SciELO - Scientific Electronic Library Online

 
vol.52 issue3Effect of clenbuterol on growth performance in broilersEstimates of genetic parameters and phenotypic, genetic and environmental trends of some productive traits in Gyr cattle author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

  • Article in xml format
  • How to cite this article
  • SciELO Analytics
  • Curriculum ScienTI
  • Automatic translation

Indicators

Related links

Share


Arquivo Brasileiro de Medicina Veterinária e Zootecnia

Print version ISSN 0102-0935On-line version ISSN 1678-4162

Arq. Bras. Med. Vet. Zootec. vol.52 n.3 Belo Horizonte June 2000

http://dx.doi.org/10.1590/S0102-09352000000300016 

Análise de polimorfismos do gene da b-lactoglobulina em vacas da raça Nelore e efeitos sobre o peso à desmama de suas progênies

[Polimorphism analisys of b-lactoglobulin gene on Nellore cows and effects on weaning weight of the calves]

 

F.J.C. Faria1, S.E.F. Guimarães2, G.B. Mourão1, R.M.G. Lima1, L.E.L. Pinheiro

1Depto. de Zootecnia – Escola de Veterinária da UFMG
Caixa Postal 567
30123-970 – Belo Horizonte, MG
2Depto. de Veterinária – Universidade Federal de Viçosa

 

Recebido para publicação em 23 de março de 1999.
E-mail: fariajfc@dedalus.lcc.ufmg.br

 

 

RESUMO

Informações sobre peso à desmama de bezerros Nelore foram utilizadas após ajuste para idade padrão aos 205 dias, sexo, idade da mãe, touro e mês de desmama, para separar as reprodutrizes em dois grupos, segundo o peso de suas crias. As médias de peso dos bezerros ajustadas pelo método dos quadrados mínimos e erros-padrão (LSM± SE) foram para os grupos pesados (P) e leves (L) 163,21± 2,18kg e 134,44± 2,18kg, respectivamente, com 41 animais em cada grupo. Essas reprodutrizes foram submetidas a coleta de sangue para estudo de polimorfismos do gene da b-lactoglobulina, por meio da técnica de PCR-RFLP. A amplificação e a digestão de um fragmento do gene da b-lactoglobulina entre o éxon II e III identificou os genótipos 1AA, 24AB e 56BB, com as freqüências de 0,16 e 0,84 para os alelos A e B, respectivamente. Os 24 animais com genótipo AB apresentaram LSM± SE de peso de seus produtos de 149,50± 4,17kg, e os 56 animais de genótipo BB tiveram média de 148,44± 2,73kg. O teste do qui-quadrado não apresentou significância (P>0,05), isto é, os grupos P e L não diferiram entre si quanto às freqüências alélicas apresentadas para esse gene. O genótipo das reprodutrizes não afetou o peso à desmama de suas crias, o que sugere haver outros fatores genéticos e não genéticos de maior magnitude que afetam o peso à desmama.

Palavras-chave: Bovino, Nelore, b-lactoglobulina, PCR, RFLP, polimorfismo genético

 

ABSTRACT

Weaning weights from a Nelore herd were used after adjustment of means for 205 days of age, sex, age of dam, sire and weaning month, and resulted into two groups of cows that differed by the weaning weight of their calves. The least square means (LSM) and standard error (SE) were for heavy group 163.21± 2.18kg and for light group 134.44± 2.18kg, with 41 animals in each group. These animals were genotyped by DNA polymorphisms of b-lactoglobulin gene, using PCR-RFLP. After amplification and digestion of a b-lactoglobulin gene fragment between II and III exon, genotypes 1AA, 24AB and 56BB were identified, with 0.16 and 0.84 frequencies for A and B alleles, respectively. The 24AB and 56BB cows showed calves with LSM± SE of 149.50± 4.17kg and 148.44± 2.73kg respectively, for weaning weight. No difference (P>0.05) was found and the heavy and light groups were similar for the allelic frequencies for this gene. The dam’s genotype did not affect the weaning weight of the calves. This suggests of having other factors, genetic or non-genetic, with major magnitude that affect the weaning weight.

Keywords: Cattle, Nellore, b-lactoglobulin, PCR, RFLP, genetic polymorphism

 

 

INTRODUÇÃO

A genética genômica, por meio da utilização de técnicas moleculares, permite a identificação de pontos de referência no DNA denominados marcadores genéticos. Diversas técnicas estão disponíveis para detecção da variabilidade genética na seqüência de DNA, identificando polimorfismos existentes. A tecnologia do DNA recombinante e a reação em cadeia da polimerase (PCR) são as ferramentas básicas para detecção dos marcadores genéticos.

No passado, as estratégias de seleção baseavam-se exclusivamente no aumento do potencial para produção de leite. Atualmente, o melhor conhecimento da estrutura e função dos genes das proteínas do leite tem permitido, com a utilização de técnicas moleculares, a rápida identificação dos alelos, apresentando uso potencial para a modificação genética da composição láctea.

O presente trabalho teve como objetivos determinar as freqüências alélicas da b-lactoglobulina em vacas da raça Nelore e verificar a associação dos genótipos de reprodutrizes com o peso à desmama de suas crias.

 

MATERIAL E MÉTODOS

Foram utilizados animais registrados da raça Nelore (puro de origem e livro aberto). Os animais foram mantidos em pastagens de braquiária e receberam suplemento mineralizado ad libitum durante todo o ano. De uma população de 398 reprodutrizes, foram selecionadas fêmeas para comporem a amostra inicial. A seleção dessas fêmeas foi baseada no peso à desmama, calculado para 205 dias, de seus filhos nascidos na estação de 1995.

Durante as análises foram excluídas da amostra inicial os bezerros que não atingiram 120kg à desmama, ou a progênie que não apresentava pai conhecido, permanecendo para análise dados referentes a 383 bezerros. Os bezerros nasceram entre os meses de agosto de 1994 e janeiro de 1995 e não foram pesados ao nascer. A desmama e pesagem ocorreram entre os meses de março a agosto de 1995. As análises foram realizadas sobre os pesos calculados para 205 dias, de acordo com a fórmula abaixo:

em que:

P205

= peso aos 205 dias de idade;
PD = peso real observado à desmama;
PN = peso ao nascimento, sendo 31,5kg para macho e 30,1kg para fêmea;
I = idade real à desmama.

 

Devido à distribuição inadequada entre as idades das reprodutrizes, elas foram divididas em três classes de idade: classe 1- fêmeas com idade superior a 2,9 anos e inferior a 6,0 anos; classe 2- fêmeas com idade superior a 5,9 anos e inferior a 10,0 anos; classe 3- fêmeas com idade superior a 9,9 anos e inferior a 14,1 anos.

O modelo estatístico utilizado para o ajuste do peso à desmama (P205) foi:

em que:

Yijklm

=

peso à desmama calculado para 205 dias de idade;

m

=

média geral da característica

Pi

=

efeito fixo do iésimo reprodutor, pai do bezerro (i=1,2,...,12);

Sj

=

efeito fixo do jésimo sexo do bezerro (j=1,2);

Mk

=

efeito fixo do késimo mês de desmama do bezerro (k=1,2,...,5);

Cl

=

efeito fixo da lésima classe de idade da reprodutriz (l=1,2,3);

eijklm

=

erro aleatório.

Após ajuste pelo modelo acima selecionaram-se 82 vacas as quais foram identificadas em dois grupos, denominados pesado (P) e leve (L), com 41 animais cada, que diferiram substancialmente (P<0,001) quanto ao peso à desmama de seus produtos. Os grupos apresentaram médias ajustadas pelo método dos quadrados mínimos e erros-padrão de 163,21± 2,18kg e 134,44± 2,18kg para P e L respectivamente, com média geral de 148,83kg para os 82 animais. A amostra foi composta pelas progenitoras, mães dos bezerros, em função da referida classificação, as quais foram submetidas à colheita de sangue para a genotipagem. Com base nessa diferença de grupo, analisou-se o genótipo das mães na intenção de identificar marcadores genéticos que pudessem estar associados às diferenças no peso à desmama.

Foram coletados da circulação periférica aproximadamente 10ml de sangue de cada animal a ser analisado, em tubos vacutainer heparinizados e estéreis. Em seguida, o material foi resfriado a 4ºC. O DNA da amostra foi extraído segundo o protocolo descrito por Sambrook et al. (1989), e os oligonucleotídeos iniciadores (primers) utilizados neste experimento foram sintetizados no Departamento de Parasitologia do Instituto de Ciências Biológicas da UFMG. Estes foram descritos inicialmente por Wilkins & Kuys (1992), e posteriormente foram feitas algumas deleções em seus nucleotídeos para que ambos tivessem a mesma temperatura de anelamento. Tais primers amplificam uma região de 961 pares de base (pb) entre o éxon II e III do gene da b-lactoglobulina. A região amplificada possui as substituições de nucleotídeos responsáveis pela diferenciação das variantes genéticas A e B. A seqüência dos primers é assim descrita: primer 1: 5’ - ACCTGGAGATCCTGCTGCAGA - 3’ e primer 2: 5’ - CATCGATCTTGAACACCGCAGGGAT - 3’.

Em todas reação de amplificação foi utilizado controle (branco/sem DNA) para confirmar a ausência de contaminação na execução do sistema. Cada reação de amplificação consistiu de tampão da PCR 1X (KCl 500mM, Tris-Cl pH 8.3 100mM), 0,2mM de cada primer, 0,2mM de dNTP (Promega), 1U Taq Polimerase (Cenbiot/RS, PHN/MG), 2,0mM MgCl2 (Promega), 50ng de DNA genômico e água mili-Q q.s.p. 10ml. As amplificações foram realizadas em termociclador PTC 100-MJ Research com capacidade para 60 tubos. O programa utilizado para amplificação do gene da b-lactoglobulina segue descrito: 1º ciclo 95º C por 1 min, 2º ciclo 61ºC por 1 min e 30 seg, 3º ciclo 72º C por 1 min e 30 seg, repetido 33 vezes.

O material amplificado foi analisado em gel de poliacrilamida a 4%. Após a amplificação, o produto foi digerido com enzima de restrição e visualizado em gel de poliacrilamida a 8%. Para identificação das bandas, utilizou-se um padrão de peso molecular pGEM (Promega). Dessa maneira, foram feitas as eletroforeses das amostras em cuba vertical de acrílico com tampão de corrida TBE 1X a 100 volts por 1 hora. Uma vez realizadas as amplificações (e constatadas em gel a 4%), seguia-se a digestão desse material (5ml), que era homogeneizado e incubado a 37ºC por 6 horas.

A enzima utilizada na digestão foi a Hph-I (Biolabs), visto ser ela recomendada para a determinação dos genótipos. Essa enzima cliva o fragmento amplificado em 741 e 220pb (genótipo AA), 741, 166 e 54 pb (genótipo BB), ou uma combinação dos dois, identificando os heterozigotos (A/B) 741, 220, 166 e 54pb (Wilkins & Kuys, 1992). Após a digestão, o material foi submetido à eletroforese em gel de poliacrilamida 8% por 2 horas a 100 volts. Para visualizar as bandas de DNA do material amplificado ou digerido procedia-se à coloração dos géis pelo método da prata.

Após a identificação dos polimorfismos genéticos do gene da b-lactoglobulina por meio da técnica de PCR-RFLP, obtiveram-se as freqüências genotípicas e alélicas para cada um dos grupos (P e L). Utilizou-se o teste de dispersão de freqüência (qui-quadrado) para a verificação do equilíbrio de Hardy-Weinberg da amostra geral e dentro de cada grupo. Esse teste também foi utilizado para se compararem as freqüências alélicas e genotípicas entre os grupos.

Adicionalmente foram realizadas análises de variância utilizando-se o pacote estatístico SAS (SAS, 1994) para averiguação do efeito do genótipo materno sobre o peso à desmama dos bezerros. Nesse caso específico foi desconsiderado durante a análise o genótipo AA do gene da b-lactoglobulina pois apresentava apenas um animal em toda a amostra. O nível de significância foi estabelecido em 5%.

O modelo estatístico utilizado para os genótipos de b-lactoglobulina (AB e BB) foi:

em que:

Yij

=

peso à desmama ajustado;

m

=

média geral;

Gi

=

efeito fixo do iésimo genótipo;

eij

=

erro aleatório.

 

RESULTADOS E DISCUSSÃO

Apenas um animal não pôde ter o seu genótipo determinado devido à impossibilidade de amplificação, ficando a amostra composta de 81 animais. Na Fig. 1 podem-se observar os genótipos encontrados. A presença constante de um fragmento de 741pb possibilitou averiguar a eficácia da digestão enzimática, tornando desnecessária a utilização de um animal-controle.

 

 

Aplicado o teste de qui-quadrado, não se observou (P>0,05) diferença entre os grupos, o que indica, portanto, o equilíbrio pela lei de Hardy-Weinberg. A Tab. 1 apresenta o número total de genótipos identificados, os genótipos por grupo e a freqüência alélica total.

 

 

De acordo com Singh & Bhat (1980), a freqüência do alelo B variou de 0,435 a 0,939 em gado indiano. Esses autores relataram freqüências de 0,40 e 0,60 para os alelos A e B em gado Gir, e 0,23 e 0,77 para os respectivos alelos em gado Ongole. As freqüências das variantes genéticas da b -lac em algumas raças zebuínas foram descritas por vários autores (Juneja & Chaudhary, 1973; Jairam & Nair 1983; Del Lama & Zago 1996; Neves et al., 1996). Segundo esses resultados (apesar de serem de raças distintas, com diferentes processos seletivos e obtidos em épocas variadas), pode-se perceber certa similaridade entre eles e o encontrado neste estudo, exceção feita para o alelo A na raça Gir, no qual a freqüência variou de 0,35 a 0,40, apresentando-se bastante superior às demais amostras. Os resultados deste estudo foram similares aos descritos no Brasil por Del Lama & Zago (1996) para animais Nelore, evidenciando a pequena variação entre os rebanhos estudados.

As divergências nas freqüências alélicas observadas para esse loco são possíveis visto estarem na dependência do número de animais estudados, rebanho, região e principalmente do grupo genético. Esses valores atestam a variabilidade presente nesse loco para as diversas raças aqui relatadas. Sua importância reside no fato de que essas freqüências servem de base para estudos de genética de populações.

Conforme descrição anterior, o presente trabalho, além de relatar essas freqüências em vacas Nelore, visou estudar o efeito do genótipo materno sobre o peso à desmama de suas crias. Um animal de genótipo AA foi excluído dessa análise. Os 24 animais com genótipo AB apresentaram média ajustada e erro-padrão do peso de suas crias de 149,50± 4,17kg, e os 56 animais restantes, do genótipo BB, tiveram média ajustada e erro-padrão de 148,45± 2,73kg. O genótipo da b -lactoglobulina não foi significativo para peso ajustado dos bezerros (P>0,05).

O efeito desse gene sobre as características físico-químicas do leite ainda é controverso e não foi possível neste experimento verificar associação entre esse sítio polimórfico e características ponderais. Moody et al. (1994) não observaram efeito do genótipo da mãe sobre peso à desmama em animais Hereford Line 1. É preciso considerar que as características quantitativas estão sujeitas a efeitos de vários genes e do ambiente, além da possível interação com outros genes como os da prolactina, de glicocorticóides, e do 17 b -estradiol. Atualmente existe a possibilidade da utilização de vários métodos moleculares para análise de polimorfismos, mas nenhuma consistência para esse gene foi estabelecida.

 

CONCLUSÕES

Existe variabilidade nesse loco para a amostra estudada e os alelos parecem estar segregando em equilíbrio de Hardy-Weinberg, apesar de o rebanho estar sob seleção. O genótipo das reprodutrizes não afetou o peso à desmama de suas crias, portanto, deve haver outros efeitos genéticos e não genéticos de maior magnitude. Este estudo enfatiza a necessidade de outras pesquisas para esclarecer a ação dos marcadores de DNA e seus efeitos sobre características quantitativas.

 

REFERÊNCIAS BIBLIOGRÁFICAS

DEL LAMA, S.N., ZAGO, M.A. Identification of k-casein and b-lactoglobulin genotypes in Brazilian Bos indicus and Bubalus bubalis populations. Braz. J. Genet., v.19, p.73-77, 1996.        [ Links ]

JAIRAM, B.T., NAIR, P.G. Genetic variants of milk proteins in different breeds of cattle. Indian J. Dairy Sci., v.36, p.5-11, 1983.        [ Links ]

JUNEJA, R.K., CHAUDHARY, R.P. Simultaneous phenotyping of milk proteins in Indian cattle. Indian J. Dairy Sci., v.26, p.104-106, 1973.        [ Links ]

MOODY, D.E., POMP, D., NEWMAN, S. et al. Characterization of DNA polymorphisms and their associations with growth and maternal traits in line 1 Hereford cattle. In: WORLD CONGRESS ON GENETICS APPLIED TO LIVESTOCK PRODUCTION, 5, 1994, Guelph. Proceedings... Guelph: University of Guelph, 1994, v.21, p. 221-224.         [ Links ]

NEVES, A.L.G., GUIMARÃES, S.E.F., LIMA, R.M.G. et al. Levantamento de freqüência dos alelos A e B do gene da b-lactoglobulina em população não selecionada de Gir. In: CONGRESSO PANAMERICANO DE CIÊNCIAS VETERINÁRIAS, 15, 1996, Campo Grande. Anais... Campo Grande: s.d. 1996, p.109.        [ Links ]

SAMBROOK, J., FRITISCH, E.F., MANIATIS, T. Molecular cloning: a laboratory manual. 2.ed. New York: Cold Spring Harbor Laboratory, 1989, 626 p.        [ Links ]

SAS User’s guide for windows: statistics. Cary: North Carolina, SAS Institute Inc., 1994. p.642. (Version 6.09).        [ Links ]

SINGH, H., BHAT, P.N. b-Lactoglobulin polymorphism in indigenous cattle. Indian J. Anim. Sci., v.50, p.932-937, 1980.        [ Links ]

WILKINS, R.J., KUYS, Y.M. Rapid b-lactoglobulin genotyping of cattle using the polymerase chain reaction. Anim. Gen., v.23, p.175-178, 1992.         [ Links ]

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License