estatístico, o número de pacientes necessários para o estudo foi calculado utilizando o programa Epi-Info, versão 6.04®. Com base nas referências encontradas na literatura que variam de 1314 a 23%15 de prevalência para encontrar uma prevalência de 18% (IC95%) e uma possível perda de 13%, seriam necessárias amostras cervicais de no mínimo 226 mulheres. As amostras de células cervicais das mulheres incluídas na pesquisa foram coletadas pela ginecologista durante a consulta ginecológica, com o auxílio de uma escova Vagispec®, para posteriores análises molecular e citológica. Para análise molecular, as amostras foram condicionadas em tubos criogênicos contendo 1 mL de tampão T.E. (10 mM Tris-HCl pH=8,5; 1 mM EDTA) e encaminhadas ao laboratório de biologia molecular até a etapa de extração do DNA viral. A análise citopatológica foi realizada como procedimento de rotina do laboratório de patologia, e os resultados obtidos foram posteriormente comparados àqueles com detecção molecular do vírus.

Detecção molecular do HPV e genotipagem

A extração do DNA das amostras coletadas foi feita a partir do kit comercial GFX (GE Healthcare) Genomic Blood DNA Purification Kit, segundo o protocolo de extração das células sanguíneas. Para detecção do HPV, realizou-se uma PCR aninhada. O primeiro round foi realizado com os primers externos: MY09/MY11: 5'CGTCCMAARGGAWACTGATC3'/ 5'GCMCAGGGWCATAAYAATGG3'16, o qual amplifica um fragmento de 450 pb da região L1 do capsídeo viral. O segundo round aconteceu com os primers internos: GP5/6: 5'TTTGTTACTCTGGTAGATAC3' e 5'GAAAAATAAACTGTAAATCA3'17, amplificando um fragmento de 150 pb também da região L1. As condições da reação para o primeiro round foram constituídas por 40 ciclos subsequentes de 94º C por 30 segundos para desnaturação, 45º C por 30 segundos para o anelamento e 72º C por 30 segundos para extensão. Para o segundo round, 40 ciclos subsequentes de 95, 55 e 72º C todos por um minuto, para desnaturação, anelamento e extensão, respectivamente. O amplicon foi visualizado em gel de agarose 1 e 2%, respectivamente, para o primeiro e o segundo round, após ter sido banhado em brometo de etídio (10 mg/mL) e observado sob luz ultravioleta.

A genotipagem do HPV foi realizada por sequenciamento do produto de PCR na Divisão de Genética do Inca Rio de Janeiro. Para esse processo, os produtos de PCR foram purificados com o kit Illustra GFX PCR DNA and Gel Band Purification (GE Health Care) e, em seguida, sequenciados com o kit ABI Prism®BigDye Terminator Cycle Sequencing Ready Reaction (AppliedBiosystems®, Foster City, USA) em um sequenciador automático ABI 3130XL (Life Technologies). Os genótipos foram determinados comparando-se a sequência consenso com outras referências depositadas em bancos de dados de DNA em busca pelo software BLAST (BLASTn). Para a edição e o alinhamento das amostras, foram utilizados os programas SeqMan e EditSeq do pacote DNAStar (LaserGene Inc., Madison, USA) e BioEditSequenceAlignment Editor©.

Análise estatística

Foram utilizados os programas do software Statistical Package for the Social Sciences (SPSS), prevendo a realização da análise bruta, do cálculo da razão de prevalência, dos intervalos de confiança e do valor de p, considerando que as diferenças foram estatisticamente significativas quando p<0,05 e utilizado o teste exato de Fisher ou do χ2. As variáveis analisadas foram: sociodemográficas, ginecológicas e laboratoriais. A análise multivariada foi realizada no Programa SPSS por meio da regressão de Poisson, sendo seguido um modelo hierarquizado de análise, no qual foram integradas as variáveis com p=0,20 na análise bruta. No primeiro nível ingressaram as variáveis sociodemográficas e no segundo, ginecológicas e laboratoriais.

 

Resultados

A prevalência do HPV foi de 18,2% (55 pacientes) do total de mulheres que participaram no estudo. Entre as 153 pacientes atendidas nas UBS, 28 (18,3%) foram positivas para o vírus e 27 (18,1%), dentre as 149 pacientes, nos Ambulatórios de Ginecologia e Obstetrícia. Não houve diferença significativa na prevalência do HPV entre os diferentes locais de recrutamento das pacientes.

A média de idade das mulheres incluídas neste estudo foi de 32,7 anos (DP±13,6); 66,9% eram consideradas brancas; 65,6% viviam com um único companheiro; 46,6% tinham oito anos ou menos de escolaridade e 88,1% tinham renda de um salário mínimo ou mais. Do total, 71,5% tinham idades iguais ou inferiores a 17 anos na primeira relação sexual, 46,4% eram gestantes; 49,7% tinham mais de um filho, 79,8% já haviam realizado o exame citopatológico, 95,8% apresentavam células normais no exame citopatológico no momento do estudo e 62,5% das pacientes HIV-1 positivas apresentavam a contagem de CD4 igual ou maior a 350 células/mm3. Entre as variáveis sociodemográficas associadas à presença do HPV, a única que mostrou significância estatística foi a idade. Pacientes com idades iguais ou inferiores a 20 anos apresentaram maior prevalência da infecção quando comparadas àquelas de maior idade (p=0,002). Com relação às características ginecológicas das pacientes, observou-se associação significativa entre o início precoce da vida sexual (idade <17 anos), com p=0,04, ausência de exame citopatológico (p=0,01) e diagnóstico de lesão intraepitelial de baixo ou alto graus (p=0,001). Dentre as pacientes, a multiparidade constitui-se fator de proteção para a infecção pelo HPV (p=0,01), como observado na Tabela 1.

Entre as pacientes HIV-1 positivas, realizou-se a dosagem de células T CD4+. A contagem igual ou menor a 349 células/mm3 teve uma associação significativa com a infecção pelo HPV (p=0,05), não acontecendo a mesma coisa quando comparadas as cargas virais plasmáticas de HIV-1 nestas pacientes (Tabela 1). Os resultados do exame citopatológico se mostraram normais em 272 (95,8%) e com alterações intraepiteliais de baixo ou alto grau em 12 (4,2%) pacientes.

No modelo final realizado com uso da análise multivariada, demonstrou-se que o maior risco de infecção pelo HPV está associado à pacientes com idades <20 anos (IC95% 1,0 - 7,7, p=0,04) e aquelas com o resultado do citopatológico alterado (IC95% 3,0 - 4,1, p=0,001), como visto na Tabela 2.

 

 

Quarenta e sete amostras (85,4%) do total das 55 incluídas no estudo foram genotipadas. Em cada uma houve apenas um genótipo por infecção. Os resultados encontrados por sequenciamento foram: oito HPV 16 (17%); oito HPV 58 (17%); seis HPV 6 (12,7%); quatro HPV 18 (8,5%); quatro HPV 33 (8,5%); três HPV 53 (5,4%); três HPV 82 (6,3%); dois HPV 83 (4,2%); dois HPV 61 (4,2%), e os demais, um caso com frequência de 2,1% cada.

Quando comparados os genótipos do HPV com os exames citopatológicos, entre todas as pacientes infectadas pelo HPV 16 cinco (62,5%) apresentaram citopatológico sem alterações intraepiteliais e três (37,5%), citopatológico com alterações intraepiteliais de baixo e alto grau. Já para o HPV 18, três delas (75%) tiveram citopatológico sem alterações intraepiteliais e uma (25%) apresentou o citopatológico com alterações intraepiteliais de baixo e alto grau.

 

Discussão

A prevalência do HPV neste estudo foi de 18,2% (55/302). No Brasil, foram encontrados resultados similares que detectaram 18,3%, em João Pessoa, Paraíba18, 17,8 e 16,8%, em São Paulo, São Paulo12,19.

Quando comparada a prevalência do HPV entre as pacientes atendidas nas UBS e no Hospital Universitário, não houve diferença significativa. Esse resultado junto às variáveis analisadas em ambos os grupos sugere que as populações atendidas pelas UBS e pelo Hospital Universitário possuem as mesmas características, tanto sociodemográficas como comportamentais, mostrando assim a importância da implantação das UBS para evitar a superlotação dos hospitais, o que melhoraria o atendimento para a maior parte da população.

Quando realizada a análise bivariada, o início precoce das relações sexuais mostrou-se um fator de risco para a infecção pelo HPV. Outro estudo demonstrou que tal variável foi um fator importante para o desenvolvimento de neoplasias cervicais20. Em relação ao número de gestações anteriores, os presentes resultados mostraram proteção contra a infecção por HPV em mulheres com maior número de partos o que havia sido relatado21,22.

A infecção pelo HPV foi significativamente mais frequente em mulheres que relataram não terem feito o exame citopatológico. Apesar dos benefícios do exame citopatológico serem conhecidos, a cobertura deste exame ainda é baixa23. A sua realização periódica seria a melhor estratégia para o rastreamento do câncer cervical.

A gestação também foi um fator associado à infecção, pela alta prevalência do vírus nessa população. Acredita-se que a gravidez possa interferir com a infecção pelo HPV devido a alterações imunes e hormonais11. Sabe-se que altos níveis de hormônios esteroides produzem diminuição da síntese e atividade dos linfócitos e macrófagos. Assim, durante a gestação há depressão transitória e seletiva da imunocompetência celular. A atividade dos linfócitos T auxiliares e T supressores está diminuída, assim como da IgG e IgA no muco cervical10.

Já foi demonstrada a relação entre as infecções pelos vírus HPV e HIV-124,25, maior prevalência do HPV em mulheres HIV-1 positivas. No presente estudo, a frequência de infecção pelo HPV entre as gestantes HIV-1 positivas (29,2%) foi mais elevada em comparação com as negativas e as não gestantes HIV-1 negativas e positivas. Esse fato pode se dever à imunomodulação característica durante o período da gestação, ocasionando um aumento dos casos de HPV9. A associação entre a infecção pelo HPV e as mulheres infectadas pelo HIV-1 está bem documentada e, para este grupo, há maior prevalência de HPV de alto risco, persistência e recorrência, quando comparadas com HIV-1 negativas24.

As pacientes HIV-1 positivas com a contagem de CD4 <349 células/mm3 mostraram associação positiva com a infecção pelo HPV. Já observou-se que a detecção de DNA do HPV está associada com níveis mais baixos de linfócitos T CD4+ e cargas virais mais elevadas do HIV-126.

No entanto, na análise multivariada, notou-se que apenas as variáveis que persistiram associadas significativamente à infecção pelo HPV foram a idade e o exame citopatológico alterado. As mulheres com idades <20 anos tiveram maiores chances de estar infectada pelo HPV quando comparadas com outras faixa etárias. Neste estudo, a prevalência da infecção pelo HPV nessa população foi de 34,4%, valor este muito superior ao encontrado na amostra geral. Vários trabalhos constataram a infecção em mulheres mais jovens27-29. Adolescentes são consideradas mais suscetíveis à infecção pelo HPV e as lesões precursoras do carcinoma cervical progridem mais rapidamente em mulheres jovens. Esses fatos estariam relacionados ao baixo uso de métodos de barreira, a imaturidade imunológica sistêmica e cervical em diferenças biológicas e/ou fisiológicas no epitélio cervical30. Dessa forma, mais estudos são necessários para se compreender quais são os mecanismos fisiológicos/biológicos envolvidos na história natural da infecção pelo HPV em mulheres mais jovens.

Apesar da população de adolescentes ser considerada de maior risco para portar o HPV, os exames de rastreio neste grupo são menos frequentes do que entre as mulheres adultas. Por isto, sugere-se direcionar projetos de educação em saúde neste grupo para se divulgar não só a importância e a finalidade do exame citopatológico, mas também o uso de preservativos e o controle dos parceiros sexuais, relacionando tais condutas à prevenção do câncer de colo uterino.

O genótipo das amostras cervicais de 47 pacientes foi determinado no presente trabalho. Entre aqueles de alto risco encontrados, os mais prevalentes foram o HPV 16, 58, 18 e o 33, sendo estes também os tipos mais encontrados nos casos de lesões intraepiteliais de baixo e alto grau. Entre os genótipos de baixo risco, o HPV 6 foi o mais prevalente, sendo este um dos virais mais comuns responsáveis pelas verrugas genitais.

Com menor frequência também foram encontrados os genótipos HPV 31, 35, 45, 53, 64, 68, 71, 82, 83 e 85, considerados de alto risco oncogênicos, embora a associação com o câncer cervical seja menos forte em comparação aos tipos 16 e 18, e o 61 de baixo risco4,31.

De acordo com outros estudos, o HPV 16 é o tipo mais prevalente em todas as regiões brasileiras, mas há uma variação em relação aos tipos e regiões. O HPV 18 é o segundo mais prevalente no Norte, Sudeste e Sul do Brasil e os 31 e 33 são os próximos mais prevalentes no Nordeste e Centro do Brasil, respectivamente32. Em um recente trabalho realizado em 18 países, detectou-se em 46,5% dos casos de lesão intraepitelial de alto grau o HPV 16 e em 8,9%, o 18. Nos casos de câncer cervical invasivo foram detectados 53,2% de HPV 16 e 13,2% de 1833.

Em oito amostras não foi possível a identificação do genótipo, que está de acordo com outros estudos. Em um caso-controle, não foi possível identificar por sequenciamento o genótipo viral em 15 casos (23,4%) e em nove amostras (28,6%) o mesmo não foi identificado no Grupo Controle20. Noutro estudo não se identificou o genótipo em três (10%) das mulheres infectadas pelo HIV-1 e em uma (11,1%) daquelas HIV-1 negativas27.

Em relação ao exame citopatológico, a prevalência dos genótipos de alto risco oncogênico foi mais elevada entre os resultados citopatológicos que não mostravam alterações intraepiteliais de alto ou baixo grau. Isso poderia ocorrer devido a limitações importantes nas avaliações citológicas, como resultados falso-negativos advindos de erros na coleta, na preparação e na leitura das amostras citológicas, ou visto que a infecção pelo HPV é um fenômeno progressivo e, dependendo do tempo de infecção, sua presença ainda não foi capaz de causar alterações celulares detectáveis pelos métodos citopatológicos e anatomopatológicos convencionais34. Assim, o exame citopatológico associado à detecção do DNA do HPV por técnicas de biologia molecular é a alternativa para identificar precocemente pacientes com elevado risco de desenvolver câncer cervical35.

Entre as limitações deste estudo podem ser mencionados os vieses de memória e informação, devido às informações serem baseadas em autorrelatos, podendo interferir nos resultados de estudos transversais. Em conclusão, este estudo detectou, por meio da PCR, uma alta prevalência do DNA-HPV em mulheres com idades inferiores a 20 anos, apresentando uma importante associação entre a idade das pacientes e a infecção pelo HPV. A gestação também está relacionada a uma maior frequência de tal enfermidade. Além disso, a genotipagem viral associada à citologia pode ser útil na identificação de mulheres de risco para lesões cervicais mais graves, resultando em uma melhoria na sua detecção.

 

Referências

1. Aral SO, Holmes KK. The epidemiology of STIs and their social and behavioral determinants: industrialized and developing countries. In: Holmes KK, Sparling PF, Stamm WE, Piot P, Wasserheit JN, Corey L, editors. Sexually transmitted diseases. 4th ed. New York: McGraw-Hill; 2008. p. 53-92.         [ Links ]

2. Bernard HU, Burk RD, Chen Z, van Doorslaer K, zur Hausen H, de Villiers EM. Classification of papillomaviruses (PVs) based on 189 PV types and proposal of taxonomic amendments. Virology. 2010;401(1):70-9.         [ Links ]

3. Nakagawa JTT, Schirmer J, Barbieri M. Vírus HPV e câncer de colo de útero. Rev Bras Enferm. 2010;63(2):307-11.         [ Links ]

4. Dunne EF, Unger ER, Sternberg M, McQuillan G, Swan DC, Patel SS, et al. Prevalence of HPV infection among females in the United States. JAMA. 2007;297(8):813-9.         [ Links ]

5. Ayres ARG, Silva GA. Prevalência de infecção do colo do útero pelo HPV no Brasil: revisão sistemática. Rev Saúde Pública. 2010;44(5):963-74.         [ Links ]

6. Banura C, Mirembe FM, Katahoire AR, Namujju PB, Mbonye AK, Wabwire FM. Epidemiology of HPV genotypes in Uganda and the role of the current preventive vaccines: a systematic review. Infect Agent Cancer. 2011;6(1):11.         [ Links ]

7. Roteli-Martins CM, Longatto Filho A, Hammes LS, Derchain SFM, Naud P, Matos JC, et al. [Association between age at first sexual intercourse and subsequent human papillomavirus infection: results of a Brazilian screening program]. Rev Bras Ginecol Obstet. 2007;29(11):580-7. Portuguese.         [ Links ]

8. Baseman JG, Koutsky LA. The epidemiology of human papillomavirus infections. J Clin Virol. 2005;32 Suppl 1:S16-24.         [ Links ]

9. Bonilha JL, Yakabe MF, Camargo BF, Martins EKL, Ribeiro MCA, Costa-Neto JM, et al. Incidência de HPV em colo do útero de gestantes HIV positivas atendidas no Hospital de Base de São José do Rio Preto, SP. Einstein (São Paulo). 2009;7(3):334-40.         [ Links ]

10. Silveira LMS, Veras RC, Cruz ALN, Faria MS. Gestação e papilomavírus humano: influência da idade materna, período gestacional, número de gestações e achados microbiológicos. Rev Bras Anal Clin. 2008;40(1):43-7.         [ Links ]

11. Jalil EM, Duarte G, El Beitune P, Simões RT, Melli PPS, Quintana SM. High prevalence of human papillomavirus infection among Brazilian pregnant women with and without human immunodeficiency virus type 1. Obstet Gynecol Int. 2009;2009:485423.         [ Links ]

12. Rama CH, Roteli-Martins CM, Derchain SFM, Oliveira EZ, Aldrighi JM, Mariani Neto C. Detecção sorológica de anti-HPV 16 e 18 e sua associação com os achados do papanicolaou em adolescentes e mulheres jovens. Rev Assoc Med Bras. 2006;52(1):43-7.         [ Links ]

13. Brasil. Ministério da Saúde. Instituto Nacional de Câncer [Internet]. Estimativa 2012: incidência de câncer no Brasil. Rio de Janeiro: INCA; 2010 [citado 2013 Jan 12]. Disponível em: <http://www.inca.gov.br/estimativa/2012/>         [ Links ]

14. Girianelli VR, Thuler LCS, Silva GA. [Prevalence of HPV infection among women covered by the family health program in the Baixada Fluminense, Rio de Janeiro, Brazil]. Rev Bras Ginecol Obstet. 2010;32(1):39-46. Portuguese.         [ Links ]

15. Becker E Jr, Edelweiss MI, Nonnenmacher B, Bozzetti MC. Prevalence and epidemiologic correlates of atypical squamous cells of undetermined significance in women at low risk for cervical cancer. Diagn Cytopathol. 2000;24(4):276-82.         [ Links ]

16. Manos MM, Ting Y, Wright DK, Lewis AJ, Broker TR, Wolinsky SM. Use of polymerase chain reaction amplification for the detection of genital human papillomaviruses. Cancer Cells. 1989;7:209-14.         [ Links ]

17. van den Brule AJ, Snijders PJ, Gordijn RL, Bleker OP, Meijer CJ, Walboomers JM. General primer-mediated polymerase chain reaction permits the detection of sequenced and still unsequenced human papillomavirus genotypes in cervical scrapes and carcinomas. Int J Cancer. 1990;45(4):644-9.         [ Links ]

18. Franco EL, Villa LL, Ruiz A, Costa MC. Transmission of cervical human papillomavirus infection by sexual activity: differences between low and high oncogenic risk types. J Infect Dis. 1995;172(3):756-63.         [ Links ]

19. Trottier H, Mahmud S, Costa MC, Sobrinho JP, Duarte-Franco E, Rohan TE, et al. Human papillomavirus infections with multiple types and risk of cervical neoplasia. Cancer Epidemiol Biomarkers Prev. 2006;15(7):1274-80.         [ Links ]

20. Silva TT, Guimarães ML, Barbosa MIC, Pinheiro MFG, Maia AF. [Identification of papillomavirus types and other risk factors for cervical intraepithelial neoplasia]. Rev Bras Ginecol Obstet. 2006;28(5):285-91. Portuguese.         [ Links ]

21. Murta EFC, Souza MAH, Adad SJ, Araujo Junior E. [Human papillomavirus infection in pregnancy: relationship with cytological findings]. Rev Bras Ginecol Obstet. 2001;23(6):377-82. Portuguese.         [ Links ]

22. Morrison EA, Gammon MD, Goldberg GL, Vermund SH, Burk RD. Pregnancy and cervical infection with human papillomaviruses. Int J Gynaecol Obstet. 1996;54(2):125-30.         [ Links ]

23. Martins LFL, Thuler LCS, Valente JG. [Coverage of the Pap smear in Brazil and its determining factors: a systematic literature review]. Rev Bras Ginecol Obstet. 2005;27(8):485-92. Portuguese.         [ Links ]

24. Brandão VCRAB, Lacerda HR, Ximenes RAA. Frequência de papilomavírus humano (HPV) e Chlamydia trachomatis em gestantes. Epidemiol Serv Saúde. 2010;19(1):43-50.         [ Links ]

25. Zhang YX, Xiong Y, Gui XE, Chen SH, Rong YP, Cai HB. Epidemiologic risk profile of human papillomavirus infections in human immunodeficiency virus-positive Chinese women. Jpn J Infect Dis. 2011;64(5):411-6.         [ Links ]

26. Strickler HD, Burk RD, Fazzari M, Anastos K, Minkoff H, Massad LS, et al. Natural history and possible reactivation of human papillomavirus in human immunodeficiency virus-positive women. J Natl Cancer Inst. 2005;97(8):577-86.         [ Links ]

27. Campos RR, Melo VH, Del Castilho DM, Nogueira CPF. [Prevalence of human papillomavirus and its genotypes in the uterine cervix of HIV-infected and non-infected women]. Rev Bras Ginecol Obstet. 2005;27(5):248-56. Portuguese.         [ Links ]

28. Molano M, Posso H, Weiderpass E, van den Brule AJ, Ronderos M, Franceschi S, et al. Prevalence and determinants of HPV infection among Colombian women with normal cytology. Br J Cancer. 2002;87(3):324-33.         [ Links ]

29. Johnson AM, Mercer CH, Beddows S, Silva N, Desai S, Howell-Jones R, et al. Epidemiology of, and behavioural risk factors for, sexually transmitted human papillomavirus infection in men and women in Britain. Sex Transm Infect. 2012;88(3):212-7.         [ Links ]

30. Deligdisch L, Miranda CRR, Wu HS, Gil J. Human papillomavirus-related cervical lesions in adolescents: a histologic and morphometric study. Gynecol Oncol. 2003;89(1):52-9.         [ Links ]

31. Derchain SFM, Sarian LOZ. [Prophylactic HPV vacines]. Rev Bras Ginecol Obstet. 2007;29(6):281-4. Portuguese.         [ Links ]

32. Rabelo-Santos SH, Zeferino L, Villa LL, Sobrinho JP, Amaral RG, Magalhães AV. Human papillomavirus prevalence among women with cervical intraepithelial neoplasia III and invasive cervical cancer from Goiania, Brazil. Mem Inst Oswaldo Cruz. 2003;98(2):181-4.         [ Links ]

33. Ciapponi A, Bardach A, Glujovsky D, Gibbons L, Picconi MA. Type-specific HPV prevalence in cervical cancer and high-grade lesions in Latin America and the Caribbean: systematic review and meta-analysis. PLoS ONE. 2011;6(10):1-15.         [ Links ]

34. Fernandes APM, Gonçalves MAG, Simões RT, Quintana SM, Duarte G, Donadi EA. Influência da infecção pelo HIV-1 sobre a presença do HPV em lesões do colo uterino. DST - J Bras Doenças Sex Transm. 2004;16(1):21-5.         [ Links ]

34. Bringhenti MEZ, Dozza TG, Dozza TG, Martins TR, Bazzo ML. Prevenção do câncer cervical: associação da citologia oncótica a novas técnicas de biologia molecular na detecção do papilomavírus humano (HPV). DST - J Bras Doenças Sex Transm. 2010;22(3):135-40.         [ Links ]

 

 

Endereço para correspondência:
Gisele Rodrigues de Oliveira
Área Acadêmica da Saúde (FURG)
Rua General Osório, s/n - Centro
CEP: 96200-190
Rio Grande (RS), Brasil

Recebido 08/03/2013
Aceito com modificações 22/05/2013

 

 

Trabalho realizado na Faculdade de Medicina da Universidade Federal do Rio Grande - Rio Grande (RS), Brasil.
Conflito de interesse: não há.

Creative Commons License Todo o conteúdo deste periódico, exceto onde está identificado, está licenciado sob uma Licença Creative Commons