Serviços Personalizados
Artigo
Indicadores
Links relacionados
Bookmark
Brazilian Journal of Medical and Biological Research
versão On-line ISSN 1414-431X
Braz J Med Biol Res v.35 n.9 Ribeirão Preto set. 2002
http://dx.doi.org/10.1590/S0100-879X2002000900006
Braz J Med Biol Res, September 2002, Volume 35(9) 1061-1068
Gender differences in vascular expression of endothelin and ETA/ETB receptors, but not in calcium handling mechanisms, in deoxycorticosterone acetate-salt hypertension
F.L. David1,3, A.C.I. Montezano1, N.A. Rebouças2, D. Nigro1, Z.B. Fortes1, M.H.C. Carvalho1 and R.C.A. Tostes1
Departamentos de 1Farmacologia, and 2Fisiologia, Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo, SP, Brasil
3Departamento de Ciências Biológicas e da Saúde, Universidade Federal de Mato Grosso, Pontal do Araguaia, MT, Brasil
Abstract
Introduction
Material and Methods
Results
Discussion
References
Acknowledgments
Correspondence and Footnotes
We determined if the increased vascular responsiveness to endothelin-1 (ET-1) observed in male, but not in female, DOCA-salt rats is associated with differential vascular mRNA expression of ET-1 and/or ETA/ETB receptors or with functional differences in Ca2+ handling mechanisms by vascular myocytes. Uninephrectomized male and female Wistar rats received DOCA and drinking water containing NaCl/KCl. Control rats received vehicle and tap water. Blood pressure and contractile responses of endothelium-denuded aortic rings to agents which induce Ca2+ influx and/or its release from internal stores were measured using standard procedures. Expression of mRNA for ET-1 and ETA/ETB receptors was evaluated by RT-PCR after isolation of total cell RNA from both aorta and mesenteric arteries. Systolic blood pressure was higher in male than in female DOCA rats. Contractions induced by Bay K8644 (which activates Ca2+ influx through voltage-operated L-type channels), and by caffeine, serotonin or ET-1 in Ca2+-free buffer (which reflect Ca2+ release from internal stores) were significantly increased in aortas from male and female DOCA-salt compared to control aortas. DOCA-salt treatment of male, but not female, rats statistically increased vascular mRNA expression of ET-1 and ETB receptors, but decreased the expression of ETA receptors. Molecular up-regulation of vascular ETB receptors, rather than differential changes in smooth muscle Ca2+ handling mechanisms, seems to account for the increased vascular reactivity to ET-1/ETB receptor agonists and higher blood pressure levels observed in male DOCA-salt rats.
Key words: DOCA-salt hypertension, Endothelin-1, Gender, Endothelin receptors, Calcium, Rats
Endothelin-1 (ET-1) is a potent vasoconstrictor peptide produced by endothelial and vascular smooth muscle cells and its effects are mediated by activation of ETA and ETB receptor subtypes. In the vascular system, ETA receptors are expressed in smooth muscle cells whereas ETB receptors are expressed predominantly in endothelial cells and, to a much lesser extent, in smooth muscle cells (1,2). Both ETA and ETB receptor subtypes can activate various signaling mechanisms in vascular smooth muscle, including i) G protein-mediated activation of phospholipase C, leading to phosphatidylinositol hydrolysis and formation of inositol trisphosphate (IP3) and diacylglycerol, ii) increase in cytosolic free Ca2+ concentration ([Ca2+]i), iii) activation of protein kinase C, and iv) changes in intracellular pH via stimulation of the Na+-H+ exchanger (2,3). ET-1 typically mediates a biphasic [Ca2+]i response consisting of a rapid initial transient phase and a sustained plateau phase. The first [Ca2+]i transient is generated primarily by IP3-induced mobilization of intracellular Ca2+ and, to a lesser extent, by Ca2+-induced Ca2+ release. The second [Ca2+]i phase, which appears to contribute to the sustained ET-1-induced vasoconstriction, depends on external Ca2+ and is the result of transmembrane Ca2+ influx, mainly through voltage-dependent L-type Ca2+ channels (VOC), which may be directly or indirectly activated by ET-1 (3-5).
We have recently shown that male, but not female, deoxycorticosterone acetate (DOCA)-salt rats exhibit increased vascular responsiveness to ET-1 and IRL-1620, a selective ETB receptor agonist, and we speculated that upregulation of ETB receptors or changes in the signaling pathways could be involved in this response (6). Since male DOCA-salt rats exhibit increased vascular ET-1 expression (7,8), changes in the ratio of ETA/ETB receptors (9,10) and altered Ca2+ control mechanisms, such as increased transmembrane flux of Ca2+ and greater Ca2+ mobilization from internal stores (11,12), in the present study we determined if increased vasoconstriction in response to ET-1/IRL-1620 in male, but not female, DOCA-salt rats is associated with differential vascular expression of mRNA for ET-1 and ETA/ETB receptors or with functional differences in Ca2+ handling mechanisms by vascular myocytes.
DOCA-salt-induced hypertension and vascular reactivity in isolated vessels
DOCA-salt hypertension was induced in male and female 8-week-old Wistar rats as previously described (6). Systolic blood pressure (SBP) was measured by the standard tail-cuff method (PowerLab 4/S, ADInstruments Pty Ltd., Castle Hill, Australia) in conscious restrained rats. Endothelium-denuded aortas from control and DOCA-salt rats were used to evaluate vascular reactivity to caffeine (5-30 mM), which releases Ca2+ from intracellular stores by an IP3-independent mechanism (13) and to Bay K8644 (10-10 to 3 x 10-5 M), which activates Ca2+ influx through VOC (14). Functional assessment of Ca2+ uptake into the sarcoplasmic reticulum (SR) and caffeine- or agonist-induced intracellular Ca2+ mobilization were also evaluated as described elsewhere (12). Briefly, the arteries were stimulated with norepinephrine (3 µM) and allowed to reach a plateau. Ca2+-free buffer was then introduced into the muscle bath for 15 min. After this depletion period, 1.6 mM Ca2+ buffer was placed in the muscle bath for 15 min (loading period). Ca2+-free buffer was then reintroduced into the bath and allowed to equilibrate for 1 min before 20 mM caffeine was added. Transient contractions in Ca2+-free buffer upon agonist stimulation, an indirect measurement of IP3-dependent Ca2+ release from the SR, were also elicited by both ET-1 (10 nM) and serotonin (5-HT, 3 µM). The experimental protocols used in the present study followed the standards and policies of the Committee on Animal Care and Use of the University of São Paulo.
Reverse transcriptase-polymerase chain reaction
Total cell RNA was isolated from aorta and mesenteric arteries using Trizol Reagent (Gibco BRL, Life Technologies, Rockville, MD, USA). After DNA digestion (RQ1 DNAse RNAse-free, Promega Corporation, Madison, WI, USA), total RNA (20 ng per sample) was used for reverse transcriptase (RT) in the presence of an RNase inhibitor (RnasIn®, Promega Corporation), 200 U of Moloney murine leukemia virus RT (Gibco BRL) and 1 µg of oligo (dT)12-18 primer at 37ºC for 60 min, according to manufacturer specifications. The cDNA products were isolated by phenol-chloroform extraction, precipitated with ethanol, resuspended in 120 µl TE (10 mM Tris-HCl and 1 mM EDTA, pH 7.5) and stored at -20ºC until required for the polymerase chain reaction (PCR). PCR primers were designed on the basis of published rat cDNA sequences for glyceraldehyde 3-phosphate dehydrogenase (GAPDH), ET-1, and ETA/ETB receptors, and are as follows: ET-1, antisense primer CTCGCTCTATGTAAGTCATGG, sense primer GCTCCTGCTCCTCCTTGATG, which should amplify a 471-bp fragment; ETA, antisense primer CTGTGCTGCTCGCCCTTGTA, sense primer GAAGTCGTCCGTGGGCATCA (216-bp fragment); ETB, antisense primer CACGATGAGGACAATGAGAT, sense primer TTACAAGACAGCCAAAGACT (565-bp fragment); GAPDH, anti-sense primer CACCACCCTGTTGCTGTA, sense primer TATGATGACATCAAGAAGGTGG (219-bp fragment). GAPDH was used as an internal control for the co-amplification. In order to identify the optimal amplification conditions, a series of pilot studies were performed using a thermal cycler with a temperature gradient in the annealing step (Eppendorf Mastercycler gradient, Eppendorf-Netheler-Hinz, Hamburg, Germany), various amounts of RT products from 2 to 200 ng RNA, and 20-35 cycles of PCR amplification. The following conditions were selected for PCR in a volume of 50 µl: RT products from 20 ng of RNA, 2.5 U Taq polymerase (Gibco BRL), 28 cycles of amplification for ET-1, 25 cycles for ETA and ETB receptor genes, and 20 cycles for the GAPDH gene. Amplification was carried out using an initial denaturing cycle at 94ºC for 5 min and the subsequent cycles as follows: denaturation, 30 s at 94ºC; annealing, 30 s at 55ºC (ET-1, ETB) or 60ºC (ETA, GAPDH), and extension, 45 s at 72ºC. PCR products (10 µl per lane) were electrophoresed using 1% agarose gel containing ethidium bromide (0.5 µg/ml). The gel was subjected to ultraviolet light and photographed. The band intensities were measured using a software package (Kodak Digital Science, Eastman Kodak Company, New Haven, CT, USA) and the signals are reported relative to the intensity of GAPDH amplification in each co-amplified sample.
Drugs
DOCA, chloral hydrate, 5-hydroxytryptamine (serotonin), and caffeine were purchased from Sigma (St. Louis, MO, USA), and Bay K8644 was from Calbiochem Corporation (La Jolla, CA, USA).
Data analysis and statistical evaluation
Values are reported as means ± SEM. EC50 (i.e., the concentration of agonist producing 50% of maximal contraction) and maximal responses were estimated by linear regression analysis (fitted to the Hill equation) from log concentration-response curves and expressed as -log EC50 (pD2 values), and percent of maximal response, respectively. Data were analyzed statistically by two-way ANOVA followed by the multiple comparison Bonferroni test (SigmaStat®, version 2.0, Jandel Scientific Software), with the level of significance set at P<0.05.
At 6 weeks of DOCA-salt treatment, systolic blood pressure was significantly elevated in both male and female rats relative to their respective time-matched controls (males 192 ± 6 vs 121 ± 4 mmHg, N = 18-20; females 165 ± 8 vs 119 ± 3 mmHg, N = 16). Systolic blood pressure was higher in male than in female DOCA-salt-treated rats.
Gender differences in Ca2+ handling mechanisms
After the equilibration period, vessels were initially contracted with 90 mM KCl. Responses of aortic rings to 90 mM KCl were similar in control (males 2.6 ± 0.4 g vs females 2.8 ± 0.3 g, N = 8) and DOCA-salt rats (males 2.9 ± 0.4 g vs females 2.7 ± 0.5 g, N = 8). Figure 1 illustrates the vascular responses to Bay K8644 and caffeine. Aortas from both male and female DOCA-salt rats showed significantly greater contractions to Bay K8644 than control aortas (P<0.05). Maximum responses, expressed as percentages of KCl-induced contraction, were: control, males 31 ± 6% vs females 25 ± 5% (N = 8) and DOCA-salt, males 100 ± 9% vs females 97 ± 6% (N = 9 and 8, respectively). Caffeine-induced contractions were also similarly enhanced in aortas from male and female DOCA-salt rats in comparison to their respective controls (P<0.05; maximum responses: control, males 38 ± 3% vs females 32 ± 2%, N =10; DOCA-salt, males 63 ± 5% vs females 53 ± 4%, N = 9 and 10, respectively).
Figure 2 illustrates typical records of functional experiments performed to evaluate vascular Ca2+ uptake and its release from intracellular SR stores induced by both a caffeine/IP3-independent pathway and by an agonist/IP3-dependent pathway. After initial stimulation with norepinephrine (3 µM), vessels were washed in Ca2+-free buffer for 15 min in order to deplete intracellular Ca2+ stores. Vessels were subsequently exposed to Ca2+-containing buffer for 15 min to reload intracellular Ca2+ stores and then stimulated with ET-1 (10 nM), 5-HT (3 µM) or caffeine (20 mM) after a 1-min exposure to Ca2+-free buffer. Under these conditions, agonist-induced contraction is an indirect measurement of the buffering capacity of the SR and also reflects agonist-induced intracellular Ca2+ mobilization. Arteries from male DOCA-salt rats exhibited spontaneous contractions during the loading period (6.4 ± 2.4% change from basal tonus), which were not observed in control arteries. Aortas from male DOCA-salt rats also exhibited greater contractions in response to ET-1 in comparison to control arteries (51 ± 4 vs 9 ± 3%, N = 11 and 10; P<0.05). Similar alterations were observed in aortas from female DOCA-salt rats, which displayed a 7.6 ± 3.5% change in basal tonus and greater contractions to ET-1 in comparison to their respective controls (40 ± 4 vs 8 ± 3%, N = 8; P<0.05). Likewise, preparations from both male and female DOCA-salt-treated rats displayed greater contractions to both 5-HT and caffeine when compared to those from their respective time-matched control groups (5-HT: males 34 ± 4 vs 19 ± 3%, females 39 ± 3 vs 18 ± 3%, N = 10-11; caffeine: males 31 ± 5 vs 11 ± 2%, females 32 ± 5 vs 12 ± 3%, N = 6-8; P<0.05 for each comparison).
[View larger version of this image (35 K GIF file)]
[View larger version of this image (24 K GIF file)]
Gender differences in ET-1 and ETA/ETB receptor mRNA expression
The results obtained by RT-PCR showing expression of mRNA for ET-1, ETA and ETB receptors in aortas and mesenteric arteries from male and female control and DOCA-salt rats are shown in Figure 3. DOCA-salt treatment significantly increased ET-1 mRNA expression both in the aorta and mesenteric arteries from male rats, while no significant changes were observed in the same vessels from female rats. A tendency to decreased ETA receptor mRNA expression was observed in the aorta and in the mesenteric artery in the male DOCA-salt group (P = 0.052 and P = 0.06, respectively), while no changes were observed in the female DOCA-salt group. A significant increase in the mRNA expression of the ETB receptor subtype was observed in both arteries from male DOCA-salt rats, but not in female DOCA-salt vessels.
[View larger version of this image (45 K GIF file)]
We have demonstrated that male DOCA-salt rats display increased vascular sensitivity to ET-1 and to IRL-1620, an ETB receptor agonist which induces contraction in aortas from male DOCA-salt rats, but not in preparations from control or female DOCA-salt animals (6). These gender-related differences in ET-1/IRL-1620 vascular reactivity were also observed in the mesenteric microcirculation in vivo, where IRL-1620 induces vasodilatation in control rats, vasoconstriction in male DOCA-salt rats, and minimal changes in vessel diameter in female hypertensive rats (6). In the current study we investigated whether the increased ET-1/ETB receptor-mediated vascular responses observed in male, but not in female, DOCA-salt rats are associated with gender differences in the vascular mRNA expression of ET-1 and ETA/ETB receptors and/or with functional differences in Ca2+ handling mechanisms by vascular myocytes. The rationale was based on the observations that i) changes in both receptor function or intracellular Ca2+ regulation are implicated in altered vascular reactivity in hypertension; ii) a defect in intracellular Ca2+ regulation, characterized by increased basal tone, increased L-type Ca2+ channel activity and altered mobilization of Ca2+ from intracellular stores, has been extensively described in the vasculature of male DOCA-salt hypertensive rats (11,12,15); iii) ET-1 has been shown to exert a wide range of effects on some of these defective mechanisms, activating Ca2+ influx mainly through VOC and also stimulating IP3-dependent and (to a lesser extent) IP3-independent Ca2+ release from intracellular stores (3-5); iv) changes in the ratio of ETA/ETB receptors have also been described in tissues from male DOCA-salt rats (9,10).
Our results show that arteries from female DOCA-salt rats display changes in Ca2+ handling mechanisms similar to those observed in arteries from male DOCA-salt rats: i) increased contractile responses to Bay K8644, ii) greater contractions to caffeine, iii) contractile activity during the Ca2+ loading period, and iv) increased caffeine- or agonist-induced contractions in Ca2+-free buffer. These results suggest, therefore, that the increased vascular sensitivity to ET-1/IRL-1620 observed in male DOCA-salt hypertensive rats is not related to gender differences in Ca2+ handling mechanisms by vascular myocytes or in the mechanisms activated by ET-1 to increase [Ca2+]i.
An explanation for the increased sensitivity of arteries from male DOCA-salt rats to ET-1/IRL-1620 was an increased expression of vascular ETB receptors. To evaluate this possibility, we performed RT-PCR in vessels from male and female control and DOCA-salt rats. We found that aortas and mesenteric arteries from male, but not female, DOCA-salt rats display increased ET-1 mRNA expression in comparison to arteries from control rats. Possibly due to a counter-regulatory mechanism, ETA receptor gene expression was slightly decreased (to a borderline significant level) and gene expression of the ETB receptor subtype was augmented in vessels from male hypertensive rats. These changes were not observed in vessels from female DOCA-salt rats, confirming our previous data showing that only arteries from male DOCA-salt rats exhibit marked vasoconstriction in response to the selective ETB receptor agonist IRL-1620 (6). Increased ET-1 content evaluated by ET-1 mRNA levels and immunoreactive ET-1 in blood vessels from male DOCA-salt rats has been previously reported (7,8). Changes in the expression or ratio of ET-1 receptors, exemplified by decreased binding of ET-1 in mesenteric arteries (16), decreased density of cardiomyocyte ETA receptors and fibroblast ETB receptors (9), as well as increased expression of ETB receptors in the renal medulla (10), have also been reported in DOCA-salt hypertension. To our knowledge, however, this is the first report that describes increased gene expression of ETB receptors in vessels from DOCA-salt rats.
The attenuated changes of ET-1 and ETA/ETB expression in arteries from female DOCA-salt rats may be related to the modulation exerted by the gonadal hormones on the ET-1 system. Gender differences in endothelin receptor density and in the relative proportion of receptor subtypes in humans (17), as well as increased expression of prepro-ET-1 mRNA in porcine aortic endothelial cells in the absence of female ovarian hormones (18), have been reported. In addition, it has been shown that 17ß-estradiol attenuates ET-1-induced coronary artery constriction both in vitro (19) and in vivo (20), and influences the affinity of endothelin receptors in coronary arterial smooth muscle (21).
This study demonstrated that changes in vascular expression of mRNA for ET-1 and ETA/ETB receptors occur in male, but not in female, DOCA-salt rats, whereas the Ca2+ handling mechanisms by vascular myocytes are similarly altered in arteries from male and female DOCA-salt rats. The molecular up-regulation of vascular ETB receptors seems to account for the increased vascular reactivity to ET-1 and ETB receptor-selective agonists observed in male DOCA-salt rats and may well play a role in the higher blood pressure levels observed in male DOCA-salt hypertensive rats.
1. Kanaide H (1996). Endothelin regulation of vascular tonus. General Pharmacology, 27: 559-563. [ Links ]
2. Schiffrin EL & Touyz RM (1998). Vascular biology of endothelin. Journal of Cardiovascular Pharmacology, 32 (Suppl 3): S2-S13. [ Links ]
3. Douglas AS & Ohlstein EH (1997). Signal transduction mechanisms mediating the vascular actions of endothelin. Journal of Vascular Research, 34: 152-164. [ Links ]
4. Griendling KK, Tsuda T & Alexander RW (1989). Endothelin stimulates diacylglycerol accumulation and activates protein kinase C in cultured vascular smooth muscle cells. Journal of Biological Chemistry, 264: 8237-8240. [ Links ]
5. Fluckiger J-P, Nguyen PV, Li G, Yang X-P & Schiffrin EL (1992). Calcium phosphoinositide, and 1,2 diacylglycerol responses of blood vessels of deoxycorticosterone-acetate hypertensive rats to endothelin-1. Hypertension, 19: 743-748. [ Links ]
6. Tostes RCA, David FL, Fortes ZB, Nigro D, Scivoletto R & Carvalho MHC (2000). Deoxycorticosterone acetate-salt hypertensive rats display gender-related differences in ETB receptor-mediated vascular responses. British Journal of Pharmacology, 130: 1092-1098. [ Links ]
7. Larivière R, Day R & Schiffrin EL (1993). Increased expression of endothelin-1 gene in blood vessels of deoxycorticosterone acetate-salt hypertensive rats. Hypertension, 21: 916-920. [ Links ]
8. Larivière R, Thibault G & Schiffrin EL (1993). Increased endothelin-1 content in blood vessels of deoxycorticosterone acetate-salt hypertensive but not in spontaneously hypertensive rats. Hypertension, 21: 294-300. [ Links ]
9. Fareh J, Touyz RM, Schiffrin EL & Thibault G (2000). Altered cardiac endothelin receptors and protein kinase C in deoxycorticosterone-salt hypertensive rats. Journal of Molecular and Cellular Cardiology, 32: 665-676. [ Links ]
10. Pollock DM, Allcock GH, Krishnan A, Dayton BD & Pollock JS (2000). Upregulation of endothelin B receptors in kidneys of DOCA-salt hypertensive rats. American Journal of Physiology, 278: F279-F286. [ Links ]
11. Watts SW, Finta KM, Lloyd MC, Storm DS & Webb RC (1994). Enhanced vascular responsiveness to Bay K8644 in mineralocorticoid- and N-nitro arginine-induced hypertension. Blood Pressure, 3: 340-348. [ Links ]
12. Tostes RCA, Traub O, Bendhack LM & Webb RC (1995). Sarcoplasmic reticulum Ca2+ uptake is not decreased in aorta from DOCA hypertensive rats: Functional assessment with cyclopiazonic acid. Canadian Journal of Physiology and Pharmacology, 73: 1536-1545. [ Links ]
13. Leitjen PAA & van Breemen C (1984). The effects of caffeine on the noradrenaline-sensitive Ca2+ store in rabbit aorta. Journal of Physiology, 357: 327-339. [ Links ]
14. Yamamoto H, Hwang O & Van Breemen C (1984). Bay K8644 differentiates between potential and receptor operated Ca2+ channels. European Journal of Pharmacology, 102: 555-557. [ Links ]
15. Tostes RC, Wilde DW, Bendhack LM & Webb RC (1997). Calcium handling by vascular myocytes in hypertension. Brazilian Journal of Medical and Biological Research, 30: 315-323. [ Links ]
16. Nguyen PV, Parent A, Deng LY, Fluckiger JP, Thibault G & Schiffrin EL (1992). Endothelin vascular receptors and responses in deoxycorticosterone acetate-salt hypertensive rats. Hypertension, 19 (Suppl II): II-98-II-104. [ Links ]
17. Ergul A, Shoemaker K, Puett D & Tackett RL (1998). Gender differences in the expression of endothelin receptors in human saphenous vein in vitro. Journal of Pharmacology and Experimental Therapeutics, 285: 511-517. [ Links ]
18. Wang X, Barber DA, Lewis DA, McGregor CGA, Sieck GC, Fitzpatrick LA & Miller VM (1997). Gender and transcriptional regulation of NO synthase and ET-1 in porcine aortic endothelial cells. American Journal of Physiology, 273: H1962-H1967. [ Links ]
19. Lamping KG & Nuno DW (1996). Effects of 17ß-estradiol on coronary microvascular responses to endothelin-1. American Journal of Physiology, 271: H1117-H1124. [ Links ]
20. Sudhir K, Ko E, Zellner C, Wong HE, Hutchison SJ, Chou TM & Chatterjee K (1997). Physiological concentrations of estradiol attenuate endothelin-1-induced coronary vasoconstriction in vivo. Circulation, 96: 3626-3632. [ Links ]
21. Barber DA, Michener SR, Ziesmer SC & Miller VM (1996). Chronic increases in blood flow upregulate endothelin-B receptors in arterial smooth muscle. American Journal of Physiology, 270: H65-H71. [ Links ]
We thank Sonia M.R. Leite for excellent technical assistance.
Address for correspondence: R.C.A. Tostes, Departamento de Farmacologia, ICB, USP, Av. Lineu Prestes, 1524, 05508-900 São Paulo, SP, Brasil. Fax: +55-11-3091-7322. E-mail: rtostes@usp.br
Presented at the IV International Symposium on Vasoactive Peptides, Belo Horizonte, MG, Brazil, October 19-21, 2001. Research supported by FAPESP and CNPq. Received December 7, 2001. Accepted May 3, 2002.











Curriculum ScienTI
uBio 




