A comparative survey between non-systemic Salmonella spp. (paratyphoid group) and systemic Salmonella Pullorum and S. Gallinarum with a focus on virulence genes

Uma investigação comparativa entre Salmonella spp. não-sistêmicas (grupo paratifoide) e sistêmicas Salmonella Pullorum e S. Gallinarum com enfoque nos genes de virulência

ABSTRACT:

A comparative survey between non-systemic (paratyphoid Salmonellae) and systemic (S. Pullorum and S. Gallinarum) Salmonella strains was performed to produce a virulence gene profile for differentiation among the groups. The following virulence genes were evaluated: invA, spvC, sefC, pefA, fimY, sopB, sopE1, stn and avrA. There are substantial differences among paratyphoid Salmonellae, S. Pullorum, and S. Gallinarum regarding the genes sefC, spvC, sopE1 and avrA. A higher frequency of sefC, spvC, sopE1 and avrA genes were detected in S. Gallinarum and S. Pullorum when compared with strains from the paratyphoid group of Salmonella. These results may be useful for differentiating among different groups and serotypes.

INDEX TERMS:
Salmonella spp.; paratyphoid group; Salmonella Pullorum; Salmonella Gallinarum; virulence genes. pullorum disease; fowl typhoid; chicken

RESUMO:

Uma investigação comparativa entre amostras de Salmonella não-sistêmicas (grupo paratifoide) e sistêmicas (S. Pullorum and S. Gallinarum) foi desenvolvida para produzir um perfil de genes de virulência para diferenciação entre os grupos. Os seguintes genes de virulência foram avaliados invA, spvC, sefC, pefA, fimY, sopB, sopE1, stn e avrA. Detectou-se uma diferença substancial entre Salmonella do grupo paratifoide, S. Pullorum e S. Gallinarum considerando os genes sefC, spvC, sopE1 e avrA. Os genes sefC, spvC, sopE1 e avrA foram detectados, em maior número, em S. Gallinarum e S. Pullorum quando comparados com as amostras de Salmonella do grupo paratifoide. Estes resultados podem ser úteis para a diferenciação entre os diferentes grupos e sorotipos de Salmonella.

TERMOS DE INDEXAÇÃO:
Salmonella spp.; grupo paratifoide; Salmonella Pullorum; Salmonella Gallinarum; genes de virulência; pulorose; tifo aviário; galinha

Introduction

The paratyphoid Salmonellae is responsible for food poisoning in humans when transmitted by food derived from infected chicken meat. The paratyphoid group of Salmonella, generally, is not considered pathogenic for chickens when orally ingested. Salmonella Pullorum and S. Gallinarum, regardless of the route of infection, cause mortality in young and adult birds, respectively (Pomeroy & Nagaraja 1991).

Virulence factors determine the ability of a given bacterial strain to cause disease. The invasion of and adhesion to the intestinal epithelium are essential events in salmonellosis pathogeny. Salmonella’s adherence to intestinal epithelial cells has been associated with the presence of type 1 fimbria (Isaacson & Kinsel 1992), coded by the fim operon. This operon harbors 10 genes including the fim Y gene, which is a regulatory gene used to detect the Salmonella genus (Yeh et al. 2002). The SEF14 fimbriae operon was described as a 3.9 kilobase (kb) region in Salmonella Enteritidis (Thorns et al. 1990). The sefABC gene(s) is located in this region. The sefC gene encodes an external membrane protein that leads the sefA subunit and the sefD adhesin to the cellular surface (Edwards et al. 2000). The sefC gene encodes a protein homologous to fimbrial outer membrane proteins, and it has been suggested that sefC is a component of this external membrane operon. The pef fimbriae are encoded by the pef (plasmid-encoded fimbriae) operon and are associated with adhesion to small intestine epithelial cells in mice (Bäumler et al. 1996).

Several factors contribute to host invasion, including the type III secretion system, which is a structure present in the bacterial membrane that is capable of transferring effector proteins into the host cell. InvA is one of the proteins that comprises the secreted protein export complex (Kimbrough & Miller 2002). The SopE1 and SopB proteins that are associated with other secreted proteins have the capacity to alter the cytoskeleton and thus provoke intestinal epithelial cell membrane ruffling and induce bacterial internalization. The sopE1 gene is horizontally transmitted by prophages and is present in a few Salmonella spp. serotypes (Zhang et al. 2002). AvrA is another protein secreted by the type III secretion system that inhibits NF-B transcription factor activation and increases human epithelial cell apoptosis in vitro (Collier-Hyams et al. 2002).

Some Salmonella serotypes cause gastroenteritis, and although the enterica subspecies produce the gene for enterotoxin (stn), only some strains produce this phenotype when cultured using conventional methods (Prager et al. 1995). High molecular weight plasmids (Helmuth et al. 1981) contain a highly conserved region called the spv region. The spv proteins are necessary to establish systemic infection (Roudier et al. 1992, Libby et al. 1997, Matsui et al. 2001).

The aim of this study was to compare the presence of virulence genes fimY, invA, sefC, pefA, sopE1, sopB, stn, avrA and spvC among the Salmonella paratyphoid group (non-systemic serovars), S. Pullorum and S. Gallinarum (systemic infection biovars) via Polymerase Chain Reaction (PCR), between systemic and non-systemic Salmonella strains, respectively.

Materials and Methods

Salmonella spp. strains and bacterial cultivation.Salmonella Typhimurium ATCC 14028 was used as a positive control strain for the detection of the invA, spvC, pefA, sopB, fimY and avrA genes. S. enteritis SA193 or S. Gallinarum SA 158 were used as positive control strains for the detection of sefC or sopE1 genes, respectively. The S. Pullorum, S. Gallinarum, S. Typhimurium, S. Senftenberg, S. Agona, S. Braenderup, S. Bredeney and S. Cerro strains belong to the Laboratory of Avian Diseases - FVMZ-USP, São Paulo, SP, Brazil. The strains were grown in LB Agar at 37ºC for 24 hours. Table 1 lists the studied Salmonella strains’ numbers, origins and isolation years.

Table 1.
The origins and years of isolation for Salmonella strains used in this study for the detection of virulence genes

Serotype	Group classification*	Number of isolates	Origin	Year of isolation
S. Agona	B	1	Ceca - Monitoring	1985
S. Typhimurium	B	2	Chicken sick	1985
S. Typhimurium	B	10	Ceca - Monitoring	1985
S. Cerro	K	11	Feed - Monitoring	1989
S. Gallinarum	D1	28	Chicken sick	1990
S. Pullorum	D1	18	Chicken sick	1990
S. Senftenberg	E4	13	Ceca - Monitoring	1999
S. Bredeney	B	1	Ceca - Monitoring	2001
S. Braenderup	C1	1	Ceca - Monitoring	2001

• * According to Kauffmann-White-LeMinor serotyping scheme.

Genomic Bacterial DNA Extraction and Polymerase Chain Reaction. Genomic DNA extraction was carried out according to Boom et al. (1990). The primers specific to the invA, spvC, sefC, pefA, fimY, sopB, sopE1 and avrA genes, references and amplicon sizes are presented in Table 2. All PCR reactions were carried out with Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions.

Table 2.
Primer sequences used for Salmonella spp. virulence gene detection

nes	Primer sequences 5´- 3´		Amplicon size - bp
invA	F: TTGTTACGGCTATTTTGACCA	R: CTGACTGCTACCTTGCTGATG	521
spvC	F: CGGAAATACCATCTACAAATA	R: CCCAAACCCATACTTACTCTG	669
pefA	F: GGGAATTCTTGCTTCCATTATTGCACTGGG	R:TCTGTCGACGGGGGATTATTTGTAAGCCACT	526
sefC	F: GCGAAAACCAATGCGACTGTAG	R: CCCACCAGAAACATTCATCCC	1104
fimY	F: GAGTTACTGAACCAACAGCT	R: GCCGGTAAACTACACGATGA	526
avrA	F: GTTATGGACGGAACGACATCGG	R: ATTCTGCTTCCCGCCGCC	389
sopB	F: CAACCGTTCTGGGTAAACAAGAC	R: AAGATTGAGCTCCTCTGGCGAT	1349
sopE1	F: ACACACTTTCACCGAGGAAGCG	R: GGATGCCTTCTGATGTTGACTGG	399
stn	F:TTGTCTCGCTATCACTGGCAACC	R:ATTCGTAACCCGCTCTCGTCC	618

For invA or spvC gene amplification, the PCR machine was programmed for 30 cycles, as follows: one minute at 93°C for denaturation, one minute at 42°C for annealing and 2 minutes at 72°C for extension. For the pefA or sefC genes, the following program of 30 cycles was used: one minute at 95°C for denaturation, one minute at 50°C for annealing and 6 minutes at 72°C for extension. Finally, for fimY, avrA, sopB, stn or sopE genes, 35 cycles of one minute at 94°C for denaturation, one minute at 55°C for annealing and a minute and a half at 72°C for extension were used. In each amplification, a positive control (Salmonella spp. reference strains) and a negative control (ultra-pure water) were added.

Detection of PCR products. The PCR products (10 l) were visualized after separation by electrophoresis in an agarose gel (1.5%) stained with ethidium bromide (10 g/ml) and photographed under ultraviolet light. A 100 bp DNA ladder (Invitrogen^TM) was used as a molecular size marker.

Results

In this study, the invA, fimY and stn genes were detected in all of the analyzed strains. All Salmonella Typhimurium, S. Senftenberg, S. Agona, S. Cerro, S. Braenderup and S. Bredeney serotypes were positive (100%) for the sopB gene, while 14 (77.8%) and 23 (82.1%) of the S. Pullorum and S. Gallinarum strains were positive for this same gene, respectively.

The sopE1 gene was detected in three (7.7%) of the Salmonella strains in the paratyphoid group, 5 (27.8%) of the S. Pullorum strains and 20 (71.4%) of the S. Gallinarum strains.

The pefA gene was observed in nine (23.1%) paratyphoid group strains, two (11.1%) S. Pullorum strains and in two (7.1%) S. Gallinarum strains.

Regarding the avrA gene, all of the S. Pullorum and S. Gallinarum serotype strains and 38 (97.4%) strains of the paratyphoid group were positive (Table 3).

Table 3.
A comparison of the number of detected genes among Salmonella serotypes isolated from paratyphoid infection, pullorum disease and fowl typhoid origins

Salmonella strains n= 85	Associated diseases	Genes detected
		invA	fimY	stn	sopB	sefC	spvC	sopE1	pefA	avrA
S. Agona (n=1)	Paratyphoid infection	1	1	1	1	0	0	0	0	1
S. Typhimurium (n=12)	Paratyphoid infection	12	12	12	12	1	1	2	1	12
S. Senftenberg (n=13)	Paratyphoid infection	13	13	13	13	1	1	1	4	13
S. Cerro (n=11)	Paratyphoid infection	11	11	11	11	0	0	0	3	11
S. Braenderup (n=1)	Paratyphoid infection	1	1	1	1	0	0	0	0	1
S. Bredeney (n=1)	Paratyphoid infection	1	1	1	1	0	0	0	1	1
S. Pullorum (n=18)	Pullorum Disease	18	18	18	14	12	13	5	2	18
S. Gallinarum (n=28)	Fowl Typhoid	28	28	28	23	21	16	20	2	28
Total of positives (%)		85 (100)	85 (100)	85 (100)	76 (89,4)	35 (41,1)	31 (36,4)	28 (32,9)	13 (15,2)	85 (100)

Discussion

For the genes studied, differences were detected in the genetic profile of Salmonella strains in the paratyphoid group that is responsible for fowl typhoid.

The invA gene is considered a target for the molecular detection of the Salmonella genus (Rahn et al. 1992, Stone et al. 1994, Swamy et al. 1996). All of the analyzed strains produced the 521 bp invA-derived PCR amplicon, confirming the results of Swamy et al. (1996). However, these results did not agree with Dodson et al. (1999), who found four negative Salmonella Pullorum strains. The presence of the fimY gene in the studied strains, including Cerro, Agona and Braenderup serotypes, was also verified; these results were not found in the study performed by Yeh et al. (2002). Serotypes not yet studied for the stn gene (Prager et al. 1995, Dinjus et al. 1997, Rahman 1999) were also included in this study. This gene was found in 100% of the strains, which is in agreement with the report by Prager et al. (1995), furthermore, in the present study, the stn gene was also detected in the S. Senftenberg, S. Agona, S. Cerro, S. Braenderup, S. Bredeney and S. Pullorum serotypes.

The spv (Salmonella plasmid virulence) operon was found in a few serotypes of Salmonella enterica subspecies I, mainly those frequently associated with disease (Bäumler et al. 1998). The spv genes are essential for a given Salmonella spp. to be able to cause systemic infection in laboratory animals (Libby et al. 1997, Matsui et al. 2001). In this study, S. Pullorum and S. Gallinarum strains were isolated from internal organs and were spvC-gene positive in 13 (72.2%) and 16 (57.1%) of the strains, respectively. Thus, the spvC gene might have contributed to the systemic infections caused by these strains. However, other virulence factors may be important because strains negative for this gene were capable of causing pullorum disease or fowl typhoid. Only two (5.1%) paratyphoid Salmonella strains isolated from cecum possessed this gene; this result is in agreement with Swamy et al. (1996), who detected a low frequency of this gene (3.8%) in strains from this source.

The pefA gene was detected in 15.3% of the strains of S. Typhimurium, S. Senftenberg, S. Cerro, S. Bredeney, S. Pullorum and S. Gallinarum serotypes in the present study. However, Bäumler et al. (1997) detected this gene in S. Typhimurium, but did not detect it in S. Gallinarum or S. Pullorum; this gene was also not found among S. Pullorum strains analyzed by Dodson et al. (1999). Bäumler et al. (1996) suggested that acquisition of the fimbrial operons might have been one of the mechanisms that enabled the spread of Salmonella spp. to a large range of domestic animal host species. It was verified that 82.2% of S. Gallinarum and S. Pullorum strains possessed the sefC gene. This result is in agreement with other data in the literature that indicates the SEF14 fimbriae operon is distributed in group D Salmonella spp. (Thorns et al. 1992, Turcotte & Woodward 1993). However, other Salmonella groups also contain this gene, but at a low frequency (5.13%, in one strain of S. Typhimurium or S. Senftenberg).

Only one (1.2%) S. Typhimurium strain was avrA-gene negative. Although, avrA gene action is still poorly understood, Du & Galan (2009) and Jones et al. (2008) showed specifically inhibits the Salmonella-induced activation of the JNK pathway through its interaction with other secretion systems. The function of the protein coded for by this gene has recently been described as inhibiting pro-inflammatory activity by blocking the NF-B transcription factor and increasing in vitro epithelial cell apoptosis (Collier-Hyams et al. 2002). These authors suggested that the protein could be a host defense mechanism for rapidly eliminating infected cells. Our results confirmed the results of Prager et al. (2000) in S. Typhimurium, S. Gallinarum and S. Pullorum serotypes. However, this gene has also been found in S. Senftenberg, S. Cerro, S. Braenderup and S. Bredeney serotypes, showing its vast distribution within Salmonella enterica. Monack et al. (2001) proposed an in vivo Salmonella-induced macrophage death model in which Salmonella induces an early or late macrophage death under physiological conditions. That is, in the intestinal stage, the inflammation induced after macrophages apoptosis would help to disperse Salmonella in the gastrointestinal tract. During this phase, the SPI 1-encoded type III protein secretion system and the binding of SipB to caspase-1 would be involved. Once the systemic infection has been established, the cells killed by apoptosis would be phagocyted or ingested by newly migrated cells, which would allow a new intracellular dissemination cycle. In this phase, the proteins encoded by SPI-2 and spv genes would also be involved. AvrA is an effector protein secreted by the type III secretion system (Hardt & Galán 1997) and, therefore, it plays a role in the enteric phase of the infection. It is capable of inducing in vitro epithelial cell apoptosis (Collier-Hyams et al. 2002). It is possible that AvrA protein causes macrophage apoptosis in the lamina propria of the mucosa, which would make it another effector protein capable of activating caspase-1.

We found sopB genes in 89.4% of the strains, which is in accordance with the results of other authors (Prager et al. 2000, Mirold et al. 2001).

SopE1 genes were detected in 20 and 5 strains of S. Gallinarum and S. Pullorum serotypes (54.3%), respectively, while only 7.7% of S. Typhimurium and S. Senftenberg strains possessed this gene within other serotypes. These results agree with those reported by Prager et al. (2000), which indicated that this gene is found in a higher frequency in S. Gallinarum and S. Pullorum strains when compared to S. Typhimurium strains. Taking into account that the sopE1 gene is transmitted by prophages and was associated with S. Typhimurium enteropathogenicity in bovines (Zhang et al. 2002), a greater pathogenic potential for sopE1-positive S. Gallinarum and S. Pullorum strains may be expected, especially considering that the first two strains were isolated from sick fowls in this study.

Taking into account the presence of the spvC, sopE1 and pefA genes in S. Gallinarum and S. Pullorum strains, the different genetic profiles that were observed suggest the presence of different clones causing the disease in fowls. Comparisons of S. Pullorum and S. Gallinarum strains with the paratyphoid group of Salmonella revealed substantial differences concerning the presence of the sopE1, spvC and sefC genes. More comprehensive studies must be conducted to determine which virulence genes might be important to Salmonella virulence in fowls.

Acknowledgements

This study was supported by grants received from CNPq nº 453920/2014-4. Antonio J. Piantino Ferreira is a recipient of CNPq fellowship.

References

• Bäumler A.J., Gilde A.J., Tsolis R.M., Van Der Velden A.W.M., Ahmer B.M.M. & Heffron F. 1997. Contribution of horizontal gene transfer and deletion events to development of distinctive patterns of fimbrial operons during evolution of Salmonella serotypes. J. Bacteriol. 179:317-322.
• Bäumler A.J., Tsolis R.M., Bowe F.A., Kusters J.G., Hoffmann S. & Hefforn F. 1996. The pef Fimbrial Operon of Salmonella typhimurium mediates adhesion to murine small intestine and is necessary for fluid accumulation in the infant mouse. Infect. Immun. 64:61-68.
• Bäumler A.J., Tsolis R.M., Ficht T.A. & Adams L.G. 1998. Evolution of host adaptation in Salmonella enterica. Infect. Immun. 66:4579-4587.
• Boom R., Sol C.J.A., Salimans M.M.M., Jansen C.L., Dillen P.M.E.W. & Van Der Noordaa J. 1990. Rapid and simple method for purification of nucleic acids. J. Clin. Microbiol. 28:595-503.
• Collier-Hyams L., Zeng H., Sun J., Tomlinson A.D., Bao Z.Q., Chen H., Madara J.L., Orth K. & Neish A.S. 2002. Cutting edge: Salmonella AvrA effector inhibits the key pro-inflammatory, anti-apoptotic NF-kB pathway. J. Immunol.169:2846-2850.
• Dinjus U., Hänel I., Müller W., Bauerfeind R. & Helmuth R. 1997. Detection of the induction of Salmonella enterotoxin gene expression by contact with epithelial cells with RT-PCR. FEMS Microbiol. Lett.146:175-179.
• Dodson S.V., Maurer J.J., Holt P.S. & Lee M.D. 1999. Temporal changes in the population genetics of Salmonella pullorum Avian Dis. 43:685-695.
• Du F. & Galán J.E. 2009. Selective inhibition of type III secretion activated signaling by the Salmonella effector AvrA. PLoS Pathog. 5(9):e1000595. doi:10.1371/journal.ppat.1000595.
  » https://doi.org/10.1371/journal.ppat.1000595
• Edwards R.A., Schifferli D.M. & Maloy S.R. 2000. A role for Salmonella fimbriae in intraperitoneal infections. Proc. Natl Acad. Sci. USA 97:1258-1262.
• Hardt W. & Galán J.E. 1997. A secreted Salmonella protein with homology to an avirulence determinant of plant pathogenic bacteria. Proc. Natl Acad. Sci. USA 94:9887-9892.
• Helmuth R., Stephan E. & Bulling E. 1981. R-factor co-integrate formation in S. typhimurium bacteriophage type 201 strains. J. Bacteriol. 146:444-452.
• Isaacson R.E. & Kinsel M. 1992. Adhesion of Salmonella typhimurium to porcine intestinal epithelial surfaces: identification and characterization of two phenotypes. Infect. Immun. 60:3193-3200.
• Jones R.M., Wu H., Wentworth C., Luo L., Collier-Hyams L. & Neish A.S. 2008. Salmonella AvrA coordinates suppression of host immune and apoptotic defenses via JNK pathway blockade. Cell Host Microbe 17:233-244.
• Kimbrough T.G. & Miller S.I. 2002. Assembly of the type III secretion needle complex of Salmonella typhimurium Microbes Infect. 4:75-82.
• Libby S.J., Adams L.G., Ficht T.A., Allen C., Whitford H.A., Buchmeier N.A., Bossie S. & Guiney D.G. 1997. The spv genes on the Salmonella dublin virulence plasmid are required for severe enteritis and systemic infection in the natural host. Infect. Immun. 65:1786-1792.
• Matsui H., Bacot C.M., Garlington W.A., Doyle T.J., Roberts S. & Gulig P.A. 2001. Virulence plasmid-borne spvB and spvC genes can replace the 90-kilobase plasmid in conferring virulence to Salmonella enterica serovar Typhimurium in subcutaneously inoculated mice. J. Bacteriol. 183:4652-4658.
• Mirold S., Ehrbar K., Weissmüller A., Prager R., Tschäpe H., Rüssmann H. & Hardt W.D. 2001. Salmonella host cell invasion emerged by acquisition of a mosaic of separate genetic elements, including Salmonella pathogenicity island 1 (SPI1), SPI5 and sopE2. J. Bacteriol. 183:2348-2358.
• Monack D.M., Navarre W.W. & Falkow S. 2001. Salmonella-induced macrophage death: the role of caspase-1 in death and inflammation. Microbes Infect. 3:1201-1212.
• Pomeroy B.S. & Nagaraja K.V. 1991. Fowl typhoid, p.87-99. In: Calnek B.W., Barnes H.J., Beard C.W., Reid W.M. & Yoder Jr, H.W. (Eds), Diseases of Poultry. Iowa State University Press, Ames.
• Prager R., Fruth A. & Tschäpe H. 1995. Salmonella enterotoxin (stn) gene is prevalent among strains of Samonella enterica, but not among Salmonella bongori and other Enterobacteriaceae. FEMS Immunol. Med. Microbiol. 12:47-50.
• Prager R., Mirold S., Tietze E., Strutz U., Knüppel B., Rabsch W., Hardt W. & Tschäpe H. 2000. Prevalence and polymorphism of genes encoding translocated effector proteins among clinical isolates of Salmonella enterica Int. J. Med. Microbiol. 290:605-617.
• Rahman H. 1999. Prevalence of enterotoxin gene (stn) among different serovars of Salmonella. Indian J. Med. Res. 110:43-46.
• Rahn K., Grandis S.A., Clarke R.C., McEwen S.A., Galan J.E., Ginocchio C., Curtiss III R. & Gyles C.L. 1992. Amplification of an invA gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella Mol. Cell Prob. 6:271-279.
• Roudier C., Fierer J. & Guiney D.G. 1992. Characterization of translation termination mutations in the spv Operon of the Salmonella virulence plasmid pSLD2. J. Bacteriol. 174:6418-6423.
• Swamy S.C., Barnhart H.M., Lee M.D. & Dreesen D.W. 1996. Virulence determinants invA and spvC in Salmonellae isolated from poultry products, wastewater, and human sources. App. Environ. Microbiol. 62:3768-3771.
• Thorns C.J., Sojka M.G. & Chasey D. 1990. Detection of a novel fimbrial structure on the surface of Salmonella enteritidis using a monoclonal antibody. J. Clin. Microbiol. 28:2409-2414.
• Thorns C.J., Sojka M.G., McLaren I.M. & Dibb-Fuller M. 1992. Characterisation of monoclonal antibodies against a fimbrial structure of Salmonella enteritidis and certain other serogroup D salmonellae and their application as serotyping reagents. Res. Vet. Sci. 53:300-308.
• Turcotte C. & Woodward M.J. 1993. Cloning, DNA nucleotide sequence and distribution of the gene encoding SEF14, a fimbrial antigen of Salmonella enteritidis J. Gen. Microbiol. 139:1477-1485.
• Yeh K.S., Chen T.H., Liao C.W., Chang C.S. & Lo H.C. 2002. PCR amplification of the Salmonella typhimurium fimY gene sequence to detect the Salmonella species. Int. J. Food Microbiol. 78:227-234.
• Zhang S., Santos R.L., Tsolis R.M., Stender S., Hardt W., Bäumler A.J. & Adams G. 2002. The Salmonella enterica serotypes Typhimurium effector proteins SipA, SopA, SopB, SopD, and SopE2 Act in concert to induce diarrhea in calves. Infect. Immun. 70:3843-3855.

Publication Dates

• Publication in this collection
  Oct 2017

History

• Received
  27 June 2016
• Accepted
  31 Jan 2017