SciELO - Scientific Electronic Library Online

 
vol.59 issue4The use of hydroxyapatite for arthrodesis in dogs and cats: a clinical studyUrachal persistence in a cat: case report author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

Share


Arquivo Brasileiro de Medicina Veterinária e Zootecnia

Print version ISSN 0102-0935On-line version ISSN 1678-4162

Arq. Bras. Med. Vet. Zootec. vol.59 no.4 Belo Horizonte Aug. 2007

http://dx.doi.org/10.1590/S0102-09352007000400019 

MEDICINA VETERINÁRIA

 

Ocorrência do vírus da imunodeficiência felina e do vírus da leucemia felina em gatos domésticos mantidos em abrigos no município de Belo Horizonte

 

Occurrence of feline immunodeficiency virus and feline leukemia virus in Sheltered domestic cats of Belo Horizonte

 

 

B.M. Teixeira; D.S. Rajão; J.P.A. Haddad; R.C. Leite; J.K.P. Reis*

Escola de Veterinária - UFMG Caixa Postal 567 30123-970 Belo Horizonte, MG

 

 


RESUMO

Investigou-se a ocorrência da infecção pelo vírus da imunodeficiência felina (FIV) e pelo vírus da leucemia felina (FeLV) em gatos domésticos, provenientes de dois abrigos, no município de Belo Horizonte. Amostras de sangue de 145 animais foram coletadas e testadas para detecção do FIV pela reação em cadeia da polimerase (PCR). Destas amostras, 40 foram testadas para o antígeno p26 de FeLV por meio de ELISA. Observaram-se duas fêmeas (1,4%) e quatro machos (2,8%) positivos para FIV e nove fêmeas (22,5%) e quatro machos (10,0%) positivos para FeLV.

Palavras-chave: gato, vírus da imunodeficiência felina, vírus da leucemia felina, PCR, ELISA


ABSTRACT

The occurrence of the feline immunodeficiency virus (FIV) and feline leukemia virus (FeLV) was investigated in domestic cats from two shelters of Belo Horizonte. Samples from 145 cats were collected and tested for FIV by the polymerase chain reaction (PCR). Forty out of 145 samples were tested for FeLV p27 antigen by a commercial ELISA kit. Two females (1.4%) and four males (2.8%) were positive for FIV. For FeLV tests, 13 cats (32.5%) were positive, being nine females (22.5%) and four males (10.0%).

Keywords: cat, feline immunodeficiency virus, feline leukemia virus, PCR, ELISA


 

 

INTRODUÇÃO

O vírus da imunodeficiência felina (FIV) e o vírus da leucemia felina (FeLV) pertencem à família Retroviridae e acometem gatos domésticos em todo o mundo (Lutz, 1990).

FIV é um Lentivírus cuja forma predominante de transmissão é a saliva. A transmissão intra-uterina, perinatal, pelo leite ou pelo sêmen de machos soropositivos também pode ocorrer (Jordan et al., 1995; O´Neil et al., 1995). Uma vez infectado, o animal pode desenvolver desordens hematológicas e deficiência imunológica, tornando-se susceptível a infecções secundárias (Yamamoto et al., 1989). Como na infecção por HIV, a alteração mais característica é a deleção de linfócitos TCD4 + (Bendinelli et al., 1995).

As taxas mais altas de infecção têm sido encontradas em gatos machos adultos com livre acesso às ruas, os quais, freqüentemente, apresentam comportamento agressivo (Lutz, 1990). Outro fator importante é a condição de saúde do animal (Souza et al., 2002).

FeLV é um Gammaretrovírus transmitido principalmente pelo contato direto freqüente ou prolongado entre animais e pela ingestão de água e comida contaminadas (Hoover; Mullins, 1991). O vírus também pode ser transmitido pelas secreções respiratórias, lacrimais, pelo leite, urina e fezes (Arjona et al., 2000), além de ser possível a transmissão venérea e durante a gestação (Harbour et al., 2002). Os sintomas da infecção incluem leucemias, linfossarcomas, síndromes mieloproliferativas e imunossupressão. Gatos jovens, que vivem em grupos com contato íntimo entre os animais são mais susceptíveis à infecção (Hoover; Mullins, 1991).

O diagnóstico das infecções por FIV e FeLV é feito pela associação do exame clínico, geralmente inconclusivo, com exames laboratoriais complementares. Os testes sorológicos para detecção de anticorpos específicos ou antígenos virais são muito utilizados, como o ensaio de imunoadsorção enzimática –ELISA (Miyazawa, 2002). Além disso, testes moleculares, como a reação em cadeia da polimerase (PCR), são eficientes para a detecção do DNA proviral (Caldas et al., 2000; Miyazawa, 2002).

A infecção por FIV e por FeLV ocorre em gatos domésticos de todo o mundo, com prevalências que variam de 1% a 44% e de 1% a 38%, respectivamente (Hosie et al., 1989; Ishida et al., 1989; Braley, 1994). No Brasil, já foi detectada por meio de pesquisas sorológicas e pela PCR, em gatos domésticos domiciliares e de rua, nos estados de São Paulo, Rio de Janeiro, Rio Grande do Sul e Minas Gerais, com prevalências que variam de menos de 2,0% a 37,5% e de 8,0% a 63,0% para FIV e FeLV, respectivamente (Caldas et al., 2000; Souza et al., 2002; Caxito, 2003; Almeida et al., 2004), e a ocorrência do FIV subtipo B em Minas Gerais foi comprovada por meio de estudo filogenético, realizado por Caxito et al. (2006).

O objetivo deste trabalho foi verificar a ocorrência da infecção por FIV e FeLV em gatos domésticos de abrigos em Belo Horizonte, MG.

 

MATERIAL E MÉTODOS

Foram coletadas 145 amostras de sangue, por meio de punção venosa, de gatos domésticos capturados nas ruas de Belo Horizonte e que se encontravam em dois abrigos, sendo 80 animais da Sociedade Protetora dos Animais e 65 de um abrigo em Ribeirão das Neves.

As amostras foram coletadas em dois tubos, um contendo anticoagulante EDTA para obtenção de células mononucleares do sangue periférico (PBMC) e outro sem anticoagulante para obtenção de soro. As células mononucleares foram obtidas pelo método Ficoll-Hypaque®1 de acordo com as recomendações do fabricante. O DNA foi extraído, seguindo-se protocolo utilizado por Hohdatsu et al. (1992). Após a extração, a quantidade de DNA obtida foi estimada por espectrofotometria e mantida a -20ºC até a realização dos testes.

A PCR foi realizada utilizando-se iniciadores para amplificação de um fragmento de 244 pares de bases do gene gag do FIV de acordo com a técnica empregada por Hohdatsu et al. (1992), cujas seqüências são 5' CTAGGAGGTGAGGAAGTTCA 3' (Senso) e 5' CTGCTTGTTGTTCTTGAGTT 3' (Anti-senso).

As reações foram realizadas em um volume total de 20µl contendo: 10mM de TrisHCl pH 8,3; 50mM de KCl; 1,5 mMde MgCl2, 1% de glicerol (p/v); 1% de DMSO (p/v); 10 pmoles de cada iniciador; 0,2mM de cada deoxinucleotídeo2; 0,5U de Taq DNA polimerase3 e 2µl do DNA molde. Uma fina camada de óleo mineral foi adicionada a cada microtubo. A reação de amplificação foi realizada em um termociclador programável4.

Os ciclos padronizados para amplificação do DNA foram realizados conforme descritos por Hohdatsu et al. (1992): uma incubação inicial a 94ºC por 5 minutos, seguida de 35 ciclos, cada um consistindo de desnaturação a 94ºC por 60 segundos, hibridização a 55ºC por 120 segundos, extensão pela polimerase a 72ºC por 120 segundos e extensão final a 72ºC por 5 minutos.

Após a PCR, duas amostras de fragmentos amplificados foram submetidas ao seqüenciamento de nucleotídeos por ciclagem térmica em seqüenciador automático5. A seqüência editada foi, então, analisada para a determinação de homologia com seqüências de FIV depositadas no banco de genomas, GenBank6.

Das 145 amostras coletadas, 40 foram separadas aleatoriamente e submetidas a um ELISA, utilizando-se kit7, com capacidade de detectar a proteína p27 de FeLV.

 

RESULTADOS

Dos 145 animais analisados pela PCR, seis (4,14%) apresentaram resultado positivo para FIV, sendo quatro machos e duas fêmeas (Tab. 1).

Das 40 amostras de soro analisadas por meio do ELISA, 13 (32,5%) apresentaram resultado positivo para o FeLV (Tab. 2).

 

 

DISCUSSÃO

Apesar da população de felinos, utilizada neste trabalho, constituir-se de animais provenientes da rua, com condições nutricionais ruins e ausência do controle de infecções, os valores de ocorrência de FIV são inferiores aos encontrados em outros estados. A detecção do vírus pela PCR foi relatada em São Paulo (13,4%), Rio Grande do Sul (37,5%) e em Minas Gerais (2,7%), com taxas de ocorrência variando de acordo com a região (Caldas et al., 2000; Caxito, 2003). Estudos sorológicos detectaram a ocorrência de anticorpos contra o FIV em São Paulo (11,7%) e no Rio de Janeiro (16,7% e 21,0%), porém o método sorológico pode gerar resultados falso-positivos, levando a uma taxa de ocorrência maior que a real (Reche Jr. et al., 1997; Souza et al., 2002; Almeida et al., 2004).

Em estudo anterior realizado em Minas Gerais (Caxito, 2003), foram encontrados resultados diferentes para gatos que viviam em ambiente doméstico (3,0%) e de rua (1,1%). O resultado encontrado para os animais de rua foi inferior ao encontrado neste estudo, apesar de também ter sido utilizada a PCR.

Comparando-se as seqüências das duas amostras obtidas com as seqüências de amostras japonesas (número de acesso 37823 e 37824) descritas por Kakinuma et al. (1995), foi encontrado de 96 a 98% de homologia entre nucleotídeos, mostrando alto grau de conservação dessa região do gene gag de amostras brasileiras com amostras japonesas do FIV.

O ELISA detectou 13 (32,5%) de amostras positivas para FeLV, este resultado foi superior aos encontrados em estudos realizados em outros estados do Brasil. Reche Jr. Et al. (1997) e Souza et al. (2002) observaram 8% e 17% de animais positivos, respectivamente, nos estados de São Paulo e Rio de Janeiro. A ocorrência encontrada é inferior à observada em estudo anterior realizado em Minas Gerais (Coelho, 2003), que detectou pela Nested-PCR uma ocorrência de 63,36%. A discrepância entre os resultados anteriores e os do presente trabalho pode estar relacionada à diferença de métodos de diagnóstico utilizados.

A alta ocorrência da infecção pelo FeLV pode estar também influenciada pela caracterização das populações analisadas, que compreendiam animais vivendo em ambientes com alta densidade populacional, mantendo íntimo e freqüente contato entre eles. Estudos anteriores demonstraram tal influência, observando a maior incidência da infecção em criadouros com mais de seis gatos (Braley, 1994).

Apesar de gatos machos serem apontados como os mais afetados pela infecção por FIV e FeLV (Hosie et al., 1989; Braley, 1994), o número de animais testados não foi suficiente para observar variações entre os sexos.

Os resultados sugerem que a procedência dos animais, neste caso, de rua, pode ser fator importante para a transmissão de FIV.

Neste trabalho, demonstrou-se a ocorrência dos vírus da imunodeficiência felina e da leucemia felina em gatos de rua que vivem em abrigos de Belo Horizonte, Minas Gerais.

 

REFERÊNCIAS BIBLIOGRÁFICAS

ALMEIDA, F.M.; FARIA, M.C.F.; BRANCO, A.S. et al. Sanitary conditions of colony of urban feral cats (Felis catus Linnaeus, 1758) in a Zoological Garden of Rio de Janeiro, Brazil. Rev. Inst. Med. Trop. São Paulo, v.46, p.269-274, 2004.        [ Links ]

ARJONA, A.; ESCOLAR, E.; SOTO, I. et al. Seroepidemiological survey of infection by feline leukemia virus and immunodeficiency virus in Madrid and correlation with some clinical aspects. J. Clin. Microbiol., v.38, p.3448-3449, 2000.        [ Links ]

BENDINELLI, M.; PISTELLO, M.; LOMBARDI, S. et al. Feline immunodeficiency virus: an interesting model for AIDS studies and an important cat pathogen. Clin. Microbiol. Rev., v.8, p.87-112, 1995.        [ Links ]

BRALEY, J. FeLV and FIV: survey shows prevalence in the United States and Europe. Feline Pract., v.22, p.25-28, 1994.        [ Links ]

CALDAS, A.P.F.; LEAL, E.S.; SILVA, E.F.A. et al. Detecção do provírus da Imunodeficiência Felina em gatos domésticos pela técnica de reação em cadeia da polimerase. Pesq. Vet. Bras., v.20, p.20-25, 2000.        [ Links ]

CAXITO, F.A. Detecção e subtipagem do vírus da imunodeficiência felina em Minas Gerais. 2003. 90f. Dissertação (Mestrado) – Instituto de Ciências Biológicas, Universidade Federal de Minas Gerais, Belo Horizonte.        [ Links ]

CAXITO, F.A.; COELHO, F.M.; OLIVEIRA, M.E. et al. Phylogenetic analysis of feline immunodeficiency strains from State of Minas Gerais, Brazil. Arq. Bras. Med. Vet. Zootec., v.58, p. 1222-1225, 2006        [ Links ]

COELHO, F.M. Ocorrência do DNA proviral do vírus da leucemia felina em Felis catus detectado por Nested PCR. 2003. 99f. Dissertação (Mestrado) – Instituto de Ciências Biológicas, Universidade Federal de Minas Gerais, Belo Horizonte.        [ Links ]

HARBOUR, D.A.; GUNN-MOORE, D.A.; GRUFFYDD-JONES, T.J. et al. Protection against oronasal challenge with virulent feline leukaemia virus lasts for at least 12 months following a primary course of immunisation with LeukocellTM 2 vaccine. Vaccine, v.20, p.2866-2872, 2002.        [ Links ]

HOHDATSU, T.; YAMADA, M.; OKADA, M. et al. Detection of feline immunodeficiency proviral DNA in peripheral blood lymphocytes by the polymerase chain reaction. Vet. Microbiol., v.30, p.113-123, 1992.        [ Links ]

HOOVER, E.A.; MULLINS, J.I. Feline leukemia virus infection and diseases. J. Am. Vet. Med. Assoc., v.199, p.1287-1297, 1991.        [ Links ]

HOSIE, M.J.; ROBERTSON, C.; JARRET, O. Prevalence of feline leukaemia virus and antibodies to feline immunodeficiency virus in cats in United Kingdom. Vet. Rec., v.128, p.293-297, 1989.        [ Links ]

ISHIDA, T.; WASHIZU, T.; TORIYABE, K. et al. Feline immunodeficiency virus infection in cats of Japan. J. Am. Vet. Med. Assoc., v.194, p.221–225, 1989.        [ Links ]

JORDAN, H.L.; HOWARD, J.; TOMPKINS, W.A. et al. Detection of feline immunodeficiency virus in semen from seropositive domestic cats (Felis catus). J. Virol., v.69, p.7328-7333, 1995.        [ Links ]

KAKINUMA, S.; MOTOKAWA, K.; HOHDATSU, T. et al. Nucleotide sequence of feline immunodeficiency virus: classification of Japanese isolates into two subtypes which are distinct from non-Japanese subtypes. J. Virol., v.69, p.3639-3646, 1995.        [ Links ]

LUTZ, H. Feline retroviruses: a brief review. Vet. Microbiol. v.23, p.131-146, 1990.        [ Links ]

MIYAZAWA, T. Infections of feline leukaemia virus and feline immunodeficiency virus. Front. Biosci., v.7, p.504-518, 2002.        [ Links ]

O´NEIL, L.L.; BURKHARD, M.J.; DIEHL, L.J. et al. Vertical transmission of feline immunodeficiency virus. AIDS Res. Hum. Retrovirus, v.10, p.267-278, 1995.        [ Links ]

RECHE JR., A.; HAGIWARA, M.K.; LUCAS, S.R.R. Clinical study of acquired immunodeficiency syndrome in domestic cats in São Paulo. Braz. J. Vet. Res. Anim. Sci., v.34, p.152-155, 1997.        [ Links ]

SOUZA, H.J.M.; TEIXEIRA, C.H.R.; GRAÇA, R.F.S. Estudo epidemiológico de infecções pelo vírus da leucemia e/ou imunodeficiência felina, em gatos domésticos do município do Rio de Janeiro. Clin. Vet., v.36, p.14-21, 2002.        [ Links ]

YAMAMOTO, J.K.; HANSEN, H.; HO, E.W. et al. Epidemiologic and clinical aspects of feline immunodeficiency virus infection in cats from the continental United States and Canada and possible mode of transmission. J. Am. Vet. Med. Assoc., v.194, p.213–220, 1989.        [ Links ]

 

 

Recebido em 22 de maio de 2006
Aceito em 6 de março de 2007

 

 

* Autor para correspondência (corresponding author)
E-mail: jenner@coltec.ufmg.br
1 Amersham Pharmacia Biotech – Piscataway, EUA
2 Promega – Madison, EUA
3 Gibco-BRL Invitrogen – Carlsbad, EUA
4 MJ Research, Inc. Globalspec – Waltham, EUA
5 ALF – Amersham Pharmacia Biotech – Uppsalla, Suécia
6 National Center for Biotechnological information – Bethesda, EUA
7 Snap combo felino da IDEXX® – Westbrook, EUA.

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License