SciELO - Scientific Electronic Library Online

 
vol.60 número2Atividade ovariana de vacas leiteiras em dietas com propilenoglicol ou monensina no período de transiçãoMetodologia alternativa para extração de DNA genômico de Staphylococcus aureus índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Journal

Artigo

  • Português (pdf)
  • Artigo em XML
  • Como citar este artigo
  • SciELO Analytics
  • Curriculum ScienTI
  • Tradução automática

Indicadores

Links relacionados

Compartilhar


Arquivo Brasileiro de Medicina Veterinária e Zootecnia

versão impressa ISSN 0102-0935versão On-line ISSN 1678-4162

Arq. Bras. Med. Vet. Zootec. v.60 n.2 Belo Horizonte abr. 2008

https://doi.org/10.1590/S0102-09352008000200003 

MEDICINA VETERINÁRIA

 

PCR multiplex para identificação de isolados de Clostridium chauvoei e Clostridium septicum

 

Multiplex PCR for identification of Clostridium chauvoei and Clostridium septicum

 

 

R.A. AssisI; F.C.F. LobatoII, *; Z.I.P. LobatoII; M.F. CamargosI; R.A.P. NascimentoI; A.P.C. VargasIII; F.M. SalvaraniII; F.A. UzalIV

ILANAGRO-MG - MAPA – Pedro Leopoldo, MG
IIEscola de Veterinária - UFMG Caixa Postal 567 – 30123-970 – Belo Horizonte, MG
IIIUniversidade Federal de Santa Maria – Santa Maria, RS
IVCalifornia Animal Health and Food Safety Laboratory – San Bernardino, CA - EUA

 

 


RESUMO

Padronizou-se uma técnica de reação em cadeia da polimerase múltipla (PCR multiplex) para detecção de Clostridium chauvoei e Clostridium septicum em culturas puras. Foram utilizados pares de iniciadores para segmentos específicos dos genes que codificam a flagelina de C. chauvoei e a toxina alfa de C. septicum. Para avaliaçã o da PCR multiplex, foram testados 16 isolados clínicos de C. chauvoei e 15 isolados de C. septicum provenientes de ruminantes, quatro sementes vacinais de cada um desses agentes. Amostras de referência de ambos os microrganismos foram usadas como controle. Para avaliar a especificidade, DNAs genômicos dos seguintes microrganismos foram usados: C. sordellii, C. novyi tipo A, C. novyi tipo B, C. perfringens tipo A, C. haemolyticum, C. botulinum tipo D, Pseudomonas aeruginosa, Staphylococcus aureus, Enterobacter aerogenes, Escherichia coli e Salmonella typhimurium. Todos os isolados e sementes vacinais de C. chauvoei e C. septicum foram detectados pela técnica. Não foram observadas reações cruzadas com as outras espécies de clostrídios, outras espécies bacterianas ou entre C. Chauvoei e C. septicum. As menores concentrações de DNA de C. chauvoei e C. septicum detectadas foram 45pg/µl e 30pg/µl, respectivamente. A PCR multiplex pode ser utilizada para a identificação específica de C. chauvoei e C. septicum em culturas puras.

Palavras-chave: PCR multiplex, identificação, Clostridium chauvoei, Clostridium septicum


ABSTRACT

Multiplex PCR was optimized to detect Clostridium chauvoei and Clostridium septicum in pure cultures. In each reaction, a pair of primers for a specific segment of the flagellin gene of C. chauvoei and a pair of primers for a specific segment of alpha toxin gene of C. septicum were employed. Reference strains of both microorganisms were used as control. The multiplex PCR was evaluated by testing 16 clinical isolates of C. chauvoei from ruminants, 15 clinical isolates of C. septicum from ruminants and, four vaccine strains of each one of these agents. Reference strains of both microorganisms were used as control. To evaluate the specificity, genomic DNA of the following microorganisms was used: C. sordellii, C. novyi type A, C. novyi type B, C. perfringens type A, C. haemolyticum, C. botulinum type D, Pseudomonas aeruginosa, Staphylococcus aureus, Enterobacter aerogenes, Escherichia coli, and Salmonella typhimurium. All the isolates and vaccine strains of C. chauvoei and C. septicum were positive by PCR assay and cross reactions were not observed with the other species of clostridia, the other bacterial species or amongst both investigated agents. The smallest concentrations of DNA detected from C. chauvoei and C. septicum were 45pg/µl and 30pg/µl, respectively. The multiplex PCR was useful for the specific identification of C. chauvoei and C. septicum in pure cultures.

Keywords: multiplex PCR, identification, Clostridium chauvoei, Clostridium septicum


 

 

INTRODUÇÃO

Em várias partes do mundo, C. chauvoei e C. septicum são considerados os principais agentes responsáveis pelas mionecroses (Pinto e Abreu, 1992). No Brasil, ambos os microrganismos, atuando isoladamente ou em associação, são os mais freqüentemente relatados nos casos de carbúnculo sintomático e gangrena gasosa em bovinos (Baldassi et al., 1985). Apesar do grande número de casos de mionecroses no Brasil, a informação etiológica sobre essas doenças é escassa (Correa et al., 1980; Baldassi et al., 1985). A maioria dos diagnósticos é baseada apenas em achados clínicos e de necropsia (Assis et al., 2001), caracterizados por dificuldades de locomoção, depressão e recumbência e à necropsia, as áreas lesadas encontram-se edematosas, crepitantes e de coloração vermelho-enegrecida (Assis et al., 2002). O diagnóstico das mionecroses tradicionalmente tem sido feito baseando-se no cultivo e isolamento dos microrganismos envolvidos (Correa et al., 1980; Baldassi et al., 1985). Entretanto, o tempo necessário para o cultivo e isolamento, é de quatro dias a uma semana (Assis et al., 2001). Daí a importância da técnica de PCR multiplex, pela rapidez e precisão na diferenciação destes microrganismos, além da utilização de diferentes primers em uma mesma reação o que reduz os custos do teste (Macêdo et al., 2007).

Na PCR multiplex, em apenas uma reação, é possível detectar C. chauvoei e C. septicum, os quais podem ser encontrados em associação nos quadros de mionecroses nas diferentes espécies animais (Williams, 1977; Poonacha et al., 1982).

O objetivo deste estudo foi padronizar uma técnica de PCR multiplex para detectar o gene que codifica a flagelina de C. chauvoei e o gene que codifica a toxina alfa de C. septicum em culturas puras.

 

MATERIAL E MÉTODOS

Os DNAs genômicos usados foram obtidos a partir de 16 isolados de C. chauvoei (15 de bovinos e um de ovino) e 13 de C. septicum (de bovinos) com origens em diversos estados. Após certificado crescimento e pureza pelo Gram e, adicionalmente a certificação da identidade dos isolados por imunofluorescência direta (Pinto e Abreu, 1992), os clostrídios foram subcultivados em caldo cérebro-coração1 e incubados a 37ºC em jarras de anaerobiose por 48 horas. As demais espécies bacterianas, listadas na Tab. 1, foram também subcultivadas em caldo cérebro-coração1 em aerobiose a 37ºC por 24 horas. Depois de verificado crescimento e pureza pelo Gram, os isolados foram novamente subcultivados em 15ml de caldo cérebro-coração1 e incubadas como descrito acima. Finalmente, depois de verificado crescimento e pureza pelo Gram, os isolados foram processadas para a extração de DNA genômico conforme a metodologia descrita por Takeuchi et al. (1997).

 

 

Para padronização da PCR multiplex, a técnica de PCR para detecção do gene da flagelina de C. chauvoei foi realizada conforme Kojima et al. (2001), e para detecção do gene da toxina alfa de C. septicum, segundo Takeuchi et al. (1997). As concentrações de DNA foram determinadas conforme Sambrook et al. (1989), com a utilização de espectrofotômetro1 a 260-280nm de absorvância (A260-280). Todos ensaios de PCR, foram realizados no termociclador Px2 Thermal Cycler2 Para padronização da PCR multiplex, foram empregados um ciclo inicial de desnaturação a 94ºC/5min, seguido por 34 ciclos a 94ºC por 1 minuto para desnaturação, 54ºC por 1 minuto para anelamento e 72ºC por 1 minuto para extensão. Foi também incluído, um ciclo final de extensão a 72ºC por 7 minutos. Utilizaram-se os pares de oligonucleotídeos iniciadores: C. chauvoei- 516-senso (5' ATCGGAAACATGAGTGCTGC 3') e 516-anti-senso (5' AGTCTTTATGCTTCCGCTAG 3') (Kojima et al., 2001) e C. septicum: senso- (5' AATTCAGTGTGCGGCAGTAG 3') e anti-senso- (5' CCTGCCCCAACTTCTCTTTT 3') (Takeuchi et al., 1997). A PCR foi realizada em um volume final de 100µl, usando tampão 1B-10X4(500mM KCl, 100mM Tris-Hcl pH 8,4, 1% Triton X-100), 2,5mM de MgCl25, 10pmol de cada iniciador de C. chauvoei, 20pmol de cada iniciador de C. septicum, 0,25mM de cada dNTPs4, 2,5U de Taq polimerase5, água ultra pura4, e 450ng e 300ng de DNA genômico de C. chauvoei e C. septicum, respectivamente. A especificidade analítica dos iniciadores foi verificada testando-se DNAs genômicos das demais espécies de clostrídios e das outras cinco espécies bacterianas (Tab. 1), nas mesmas condições descritas acima, com o uso de 450ng de DNA de cada um desses microrganismos. Foram realizadas PCR multiplex com DNAs genômicos de C. chauvoei e C. septicum separadamente para verificar a especificidade analítica dos iniciadores entre esses agentes. Em todas as reações foram utilizados controles positivo e negativo. Como controles positivos foram utilizados DNAs genômicos de C. chauvoei, amostra ATCC 10092, e de C. septicum, amostra ATCC 12464. Como controle negativo foram utilizados todos os reagentes da PCR sem os DNAs genômicos.

Após o término da PCR, os produtos amplificados, separados pela eletroforese foram visualizados em gel de agarose a 1% corado com brometo de etídeo (0,5µg/ml). 1kb Plus DNA Ladder3, foi usado como marcador de peso molecular. Para certificação da identidade dos produtos amplificados, uma amostra de C. chauvoei usada na produção de vacina e o isolado de C. septicum Itaperuna proveniente do estado do Rio de Janeiro foram novamente amplificados. As bandas correspondentes aos produtos da PCR de C. chauvoei e de C. septicum, foram cortadas do gel com auxílio de um bisturi estéril e purificadas separadamente usando-se o kit Wizard SV Gel4 e PCR Clean-Up System A92812. Posteriormente os DNAs dessas amostras foram submetidas para seqüenciamento no Bioagro/UFV/Minas Gerais.3, 5

Para se determinar a menor concentração de DNA detectada pela técnica, foram realizadas diluições decimais (10-1 a 10-6), a partir de concentrações de 450ng/µl e 300ng/µl de DNA genômico das amostras de C. chauvoei - ATCC 10092 e C. septicum - ATCC 12464, respectivamente.

 

RESULTADOS E DISCUSSÃO

A PCR multiplex foi padronizada com 20 amostras de C. chauvoei (16 culturas puras provenientes de ruminantes e quatro sementes usadas na produção de vacinas) e 19 de C. septicum (15 culturas puras provenientes de ruminantes e quatro sementes usadas na produção de vacinas). Todos os isolados clínicos desses agentes foram detectados pela PCR multiplex, na qual observou-se somente a amplificação dos produtos esperados de 516pb e 270pb de C. chauvoei e C. septicum, respectivamente. Não foram observadas reações cruzadas com as demais espécies de clostrídios, com as outras espécies bacterianas e entre C. chauvoei e C. septicum (Fig. 1). Em todas as reações, os controles positivo e negativo de C. chauvoei e C. septicum, mostraram-se também eficientes. Os produtos amplificados e purificados de C. chauvoei e C. septicum, tiveram sua identidade certificada pelo seqüenciamento. A seqüência da amostra Itaperuna, RJ de C. septicum, está disponível no GenBank sob o número de acesso AY589051.

 

 

Na figura 1, está demonstrada a amplificação de uma cultura de C. chauvoei, isolado no estado de Minas Gerais, e de uma cultura de C. septicum, isolado no estado do Rio Grande do Sul. Em adição, está representada a amplificação desses isolados, usando os respectivos DNAs genômicos separadamente. Também, são mostrados os resultados da PCR multiplex, usando DNAs genômicos de C. sordellii, C. novyi tipo A e C. perfringens tipo A.

As menores concentrações de DNA detectados da amostra ATCC 10092 de C. chauvoei e da amostra ATCC 12464 de C. septicum foram 45pg/µl e 30pg/µl, respectivamente.

Em relação aos estudos de Takeuchi et al., 1997 e Kojima et al., 2001, não foi possível fazer comparação da sensibilidade entre os resultados relatados por esses autores e os deste trabalho, devido às diferentes metodologias adotadas. Neste estudo a menor quantidade de DNA, detectado por reação, foi determinada em picogramas. Takeuchi et al. (1997), determinaram a menor quantidade de DNA detectado por reação em UFC/ml e Kojima et al. (2001) em UFC.

Relatos sobre o desenvolvimento de duas técnicas de PCR multiplex para detecção de C. chauvoei, C. septicum e outros clostrídios patogênicos com base no gene que codifica a flagelina foram feitos por Sasaki et al. (2002a,b). Na literatura disponível, entretanto, não foram encontrados descrição de PCR multiplex com base no gene da toxina alfa de C. septicum. A PCR multiplex mostrou-se também eficiente para detectar C. chauvoei e C. septicum, separadamente. Esta técnica complementará os procedimentos laboratoriais para o diagnóstico de C. chauvoei e C. septicum, e poderá melhorar significativamente a taxa de sucesso no diagnóstico das mionecroses no Brasil. Contudo, futuros trabalhos deverão ser realizados para se avaliar a eficiência da técnica na identificação de C. chauvoei e C. septicum diretamente dos espécimes clínicos de animais com suspeita de mionecroses.

 

AGRADECIMENTOS

À FAPEMIG e ao CNPq, pelo suporte financeiro. Ao Instituto PESAGRO - Rio de Janeiro, especialmente aos Drs. Rossiane Moura Souza e Milton Moreno. À Dra. Lúcia Baldassi (IBSP - São Paulo). À Dra. Akemi Kojima (NVAL - Kokubunji, Japão) e ao LANAGRO - MG.

 

REFERÊNCIAS BIBLIOGRÁFICAS

ASSIS, R.A.; LOBATO, F.C.F.; DIAS, L.D. et al. Producción y evaluación de conjugados fluorescentes para diagnóstico de mancha y gangrena gaseosa. Rev. Med. Vet., v.82, p.68-70, 2001.         [ Links ]

ASSIS, R.A.; LOBATO, F.C.F.; MARTINS, N.E. et al. Surto de gangrena gasosa em bovinos. Rev. Port. Cienc. Vet., v.27, p.13-145, 2002.         [ Links ]

BALDASSI, L.; HIPÓLITO, M.; CALIL, E.M.B. et al. Observações sobre a incidência de gangrena gasosa e carbúnculo sintomático durante 10 anos, 1970-79, no estado de São Paulo. Biológico, v.51, p.161-165, 1985.         [ Links ]

CORREA, W.M.; CORREA, C.N.N.; LOPES, C.A.M. et al. Enfermidades por clostrídios 1969-1978 (clostridial diseases 1969-1978). Arq. Esc. Vet. UFMG, v.32, p.369-374, 1980.         [ Links ]

KOJIMA, A.; UCHIDA, I.; SEKISAKI, T. et al. Rapid detection and identification of Clostridium chauvoei by PCR based on flagellin gene sequence. Vet. Microbiol., v.78, p.363-371, 2001.         [ Links ]

MACÊDO, N.R.; MENEZES, C.P.L.; LAGE, A.P. et al. Detecção de cepas patogênicas pela PCR multiplex e avaliação da sensibilidade a antimicrobianos de Escherichia coli isoladas de leitões diarréicos. Arq. Bras. Med. Vet. Zootec., v.59, p.1117-1123, 2007.         [ Links ]

PINTO, M.P.; ABREU, V.L.V. Comparação de técnicas para preparo de conjugados anti-Clostridium septicum e anti-Clostridium chauvoei. Arq. Bras. Med. Vet. Zootec., v.44, p.513-520, 1992.         [ Links ]

POONACHA, K.B.; DONAHUE, J.M.; LEONARD, W.H. Clostridial myositis in a cat. Vet. Pathol., v.19, p.217-219, 1982.         [ Links ]

SAMBROOK, J.; FRITSCH, E.F.; MANIATIS, T. Molecular Cloning: A laboratory manual. 2ed. New York: Cold Spring Harbor Laboratory, 1989.         [ Links ]

SASAKI, Y.; KOJIMA, A.; AOKI, H. Phylogenetic analysis and PCR detection of Clostridium chauvoei, Clostridium haemolyticum, Clostridium novyi types A and B, and Clostridium septicum based on the flagellin gene. Vet. Microbiol., v.86, p257-267, 2002a.         [ Links ]

SASAKI, Y.; KOJIMA, A.; KIKUCHI, E. et al. Multiplex PCR for direct detection of pathogenic clostridia in bovine clostridial infections. J. Vet. Med., v.55, p.889-893, 2002b.         [ Links ]

TAKEUCHI, S.; HASHIZUME, N.; KINOSHITA, T. et al. Detection of Clostridium septicum hemolysin gene by polymerase chain reaction. J. Vet. Med. Sci., v.59, p.853-855, 1997.         [ Links ]

WILLIAMS, B.M. Clostridial myositys in cattle: bacteriology and gross pathology. Vet. Rec., v.100, p.90-91, 1977.         [ Links ]

 

 

Recebido em 31 de julho de 2007
Aceito em 10 de maio de 2008

 

 

* Autor para correspondência (corresponding author)
E-mail: flobato@vet.ufmg.br
1 Difco - Sparks, EUA
2 Thermo Spectronic Model Genesys 10UV - Rochester, EUA
3 Thermo Electron Corporation - Milford, EUA
4 Invitrogen - São Paulo, Brasil
5 Promega - Wisconsin, EUA
6 Invitrogen - São Paulo, Brasil
7 Phoneutria - Belo Horizonte, Brasil

Creative Commons License Todo o conteúdo deste periódico, exceto onde está identificado, está licenciado sob uma Licença Creative Commons