Toxoplasma gondii, Neospora caninum and Sarcocystis spp. in species of naturally infected birds

Toxoplasma gondii, Neospora caninum e Sarcocystis spp. em espécies de aves naturalmente infectadas

ABSTRACT:

Toxoplasma gondii, Neospora caninum and Sarcocystis spp. are parasites detected in tissues of domestic and wild animals. Birds are relevant in the life cycle and epidemiology of protozoa due to the wide variety of bird species, feeding and migratory habits. The aim of this study was the molecular detection of T. gondii, N. caninum and Sarcocystis spp. in several species of naturally infected birds. Therefore, samples of brain and heart tissue were collected from birds received and necropsied at the Central Laboratory for the Diagnosis of Avian Pathologies (LCDPA), undergoing DNA extraction and amplification by the polymerase chain reaction (PCR) of the 18S rRNA gene to Sarcocystis spp., NC5 gene for N. caninum and repetitive gene 529 base pairs for T. gondii. N. caninum was detected in two birds (02/65, 3.07%), in a brain sample of Rupornis magnisrostris (accession number: ON182081, 267pb) and in a brain and heart sample of Dendrocygna bicolor (accession number: ON211312, 267pb). DNA of the genus Sarcocystis was detected in three birds (03/65, 4.62%), and in the genetic sequencing Sarcocystis spp. (accession number: MW463929) in brain of Nymphicus hollandicus and Sarcocystis speeri (accession number: MW464125) in brain and heart of Amazona aestiva. Phylogenetic analysis revealed that Sarcocystis spp. formed a clade with Sarcocystis spp. that use skunk (Didelphis aurita) as definitive host and Sarcocystis falcatula that use Moluccan loris (Trichoglossus moluccanus) as intermediate host. S. speeri formed a clade with S. speeri that used Mus musculus as an experimental intermediate host and formed a clade with Sarcocystis columbae, Sarcocystis corvusi, Sarcocystis halieti and Sarcocystis sp. that affect bird species. T. gondii DNA was not detected in any tissue. This is the first report of DNA detection of N. caninum, Sarcocystis spp. and S. speeri in tissue samples for these bird species extending the list of intermediate hosts.

INDEX TERMS:
Toxoplasma gondii; Neospora caninum; Sarcocystis spp.; PCR; birds; brains; hearts; Apicomplexa

RESUMO:

Toxoplasma gondii, Neospora caninum e Sarcocystis spp. são parasitas detectados em tecidos de animais domésticos e selvagens. As aves são relevantes no ciclo de vida e epidemiologia dos protozoários devido à grande variedade de espécies de aves, hábitos alimentares e migratórios. O objetivo deste estudo foi a detecção molecular de T. gondii, N. caninum e Sarcocystis spp. em diversas espécies de aves naturalmente infectadas. Portanto, amostras de tecido de cérebro e coração foram coletados de aves recebidas e necropsiadas no Laboratório Central de Diagnóstico de Patologias Aviárias (LCDPA), sendo submetidas a extração de DNA e amplificação pela reação em cadeia da polimerase (PCR) do gene 18S rRNA para Sarcocystis spp., gene NC5 para N. caninum e gene repetitivo 529 pares de bases para T. gondii. N. caninum foi detectado em duas aves (02/65; 3,07%), em amostra de cérebro de Rupornis magnisrostris (número acesso: ON182081, 267pb) e em amostras de cérebro e coração de Dendrocygna bicolor (número acesso: ON211312, 267pb). DNA do genero Sarcocystis spp. foi detectado em três aves (03/65; 4,62%), sendo que no sequenciamento genético foram identificados Sarcocystis spp. (número acesso: MW463929) em cérebro de Nymphicus hollandicus e Sarcocystis speeri (número acesso: MW464125) em cérebro e coração de Amazona aestiva. A análise filogenética revelou que Sarcocystis spp. formou um clado com Sarcocystis spp. que utilizam gambá (Didelphis aurita) como hospedeiro definitivo e S. falcatula que utilizam Lóris-molucano (Trichoglossus moluccanus) como hospedeiro intermediário. S. speeri formou um clado com S. speeri que utilizou Mus musculus como hospedeiro intermediário experimental e formou um clado com Sarcocystis columbae, Sarcocystis corvusi, Sarcocystis halieti e Sarcocystis sp. que afetam espécies de aves. O DNA de T. gondii não foi detectado em nenhum tecido. Este é o primeiro relato de detecção de DNA de N. caninum, Sarcocystis spp. e S. speeri em amostras de tecido para essas espécies de aves estendendo a lista de hospedeiros intermediários.

TERMOS DE INDEXAÇÃO:
Toxoplasma gondii; Neospora caninum; Sarcocystis spp.; PCR; aves; cérebro; coração; Apicomplexa

Introduction

Toxoplasma gondii, Neospora caninum and Sarcocystis spp. are widespread protozoa Apicomplexa organisms with heteroxenous life cycles with capacity of infecting a variety of domestic and wild animals and different degree of clinical importance in animals and man (Dubey 2010, Darwich et al. 2012, Nazir et al. 2018). Birds are susceptible to T. gondii, N. caninum and Sarcocystis spp. infection and they are considered intermediate hosts in these protozoa life cycles, consequently birds are important sources for humans and other animals infection (Sato et al. 2020, Dubey et al. 2021).

T. gondii infection in birds was described (Ibrahim et al. 2018, Bachand et al. 2019), as well as N. caninum infection in birds (Costa et al. 2008, Gondim et al. 2010). Sarcocystis species also had been detected in birds however, birds role in Sarcocystis life cycle is not complete determined (Konradt et al. 2017). Birds feeding habits as consumption of carcass (carnivore birds) or consumption of food and water touching the soil make possible birds infection by ingesting protozoa cysts or oocysts (Dubey 2010, Darwich et al. 2012, Nardoni et al. 2019, Dubey et al. 2021 Sato et al. 2020).

The role of birds in protozoa life cycles and epidemiology remains unclear (Dubey & Jones 2008, Gondim et al. 2010, Sato et al. 2020). Besides that, studies showing the occurrence of T. gondii, N. caninum and Sarcocystis spp. in birds are scarce (Darwich et al. 2012, Konradt et al. 2017, Nazir et al. 2018). Therefore, the importance of domestic and wild birds in protozoa epidemiology needs more attention. So, the objective of this work was the molecular detection of T. gondii, N. caninum and Sarcocystis spp. in diverse species of naturally infected wild and domestic birds.

Materials and Methods

Samples

Birds who died from different causes and were destined to necropsy at the “Laboratório Central de Diagnóstico de Patologias Aviárias” (Avian Pathologies Diagnosis Central Laboratory - LCDPA) of the “Universidade Federal de Santa Maria” (UFSM) they were separated and analyzed. In study, were used tissue samples of brains and hearts from 65 birds, stored at -20°C until use DNA extraction is performed. The birds were classified in 33 species, belonging to 15 families (Accipitridae, Anatidae, Cacatuidae, Ciconiidae, Columbidae, Cracidae, Estrildidae, Fringillidae, Hirundinidae, Phasianidae, Psittacidae, Ramphastidae, Thraupidae, Turdidae and Tyranne) (Sick 1997). Birds were free-living, domestic or originating from conservatories or maintainer located in the city of Santa Maria, Rio Grande do Sul, Brazil (Table 1). Although the analyzed birds were inhabitants of places belonging to the city of Santa Maria, it is not possible to say that they lived all their lives in the same place because they have an unknown life history.

Table 1.
Classification of the 65 birds in families, species and housing in the municipality of Santa Maria, Rio Grande do Sul, Brazil

Family	Scientific name	Number of animals	Housing
Accipitridae	Rupornis magnirostris	1	Maintainer
Anatidae	Dendrocygna bicolor	1	Maintainer
Cacatuidae	Nymphicus hollandicus	2	Domestic
Ciconiidae	Ciconia maguari	1	Wild
Columbidae	Columbina passerina	1	Wild
Columbidae	Leptotila verreauxi	1	Wild
Columbidae	Zenaida auriculata	2	Wild
Cracidae	Crax fasciolata	2	Maintainer
Estrildidae	Erythrura gouldiae	1	Conservatory
Estrildidae	Poephila cincta	2	Conservatory
Estrildidae	Taeniopygia guttata	1	Conservatory
Fringillidae	Serinus canaria	3	Conservatory
Hirundinidae	Pygochelidon cyanoleuca	1	Wild
Phasianidae	Chrysolophus pictus	1	Conservatory
Phasianidae	Lophura swinhoii	1	Conservatory
Phasianidae	Pavo cristatus	1	Conservatory
Phasianidae	Syrmaticus ellioti	1	Conservatory
Psittacidae	Amazona aestiva	7	Maintainer
Psittacidae	Amazona aestiva	1	Conservatory
Psittacidae	Amazona amazonica	1	Maintainer
Psittacidae	Amazona pretrei	1	Conservatory
Psittacidae	Amazona vinacea	1	Maintainer
Psittacidae	Ara chloropterus	1	Maintainer
Psittacidae	Melopsittacus undulatus	2	Domestic
Psittacidae	Myiopsitta monachus	1	Domestic
Psittacidae	Myiopsitta monachus	1	Maintainer
Psittacidae	Neophema splendida	1	Conservatory
Psittacidae	Neopsephotus bourkii	5	Conservatory
Psittacidae	Platycercus eximius	6	Conservatory
Psittacidae	Forpus xanthopterygius	1	Conservatory
Psittacidae	Psephotus haematonotus	2	Conservatory
Psittacidae	Psephotus haematonotus	1	Conservatory
Ramphastidae	Ramphastos dicolorus	3	Maintainer
Thraupidae	Paroaria coronata	5	Maintainer
Turdidae	Turdus rufiventris	1	Wild
Tyrannidae	Tyrannus savana	1	Wild
15	33	65

DNA extraction

A total of 130 fresh tissue samples (65 brains and 65 hearts) from birds were submitted to DNA extraction. DNA was extracted from 50mg of tissue using commercial kit (Wizard^® Genomic DNA Purification Kit-Promega), following manufacturer instructions with one modification, the lysis step was performed at 55°C overnight, according to Moré et al. (2011). After extraction, DNA concentration was evaluated in all samples by measuring absorbance at 260nm with ultraviolet light (NanoDrop 1000, ThermoScientific, USA) and DNA concentration of all samples was adjusted to approximately 100ng/ul. After that, DNA samples were stored at -20°C until use.

Molecular detection

The diagnosis of infection by the protozoa Toxoplasma gondii, Neospora caninum and Sarcocystis spp. was carried out by detecting nucleic acids (DNA) using the polymerase chain reaction technique (PCR).

T. gondii PCR. Extracted DNA from birds tissues was submitted to PCR amplifying repetitive gene 529 base pares for T. gondii using primers TOX4 (CGCTGCAGGGAGGAAGACGAAAGTTG) and TOX5 (CGCTGCAGACACAGTGCATCTGGATT) were selected from the 5’ and 3’ for amplification of a 529 bp fragment (Homan et al. 2000). Each PCR was performed in a total volume of 25μL, containing 2.5μL of10X buffer (Promega, USA); 0.65mM dNTPs (Ludwig Biotec, Brazil); 0.6μm of each primer (Sigma-Aldrich, Brazil); 1U Taq DNA Polymerase (Promega, USA); 1.25mM MgCl and 100ng of DNA as template. DNA extracted from tachizoites of T. gondii RH strain was used as positive control and MilliQ water was used as negative control. The PCR was carried out using a T100 thermal cycler (BioRad, USA) under the following conditions: 10 min at 95°C for the initial hot denaturation step, followed by 30 cycles of 30 s at 94°C, 1 min at 65°C, 1 min at 72°C, and a final extension step of 5 min at 72°C. The PCR products were visualized by UV illumination after electrophoresis at 1% agarose gel stained with Gel Red Nucleic Acid Stain (Biotium, USA).

N. caninum PCR. PCR was performed using a set of primers Np6 (CAGTCAACCTACGTCTTC) and Np21 (GTGCGTCCAATCCTGTAA) amplifying NC5 specific gene, sequence primers 5’ and 3’ amplifying a fragment of 328 bp (Yamage et al. 1996). Each reaction was made in a final volume of 25μL, containing 2.5μL of 10X buffer, 0.5μM of each primer, 0.5mM deoxynucleotide triphosphate (dNTPs) (Kapa, Bio Systems, Boston/MA, USA), 1U of Taq DNA Polymerase GoTaq^® (Hot Start Polymerase, Promega, Madison/WI, USA), 0.75mM MgCl and 100ng of DNA. DNA extracted from tachizoites of N. caninum NC1 strain was used as positive control and MilliQ water was used as negative control. The PCR was carried out using a T100 thermal cycler (BioRad, USA) under the following conditions: 5 min at 95°C for the initial hot denaturation step, followed by 35 cycles of 1 min at 95°C, 1 min at 50°C, 1 min at 72°C, and a final extension step of 10 min at 72°C. The PCR products were visualized by UV illumination after electrophoresis at 1% agarose gel stained with Gel Red Nucleic Acid Stain (Biotium, USA).

Sarcocystis spp. PCR. Detection of Sarcocystis spp. by PCR amplifying the 18S rRNA region of the gene was carried out using 2L (GGATAAACCGTGGTAATTCTATG) and 3H (GGCAAATGCTTTCGCAGTAG), sequence primers 5’ and 3’amplifying a 900 bp fragment (Yang et al. 2001). Each PCR was performed in a total volume of 25μL, containing 3μL of 10X buffer (Promega, USA); 1mM dNTPs (Ludwig Biotec, Brazil); 1.2uM of each primer (Sigma-Aldrich, Brazil); 1U Taq DNA polymerase (Promega, USA); 1.5mM MgCl and 100ng of DNA as template. DNA extracted from a pool of 50 cysts of Sarcocystis spp. was used as positive control and MilliQ water was used as negative control. The PCR was carried out using a T100 thermal cycler (BioRad, USA) under the following conditions: 2 min at 95°C for the initial hot denaturation step, followed by 40 cycles of 40 s at 94°C, 50 s at 56°C, 6 s at 72°C, and a final extension step of 6 min at 72°C. The PCR products were visualized by UV illumination after electrophoresis at 1% agarose gel stained with Gel Red Nucleic Acid Stain (Biotium, USA).

PCR inhibition test

Additional test was performed to determine whether PCR amplification may fail due the presence of PCR inhibitors in the samples.

Mixing positive and negative DNA templates. A possible effect of PCR inhibitors that could be present together with DNA templates which did not resulted in N. caninum, Sarcocystis spp. or T. gondii DNA amplification was tested by mixing positive control DNA templates with negative samples extracted from birds brain or heart fragments. Therefore, samples control positive were mixed 1:1; 5/5μL with negative samples (i.e. 5 brain samples and 5 heart samples for each parasite analyzed) and submitted to same PCR conditions.

Gene sequencing

Positive PCR products for N. caninum and Sarcocystis spp. were purified using QIAquick^® PCR Purificatoin Kit (Qiagen™, Germany) according to manufacturer instructions. Final purified DNA was analyzed using spectrophotometer NanoDrop 1000 (ThermoScientific, USA) for concentration determination. After PCR purification, the sequencing reactions were performed using 5pmol of primers separately, 30-60ng of purified PCR product and MiliQ water in a final volume of 6μL. Followed by dehydration at 60°C for 2 hours and finally submitted to sequencing (ACTGENE - Serviço de Sequenciamento, Brazil). The results obtained were analyzed using StandenPackage software and the generated nucleotides sequences evaluated in Genbank NCBI database blast search⁴.

Gene identification and phylogenetic analysis

Phylogenetic analyses were conducted separately for the 18S rRNA by using MEGA X software. Sequence analyses were performed with the BLASTX software⁵. Nucleotide sequences were aligned and compared to sequences from various hosts were downloaded from GenBank database using ClustalW. The alignments were optimized with the BioEdit Sequence Alignment Editor Program version 7.2. Phylogenetic analysis was carried out in MEGA-X, using the maximum likelihood. The confidence of each branch in the phylogeny was estimated with bootstrap values calculated from 1000 replicates.

Authorization for use tissue samples of dead bird

This study was authorized by “Instituto Chico Mendes de Conservação da Biodiversidade” (Chico Mendes Institute for Biodiversity Conservation - ICMBio) under the “Sistema de Autorização e Informação em Biodiversidade” (Biodiversity Authorization and Information System - SISBIO) registration number 76022-1. Animals’ Use Ethics Committee (CEUA) registration number 8263100820 because the study involves only dead animals not necessary approval.

Results

In the study, DNA from Toxoplasma gondii was not detected in tissue sample, in addition to DNA from Neospora caninum or Sarcocystis spp. was found in five birds (05/65, 7.69%) (Table 2). N. caninum DNA was detected by PCR and sequencing confirmed in two birds, in brain tissue of a Rupornis magnisrostris (accession number: ON182081, 267pb) and in brain and heart tissues of a Dendrocygna bicolor (accession number: ON211312, 267pb) (Table 2).

Table 2.
Toxoplasma gondii, Neospora caninum and Sarcocystis spp. nucleic acid detection in brain and heart of naturally infected birds

Scientific name	Number of animals tested	Number of animals positive	Toxoplasma gondii		Neospora caninum (2/65 - 3.07%)		Sarcocystis spp. (3/65 - 4.62%)
			Heart	Brain	Heart	Brain	Heart	Brain
Rupornis magnirostris	1	1	-	-	-	1	-	-
Dendrocygna bicolor	1	1	-	-	1	1	-	-
Nymphicus hollandicus	2	1	-	-	-	-	-	1
Amazona aestiva	7	1	-	-	-	-	1	1
Paroaria coronata	5	1	-	-	-	-	1	1
TOTAL		5/65 (7.69%)	0	0	1/65 (1.54%)	2/65 (3.07%)	2/65 (3.07%)	3/65 (4.62%)

Sarcocystis spp. DNA was detected by PCR in three birds: in brain tissue of a Nymphicus hollandicus, in brain and heart of Amazona aestiva and in brain and heart of a Paroaria coronata (Table 2). The samples tissue of the three birds were sequenced, but unsuccessful for brain and heart samples of a Paroaria coronata. Genetic sequencing confirmed and were sequences deposited in GenBank the presence of Sarcocystis spp. in the brain of Nymphicus hollandicus (accession number: MW463929, 712pb) and Sarcocystis speeri in the brain and heart of a Amazona aestiva (accession number: MW464125, 650pb). No mixed infections were observed.

Phylogenetic analysis based of the 18S rRNA (Fig.1) revealed that Sarcocystis spp. formed a clade with Sarcocystis spp. that utilize Didelphis aurita as the known or presumed definitive host and Sarcocystis falcatula that utilize Trichoglossus moluccanus as intermediate host. Sarcocystis speeri formed a clade with S. speeri that utilized Mus musculus (gamma interferon gene knockout mice) as intermediate host in bioassay. Besides, formed a clade with Sarcocystis columbae, Sarcocystis corvusi, Sarcocystis halieti and Sarcocystis sp. that affect outers species birds. Additional test was performed to evaluate whether PCR inhibitors could be influencing negative results and all of there-tested samples (10 previously negative samples mixed with T. gondii DNA - 10 previously negative samples mixed with N. caninum DNA - 10 previously negative samples mixed with Sarcocystis spp. DNA) resulted in positive both parasites DNA amplification indicating the absence of inhibitors in PCR reaction.

Fig.1.
Phylogenetic analysis of 18S rRNA sequences obtained from various hosts compared to representative members of Sacocystidae family. The values between the branches represent the percent bootstrap value per 1000 replicates, and values below 70% are not shown.

Discussion

DNA from Toxoplasma gondii was not detected in tissue sample. Although birds are more resistant to T. gondii infection, DNA of T. gondii has already been detected in birds tissues in different countries (Gondim et al. 2010, Lukášová et al. 2018). Birds eating habits involve direct contact with soil and water potentially contaminated with sporulated oocysts, which is considered the most important form of T. gondii infection for animals (Dubey 2010). Therefore, the absence of T. gondii DNA in the analyzed birds samples was unexpected due the wide environmental contamination with T. gondii (Dubey et al. 2021).

DNA detection suggests that there were infection of Neospora caninum in wild birds, demonstrating that the positive detected birds were susceptibility to N. caninum infection and that birds were naturally infected. However, infection in birds has been described by different authors and N. caninum DNA had already been detected in sparrows tissues in Brazil (Costa et al. 2008, Gondim et al. 2010) and in other places in the world as in woodpeckers and vultures in Spain (Darwich et al. 2012), in crows in Israel (Salant et al. 2015) and pigeons in China (Du et al. 2015). A study demonstrated a higher prevalence of Neosporosis in cattle in farms that have the presence of birds (Darwich et al. 2012). N. caninum infection showed in the present study reinforce birds as an intermediate host and consequently serving as a source of infection for definitive host.

DNA from Sarcocystis spp. was detected in the species Nymphicus hollandicus and Paroaria coronata. Nucleic acids of Sarcocystis speeri was detected in Amazona aestiva. In a Brazilian zoo described Sarcocystis of the outbreak involving parakeets, cockatoos, parrots and pigeons (Ecco et al. 2008). In South American, other species have been described, such Sarcocystis falcatula-like (Dubey et al. 2000) and Sarcocystis lindsayi (Dubey et al. 2001).

S. speeri was described and named by Dubey & Lindsay (1999), who used an experimental intermediate host (Mus musculus) susceptible to infection, but the natural intermediate hosts are unknown. Didelphis albiventris and Didelphis virginiana are considered definitive hosts for S. speeri (Dubey et al. 2000). Besides, S. falcatula and Sarcocystis neurona use Didelphis spp. as definitive hosts (Gondim et al. 2021). In South America may act as definitive hosts D. albiventris, Didelphis aurita, Didelphis marsupialis, Didelphis imperfecta and Didelphis pernigra. (Cerqueira 1985, Lemos & Cerqueira 2002). Studies report that S. speeri and S. neurona are not infective to Melopsittacus undulatus, but are infective to gamma interferon gene knockout (KO) mice and, species S. falcatula and S. lindsayi are infective to M. undulatus but not to KO mice (Dubey et al. 2016).

In general, the N. hollandicus, A. aestiva and P. coronata are classified as a granivorous birds and under natural conditions its diet consists of a wide variety of seeds, fruits, leaves, flowers and insects (Sick 1997). The presence of DNA of parasites of genre Sarcocystis, in the present study, suggests these birds as intermediate host and also deduces that probably became infected by ingestion of contaminated water or food containing oocysts or Sarcocystis. Omnivorous or carnivorous birds have been identified as definitive hosts for Sarcocystis (Valadas et al. 2016).

The detection of Sarcocystis spp. and S. speeri in tissue samples from birds contribute to the extension of intermediate hosts. Sarcocystis spp. present a wide range of both definitive and intermediate hosts, and their detection in bird samples is extremely relevant, since birds are prey in the food chain of definitive hosts. Additionally, birds infected with S. speeri may be a risk factor for D. albiventris and D. virginiana infection when they ingest infected bird carcasses containing tissue cysts (Dubey & Lindsay 1999).

Diverse animal species are involved in Sarcocystis life cycle contributing to the wide protozoa distribution and previous studies had already demonstrated the presence of Sarcocystis in wild birds tissues (Prakas & Butkauskas 2012). Therefore, DNA detection N. caninum, Sarcocystis spp. and S. speeri reinforce protozoa infection potential in wild and domestic birds species and the importance of birds in protozoa epidemiology.

Conclusions

DNA of Neospora or Sarcocystis was detected in five birds. Neospora caninum nuclei acids were detected in tissue samples of naturally infected Rupornis magnirostris and Dendrocygna bicolor. Sarcocystis spp. DNA was detected in tissue samples Nymphicus hollandicus and Paroaria coronata and Sarcocystis speeri DNA was detected in tissue samples Amazona aestiva of naturally infected.

This seems to be the first report of DNA detection of N. caninum, Sarcocystis spp. and S. speeri in tissue samples to these birds species extending the list of intermediate hosts. Considering there is a great diversity of domestic and wild birds, studies that investigate their infection by protozoa are very relevant, since they clarify which species are host to the protozoa.

Acknowledgements

The authors are grateful to the “Coordenação de Aperfeiçoamento de Pessoal de Nível Superior ” (CAPES), Brazil, for the financial support.

References

• Bachand N., Ravel A., Leighton P., Stephen C., Ndao M., Avard E. & Jenkins E. 2019. Serological and molecular detection of Toxoplasma gondii in terrestrial and marine wildlife harvested for food in Nunavik, Canada. Parasites Vectors 12:1-10. <https://dx.doi.org/10.1186/s13071-019-3408-9>
  » https://doi.org/10.1186/s13071-019-3408-9
• Cerqueira R. 1985. The distribution of Didelphis in South America (Polyprotodontia, Didelphidae). J. Biogeogr. 12(2):135-145. <https://dx.doi.org/10.2307/2844837>
  » https://doi.org/10.2307/2844837
• Costa K.S., Santos S.L., Uzêda R.S., Pinheiro A.M.O., Almeida M.A.O., Araújo F.R., McAllister M.M. & Gondim L.F.P. 2008. Chickens (Gallus domesticus) are natural intermediate hosts of Neospora caninum Int. J. Parasitol. 38(2):157-159. <https://dx.doi.org/10.1016/j.ijpara.2007.10.008> <PMid:18054356>
  » https://doi.org/10.1016/j.ijpara.2007.10.008
• Darwich L., Cabezón O., Echeverria I., Pabón M., Marco I., Molina-López R., Alarcia-Alejos O., López-Gatius F., Lavín S. & Almería S. 2012. Presence of Toxoplasma gondii and Neospora caninum DNA in the brain of wild birds. Vet. Parasitol. 183(3/4):377-381. <https://dx.doi.org/10.1016/j.vetpar.2011.07.024> <PMid:21831525>
  » https://doi.org/10.1016/j.vetpar.2011.07.024
• Du L., Yang D., Zhai T., Gong P., Zhang X. & Li J. 2015. Detection of Neospora caninum-DNA in brain tissues from pigeons in Changchun, Jilin (China). Vet. Parasitol. 214(1/2):171-173. <https://dx.doi.org/10.1016/j.vetpar.2015.09.005> <PMid:26385650>
  » https://doi.org/10.1016/j.vetpar.2015.09.005
• Dubey J., Calero-Bernal R., Rosenthal B., Speer C. & Fayer R. 2016. Sarcocystosis of Animals and Humans. CRC Press, Boca Raton, Flórida. 481p.
• Dubey J.P. & Jones J.L. 2008. Toxoplasma gondii infection in humans and animals in the United States. Int. J. Parasitol. 38(11):1257-1278. <https://dx.doi.org/10.1016/j.ijpara.2008.03.007> <PMid:18508057>
  » https://doi.org/10.1016/j.ijpara.2008.03.007
• Dubey J.P. & Lindsay D.S. 1999. Sarcocystis speeri n. sp. (Protozoa: Sarcocystidae) from the Opossum (Didelphis virginiana). J. Parasitol. 85(5):903-909. <https://dx.doi.org/10.2307/3285830> <PMid:10577729>
  » https://doi.org/10.2307/3285830
• Dubey J.P. 2010. Toxoplasma gondii infections in chickens (Gallus domesticus): Prevalence, clinical disease, diagnosis and public health significance. Zoonoses Publ. Health 57(1):60-73. <https://dx.doi.org/10.1111/j.1863-2378.2009.01274.x> <PMid:19744305>
  » https://doi.org/10.1111/j.1863-2378.2009.01274.x
• Dubey J.P., Murata F.H.A., Cerqueira-Cézar C.K., Kwok O.C.H. & Su C. 2021. Epidemiologic significance of Toxoplasma gondii infections in turkeys, ducks, ratites and other wild birds: 2009-2020. Parasitology 148(1):1-30. <https://dx.doi.org/10.1017/S0031182020001961> <PMid:33070787>
  » https://doi.org/10.1017/S0031182020001961
• Dubey J.P., Rosenthal B.M. & Speer CA. 2001. Sarcocystis lindsayi n. sp. (Protozoa: Sarcocystidae) from the South American opossum, Didelphis albiventris from Brazil. J. Eukaryot. Microbiol. 48(5):595-603. <https://dx.doi.org/10.1111/j.1550-7408.2001.tb00196.x> <PMid:11596925>
  » https://doi.org/10.1111/j.1550-7408.2001.tb00196.x
• Dubey J.P., Speer C.A., Bowman D.D., Horton K.M., Venturini C. & Venturini L. 2000. Experimental transmission of Sarcocystis speeri Dubey and Lindsay, 1999 from the South American Opossum (Didelphis albiventris) to the North American Opossum (Didelphis virginiana). J. Parasitol. 86(3):624-627. <https://dx.doi.org/10.1645/0022-3395(2000)086[0624:ETOSSD]2.0.CO;2> <PMid:10864267>
  » https://doi.org/10.1645/0022-3395(2000)086[0624:ETOSSD]2.0.CO;2
• Ecco R., Luppi M.M., Malta M.C.C., Araújo M.R., Guedes R.M.C. & Shivaprasad H.L. 2008. An outbreak of sarcocystosis in psittacines and a pigeon in a zoological collection in Brazil. Avian Dis. 52(4):706-710. <https://dx.doi.org/10.1637/8303-040408-Case.1> <PMid:19166069>
  » https://doi.org/10.1637/8303-040408-Case.1
• Gondim L.F.P., Soares R.M., Moré G., Jesus R.F. & Llano H.A.B. 2021. Sarcocystis neurona e Sarcocystis spp. relacionados, excretados por gambás (Didelphis spp.) na América do Sul. Revta Bras. Parasitol. Vet. 30(3):e006521. <https://dx.doi.org/10.1590/S1984-29612021059>
  » https://doi.org/10.1590/S1984-29612021059
• Gondim L.S.Q., Abe-Sandes K., Uzêda R.S., Silva M.S.A., Santos S.L., Mota R.A., Vilela S.M.O. & Gondim L.F.P. 2010. Toxoplasma gondii and Neospora caninum in sparrows (Passer domesticus) in the Northeast of Brazil. Vet. Parasitol. 168(1/2):121-124. <https://dx.doi.org/10.1016/j.vetpar.2009.09.055> <PMid:19879051>
  » https://doi.org/10.1016/j.vetpar.2009.09.055
• Homan W.L., Vercammen M., De Braekeleer J. & Verschueren H. 2000. Identification of a 200- to 300-fold repetitive 529 bp DNA fragment in Toxoplasma gondii, and its use for diagnostic and quantitative PCR. Int. J. Parasitol. 30(1):69-75. <https://dx.doi.org/10.1016/s0020-7519(99)00170-8> <PMid:10675747>
  » https://doi.org/10.1016/s0020-7519(99)00170-8
• Ibrahim H.M., Osman G.Y., Mohamed A.H., Al-Selwi A.G.M., Nishikawa Y. & Abdel-Ghaffar F. 2018. Toxoplasma gondii: Prevalence of natural infection in pigeons and ducks from middle and upper Egypt using serological, histopathological, and immunohistochemical diagnostic methods. Vet. Parasitol. Reg. Stud. Reports 13:45-49. <https://dx.doi.org/10.1016/j.vprsr.2018.04.002> <PMid:31014887>
  » https://doi.org/10.1016/j.vprsr.2018.04.002
• Konradt G., Bianchi M.V., Leite-Filho R.V., Silva B.Z., Soares R.M., Pavarini S.P. & Driemeier D. 2017. Necrotizing meningoencephalitis caused by Sarcocystis falcatula in bare-faced ibis (Phimosus infuscatus). Parasitol. Res. 116:809-812. <https://dx.doi.org/10.1007/s00436-016-5341-6> <PMid:27915419>
  » https://doi.org/10.1007/s00436-016-5341-6
• Lemos B. & Cerqueira R. 2002. Morphological differentiation in the white-eared opossum group (Didelphidae: Didelphis). J. Mammal 83(2):354-369. <https://dx.doi.org/10.1644/1545-1542(2002)083<0354:MDITWE>2.0.CO;2>
  » https://doi.org/10.1644/1545-1542(2002)083<0354:MDITWE>2.0.CO;2
• Lukášová R., Kobédová K., Halajian A., Bártová E., Murat J.B., Rampedi K.M. & Luus-Powell W.J. 2018. Molecular detection of Toxoplasma gondii and Neospora caninum in birds from South Africa. Acta Trop. 178:93-96. <https://dx.doi.org/10.1016/j.actatropica.2017.10.029> <PMid:29092798>
  » https://doi.org/10.1016/j.actatropica.2017.10.029
• Moré G., Abrahamovich P., Jurado S., Bacigalupe D., Marin J.C., Rambeaud M., Venturini L. & Venturini M.C. 2011. Prevalence of Sarcocystis spp. in Argentinean cattle. Vet. Parasitol. 177(1/2):162-165. <https://dx.doi.org/10.1016/j.vetpar.2010.11.036> <PMid:21168276>
  » https://doi.org/10.1016/j.vetpar.2010.11.036
• Nardoni S., Rocchigiani G., Varvaro I., Altomonte I., Ceccherelli R. & Mancianti F. 2019. Serological and molecular investigation on Toxoplasma gondii infection in wild birds. Pathogens 8(2):58. <https://dx.doi.org/10.3390/pathogens8020058> <PMid:31035730>
  » https://doi.org/10.3390/pathogens8020058
• Nazir M.M., Ayaz M.M., Ahmed A.N., Maqbool A., Ashraf K., Oneeb M., Yasin G., Subhani A., Ali M.A., Nazir N. & Sajid M.A. 2018. Prevalence of Toxoplasma gondii, Neospora caninum, and Sarcocystis species DNA in the heart and breast muscles of Rock pigeons (Columbia livia). J. Parasitol. Res. 2018:1-4 <https://dx.doi.org/10.1155/2018/6264042> <PMid:29854422>
  » https://doi.org/10.1155/2018/6264042
• Prakas P. & Butkauskas D. 2012. Protozoan parasites from genus Sarcocystis and their investigations in Lithuania. Ekologija, Liet. Moksl. Akad. 58(1):45-58. <https://dx.doi.org/10.6001/ekologija.v58i1.2349>
  » https://doi.org/10.6001/ekologija.v58i1.2349
• Salant H., Mazuz M.L., Savitsky I., Nasereddin A., Blinder E. & Baneth G. 2015. Neospora caninum in crows from Israel. Vet. Parasitol. 212(3/4):375-378. <https://dx.doi.org/10.1016/j.vetpar.2015.08.019> <PMid:26359640>
  » https://doi.org/10.1016/j.vetpar.2015.08.019
• Sato A.P., Vaz F.F., Konell A.L., Koch M.O., Ferreira R.F., Sipinski E.A.B. & Dittrich R.L. 2020. Survey of Toxoplasma gondii, Neospora caninum and Sarcocystis neurona antibodies in wildred-tailed Amazon parrots (Amazona brasiliensis). Rev. Bras. Parasitol. Vet. 29(1): e017519. <https://dx.doi.org/10.1590/s1984-29612019107> <PMid:32049146>
  » https://doi.org/10.1590/s1984-29612019107
• Sick H. 1997. Ornitologia Brasileira. Edição revista e ampliada por José Fernando Pacheco. Nova Fronteira, Rio de Janeiro. 862p.
• Valadas S.Y.O.B., Soares R.M. & Lindsay D.S. 2016. Revisão sobre Sarcocystis spp. excretados por gambás (Didelphis spp.) no Brasil. Brazilian J. Vet. Res. Anim. Sci. 53(3):214-226. <https://dx.doi.org/10.11606/issn.1678-4456.v53i3p214-226>
  » https://doi.org/10.11606/issn.1678-4456.v53i3p214-226
• Yamage M., Flechtner O. & Gottstein B. 1996. Neospora caninum: specific oligonucleotide primers for the detection of brain ‘‘cyst’’ DNA of experimentally infected nude mice by the polymerase chain reaction (PCR). J. Parasitol. 82(2):272-279. <PMid:8604096>
• Yang Z.Q., Zuo Y.X., Yao Y.G., Chen X.W., Yang G.C. & Zhang Y.P. 2001. Analysis of the 18S rRNA genes of Sarcocystis species suggests that the morphologically similar organisms from cattle and water buffalo should be considered the same species. Mol. Biochem. Parasitol. 115(2):283-288. <https://dx.doi.org/10.1016/s0166-6851(01)00283-3> <PMid:11420115>
  » https://doi.org/10.1016/s0166-6851(01)00283-3

• ⁴
  Available at <http://www.ncbi.nlm.nih.gov/BLAST> Accessed on Apr. 6, 2020.
• ⁵
  Available at <http://www.ncbi.nlm.nih.gov/blast/> Accessed on Aug. 20, 2020.

Publication Dates

• Publication in this collection
  01 June 2022
• Date of issue
  2022

History

• Received
  13 Apr 2022
• Accepted
  28 Apr 2022