Services on Demand
Article
Indicators
Related links
Bookmark
Brazilian Journal of Medical and Biological Research
On-line version ISSN 1414-431X
Braz J Med Biol Res vol. 32 n. 1 Ribeirão Preto Jan. 1999
http://dx.doi.org/10.1590/S0100-879X1999000100006
Braz J Med Biol Res, January 1999, Volume 32(1) 45-49 (Short Communication)
A polymerase chain reaction-based assay to identify genotype F of hepatitis B virus
M.T.B. Moraes, C. Niel and S.A. Gomes
Departamento de Virologia, Instituto Oswaldo Cruz, FIOCRUZ, Rio de Janeiro, RJ, Brasil

Text
References
Acknowledgments
Correspondence and Footnotes
We have developed a polymerase chain reaction (PCR) assay which distinguishes genotype F from the other genotypes of hepatitis B virus (HBV). The method was used to characterize HBV strains isolated in urban areas of the Brazilian Amazon. DNA was amplified in 54 of a total of 78 HBsAg-positive serum samples, using universal, non-genotype-specific primers. Only 4 (7.4%) were identified as genotype F by our genotype-specific PCR assay. This proportion is notably lower than that previously reported in Argentina, Venezuela, Peru, and Central America.
Key words: hepatitis B virus, genotype F, subtype adw4, polymerase chain reaction, Brazil
Hepatitis B virus (HBV) is one of the most important agents of human liver disease, including acute and chronic hepatitis, cirrhosis, and hepatocellular carcinoma. HBV isolates have been classified into 9 serotypes, ayw1, ayw2, ayw3, ayw4, ayr, adw2, adw4, adrq+, and adrq-, according to the antigenic determinants and subdeterminants of their surface antigen (HBsAg) (1). In all serotypes, the common "a" antigenic determinant is located within domains bordered by amino acids 120 to 147 of HBsAg. The expression of d/y and w/r determinants has been localized at residues 122 and 160, respectively. A shift from Lys to Arg at these sites is responsible for subtype changes (2). More recently, HBV has been divided into six genotypes, A to F, by comparison of complete nucleotide sequences (3). HBV serotypes and genotypes are not uniformly distributed around the world. Genotype A is commonly found in Europe, USA, and sub-Saharan Africa. Genotypes B and C seem to be confined to original populations of the Far East, genotype D is the most widespread, and genotype E has only been found in Africa. In South America, a large diversity of HBV strains has been demonstrated (4), more frequently of genotypes A, B, D, and F (5,6) and more rarely of genotype C (7).
Genotype F, which contains all adw4 isolates identified, possesses two unique characteristics. First, it is the most diverging branch of the HBV phylogenetic tree, with a divergence of 15% compared to 8-11% among the other genotypes (8). Second, it has been detected in aboriginal populations of the Americas, suggesting an origin in the New World (8,9).
A simple and efficient genotyping method, as described for hepatitis C virus (10), would greatly facilitate molecular epidemiology studies of HBV. We developed a polymerase chain reaction (PCR) assay which distinguished HBV strains of genotype F from the others, and used it to characterize HBV strains from the Brazilian Amazon Basin.
A panel of ten HBV strains of known subtype and genotype was used to develop a PCR assay for specific detection of genotype F isolates. Strains adw2 (BrA and BrL; genotype A), adw4 (BrC and 7-1991; F), ayw2 (BrF and BrN; D), and ayw3 (BrI and BrJ; D) have been previously characterized (5,11). They represent the four subtypes and three genotypes most commonly found in Brazil. Two adr strains (genotype C) from Japan were included in the panel because this subtype has been shown to infect South American populations of Asian origin (7). Seventy-eight HBsAg-positive samples collected in the cities of Manaus, State of Amazonas, and Macapá, State of Amapá (Brazilian Amazon region), were studied to determine the frequency of genotype F.
Two hundred microliters of serum were treated with 0.5 mg/ml of proteinase K in the presence of 0.2 M NaCl, 0.25% SDS, for 4 h at 37oC. HBV DNA was then extracted with phenol/chloroform and precipitated with ethanol (12). The pellet was dried and resuspended in 30 µl distilled water. PCR assays were done with 1 µl of DNA in a volume of 50 µl.
Oligonucleotides PS1 and PS2 (4) were used as generic primers to amplify DNAs of all HBV strains, since their sequence seems to be well conserved in strains from around the world. Primers PS42 (5' ACACACATCCACAGGCAATGCAG 3') and S22 (5' GTATTTAAATGGATACCCACAGA 3'), localized at genome positions 3194-3216 and 841-819, respectively, were used for the amplification of sequences from genotype F. PCRs were done in 0.2-ml tubes placed in a Perkin-Elmer 2400 thermocycler. After an initial denaturation of 2 min at 94oC, DNA was amplified for 35 cycles at 94oC for 30 s, variable annealing temperature (see below) for 1 min, and 72oC for 2 min, followed by a final elongation of 7 min at 72oC. Ten microliters of amplification products were electrophoresed on 2.0% agarose gel and stained with ethidium bromide.
For molecular cloning, DNA from the pre-S/S region was amplified using PS1 and S2 (5' GGGTTTAAATGTATACCCAAAGA 3', nt 841 to 819) oligonucleotides (PS1-S22 for strains belonging to genotype F). PCR products were quantified by ethidium bromide staining using DNA standards as controls, and 5-10 ng were ligated into a 50-ng pCRII vector (TA cloning kit; Invitrogen, San Diego, CA). Recombinant plasmid DNA was purified for sequencing by ultracentrifugation in a CsCl gradient. Nucleotide sequences were determined with a Cy5 autoread sequencing system (Pharmacia Biotech, Uppsala, Sweden) using M13 universal and internal S4 (5) primers. Sequencing reactions were analyzed on an ALFexpress automated sequencer (Pharmacia).
Two series of PCR experiments were carried out in parallel with the PS42-S22 primer pair and with the universal, non-genotype-specific PS1-PS2 primer pair. In the first experiments, when the annealing temperature for PCR was 55oC, all 10 strains yielded visible bands in agarose gel after amplification with primers PS1-PS2 (Figure 1A, lanes 1 to 10), whereas seven strains yielded visible bands with primers PS42-S22 (lanes 11 to 20). To increase PCR specificity, the annealing temperature was elevated in a stepwise way two degrees at a time. At 61oC, all strains continued to give a positive result with PS1-PS2 universal primers, while only the two adw4 isolates were amplified with PS42-S22 primers (Figure 1B). In addition, we noted that the size of the PS1-PS2 amplification products from ayw strains was slightly lower than that from ad isolates (compare lanes 1-6 to lanes 7-10 in Figure 1A and B). This was probably due to a 33-nucleotide deletion at the 5' end of the pre-S1 region of ayw strains.
[View larger version of this image (44 K GIF file)]
DNAs of 78 HBsAg-positive samples originating from the Brazilian Amazon region were extracted and submitted to PCR (annealing temperature 55oC). Fifty-four of them were successfully amplified by PS1-PS2 primers. Decreasing annealing temperature to 50oC had no effect on the number of PCR-positive samples. Of these, 37 (69%) showed a DNA band of a size compatible with the ad profile, whereas 17 (31%) seemed to be ay. Using the PCR assay described above, DNAs from only four (7.4%) strains were amplified by using genotype F (adw4) specific primers. This proportion was much lower than that reported in other studies performed with samples from the Amazon region (13,14). This suggested that the DNAs of some adw4 strains were not amplified in the genotype-specific PCR assay (false negative samples). To rule out this hypothesis, 10 strains presumed not to be adw4 (five ad and five ay) were selected and serotyped by nucleotide sequencing of the S gene region (codons 111 to 170). The same was done for three presumed adw4 strains. Amino acid sequences were then deduced and are shown in Figure 2. Sequencing results corroborated the serotype of the adw4 strains. Also, the identities of the five ad (not adw4) and five ay strains were confirmed. These ten last strains possessed the w2 subdeterminant. As is common in Brazil when a small number of samples is analyzed, no strain presented the r determinant. The sequence variations observed among HBV isolates from the Brazilian Amazon were not different from those previously detected in the city of Rio de Janeiro (5).
|
Figure 2 - Amino acid sequences deduced from partial nucleotide sequence of S genes of 13 HBV strains from the Amazon region. Asterisks indicate the positions of the antigenic determinants and subdeterminants. The HBsAg subtype of the strains was deduced from the substitutions of codons 122 and 160, which determine d/y and w/r, respectively. Antigenic subdeterminant w4 is defined by a Leu at codon 127 (9). Note that all strains other than adw4 possess a Pro defining the subdeterminant w2 at position 127. |
[View larger version of this image (21 K GIF file)]
Molecular epidemiology studies of HBV would be facilitated by simple and fast serotyping or genotyping methods. Although HBV serotyping into nine different serotypes was developed over twenty years ago, it has never been implemented as a routine diagnostic method due to the lack of reagents and requirement for expertise in techniques such as immunodiffusion and immunoelectroosmophoresis (9). On the other hand, PCR has been extensively used in the study of hepatitis viruses, notably for rapid diagnosis, antiviral studies, and pathogenesis. In the last few years, assays have been developed to differentiate HBV subtypes by PCR using specific primers (15-17). Genotyping has been devised based on restriction fragment length polymorphism analysis of amplicons (18). Due to the importance of genotype F in the New World, a method capable of discriminating it should be useful for HBV molecular epidemiology studies in the Americas. Recently, it was shown that the presence of a SmaI restriction site could be used to recognize sequences from genotype F (19). Our method presents the advantage that is very simple and fast. It does not need nested PCR or restriction endonuclease digestion. All the adw4 strains belong to genotype F. Reciprocally, the large majority of strains from genotype F has been subtyped as adw4, although non-conventional genotype-subtype associations, namely adw2 and ayw4 within genotype F, have been recently described (13).
In Central America (20) and Venezuela (13), 75-80% of the HBV strains studied were genotype F. In the Peruvian Amazon Basin, an outbreak of acute hepatitis was provoked by a genotype F HBV (19). In Buenos Aires, Argentina, 5 of 12 (42%) sequenced HBV samples were genotype F (6). Data obtained by serotyping samples collected from 1980 to 1983 showed that serotype adw4 represented about 40% of HBV in the Northern region of Brazil (Amazon region) (14). The proportion of adw4 reported here was notably lower (7.4%). This difference may be a consequence of the use of some monoclonal antibodies that resulted in an overestimation of the percent of adw4 in previous studies. Indeed, we have found that some strains previously characterized as adw4 by monoclonal antibodies were identified adw2 or ayw3 by nucleotide sequencing (data not shown). In the other regions of Brazil, the proportion of adw4 strains has been reported to vary from 4 to 8%. Our results suggest that the epidemiological pattern of the urban areas of the Brazilian Amazon region is similar to that of other parts of Brazil, probably due to internal migration from other regions.
1. Couroucé-Pauty AM, Lemaire JM & Roux JF (1978). New hepatitis B surface antigen subtypes inside the ad category. Vox sanguinis, 35: 304-308. [ Links ]
2. Okamoto H, Imai M, Tsuda F, Tanaka T, Miyakawa Y & Mayumi M (1987). Point mutation in the S gene of hepatitis B virus for a d/y or w/r subtypic change in two blood donors carrying a surface antigen of compound subtype adyr or adwr. Journal of Virology, 61: 3030-3034. [ Links ]
3. Norder H, Hammas B, Löfdahl S, Couroucé AM & Magnius LO (1992). Comparison of the amino acid sequences of nine different serotypes of hepatitis B surface antigen and genomic classification of the corresponding hepatitis B virus strains. Journal of General Virology, 73: 1201-1208. [ Links ]
4. Niel C, Moraes MTB, Gaspar AMC, Yoshida CFT & Gomes SA (1994). Genetic diversity of hepatitis B virus strains isolated in Rio de Janeiro, Brazil. Journal of Medical Virology, 44: 180-186. [ Links ]
5. Moraes MTB, Gomes SA & Niel C (1996). Sequence analysis of hepatitis B virus strains of genotypes A, D, and F isolated in Brazil. Archives of Virology, 14: 1767-1773. [ Links ]
6. Telenta PFS, Palagios Poggio G, López JL, Gonzalez J, Lemberg A & Campos RH (1997). Increased prevalence of genotype F hepatitis B virus isolates in Buenos Aires, Argentina. Journal of Clinical Microbiology, 35: 1873-1875. [ Links ]
7. Yoshida CFT, Gaspar AMC, Marzochi KBF & Schatzmayr HG (1979). HBsAg subtypes and HBsAb in white and asiatic populations from urban and rural communities in the South of Brazil. Review of Microbiology, 10: 106-110. [ Links ]
8. Naumann H, Schaefer S, Yoshida CFT, Gaspar AMC, Repp R & Gerlich WH (1993). Identification of a new hepatitis B virus (HBV) genotype from Brazil that expresses antigen subtype adw4. Journal of General Virology, 74: 1627-1632. [ Links ]
9. Magnius LO & Norder H (1995). Subtypes, genotypes and molecular epidemiology of the hepatitis B virus as reflected by sequence variability of the S-gene. Intervirology, 38: 24-34. [ Links ]
10. Lau JY, Mizokami M, Kolberg JA, Davis GL, Prescott LE, Ohno T, Perrillo RP, Lindsay KL, Gish RG, Qian K-P, Kohara M, Simmonds P & Urdea MS (1995). Application of six hepatitis C virus genotyping systems to sera from chronic hepatitis C patients in the United States. Journal of Infectious Diseases, 171: 281-289. [ Links ]
11. Santos E, Niel C, Vianna CAO, Moraes de Sá CA & Gomes SA (1998). Genomic variations of hepatitis B virus strains in patients chronically coinfected with hepatitis B and human immunodeficiency viruses. Acta Virologica, 42: 25-31. [ Links ]
12. Sambrook J, Fritsch EF & Maniatis T (1989). Molecular Cloning. 2nd edn. Cold Spring Harbor Laboratory Press, New York, NY. [ Links ]
13. Blitz L, Pujol FH, Swenson PD, Porto L, Atencio R, Araujo M, Costa L, Monsalve DC, Torres JR, Fields HA, Lambert S, Van Geyt C, Norder H, Magnius LO, Echevarria JM & Stuyver L (1998). Antigenic diversity of hepatitis B virus strains of genotype F in Amerindians and other population groups from Venezuela. Journal of Clinical Microbiology, 36: 648-651. [ Links ]
14. Gaspar AMC & Yoshida CFT (1987). Geographic distribution of HBsAg subtypes in Brazil. Memórias do Instituto Oswaldo Cruz, 82: 253-258. [ Links ]
15. Echevarria JE, Tenorio A, Couroucé AM, León P & Echevarria JM (1994). Polymerase chain reaction can resolve some undefined cases of hepatitis B virus antigenic subtyping. Journal of Medical Virology, 42: 217-223. [ Links ]
16. Norder H, Hammas B & Magnius LO (1990). Typing of hepatitis B virus genomes by a simplified polymerase chain reaction. Journal of Medical Virology, 31: 215-221. [ Links ]
17. Repp R, Rhiel S, Heermann KH, Schaefer S, Keller C, Ndumbe P, Lampert F & Gerlich WH (1993). Genotyping by multiplex polymerase chain reaction for detection of endemic hepatitis B virus transmission. Journal of Clinical Microbiology, 31: 1095-1102. [ Links ]
18. Lindh M, Andersson AS & Gusdal A (1997). Genotypes, nt 1858 variants, and geographic origin of hepatitis B virus - Large-scale analysis using a new genotyping method. Journal of Infectious Diseases, 175: 1285-1293. [ Links ]
19. Casey JL, Niro GA, Engle RE, Vega A, Gomez H, McCarthy M, Watts DM, Hyams KC & Gerin JL (1996). Hepatitis B virus (HBV)/Hepatitis D virus (HDV) coinfection in outbreaks of acute hepatitis in the Peruvian Amazon Basin: The roles of HDV genotype III and HBV genotype F. Journal of Infectious Diseases, 174: 920-926. [ Links ]
20. Arauz-Ruiz P, Norder H, Visoná KA & Magnius LO (1997). Genotype F prevails in HBV infected patients of hispanic origin in Central America and may carry the precore stop mutant. Journal of Medical Virology, 51: 305-312. [ Links ]
The authors are grateful to Drs. A.M.C. Gaspar and C.F.T. Yoshida for the gift of serum samples.
Address for correspondence: S.A. Gomes, Departamento de Virologia, Instituto Oswaldo Cruz, FIOCRUZ, Av. Brasil, 4365, 21045-900 Rio de Janeiro, RJ, Brasil. Fax: +55-21-270-6397. E-mail: sagomes@gene.dbbm.fiocruz.br
Research supported by CNPq and FAPERJ. Received May 6, 1998. Accepted October 22, 1998.











Curriculum ScienTI
uBio 

