SciELO - Scientific Electronic Library Online

vol.64 issue4Serological and microbiological detection of Salmonella spp. in rheas (Rhea americana) author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Related links

  • On index processCited by Google
  • Have no similar articlesSimilars in SciELO
  • On index processSimilars in Google

Arquivo Brasileiro de Medicina Veterinária e Zootecnia

Print version ISSN 0102-0935

Arq. Bras. Med. Vet. Zootec. vol.64 no.4 Belo Horizonte Aug. 2012 

Polymorphisms of the coding region of Slc11a1 (Nramp1) gene associated to natural resistance against bovine brucellosis

Polimorfismos na região codificadora do gene Slc11a1 (Nramp1) associados à resistência natural contra brucelose bovina

T.A. PaixãoI; R. MartinezII; R.L. SantosIII

IInstituto de Ciências Biológicas - Universidade Federal de Minas Gerais - Belo Horizonte, MG
IICorporación Colombiana de Investigación Agropecuaria - CORPOICA - Bogotá DC, Colombia
IIIEscola de Veterinária - Universidade Federal de Minas Gerais - Belo Horizonte, MG

Keywords: bovine, brucellosis, natural resistance, Nramp1, Slc11a1

Brucelose bovina causada por Brucella abortus é uma importante doença zoonótica, caracterizada pela ocorrência de aborto durante o último trimestre da gestação, o que resulta em diminuição da fertilidade da produção de leite em vacas. A identificação de genes associados à resistência natural contra brucelose tem sido investigada com o objetivo de selecionar animais resistentes à doença. Em bovinos, é controversa a resistência natural contra B. abortus associada ao polimorfismo da região 3' UTR do gene Slc11A1 (Nramp1). Polimorfismos localizados na sequência codificadora de Slc11A1 têm sido identificados em bovinos, contudo a influência sobre a resistência natural contra brucelose não é conhecida. No presente estudo, três novos polimorfismos do gene Slc11A1 foram genotipados por análise conformacional de fita simples em vacas experimentalmente ou naturalmente infectadas por B. Abortus, e foram avaliadas a frequência de cada genótipo e sua associação com o fenótipo de resistência ou susceptibilidade à brucelose bovina. Os resultados deste estudo demonstram que alguns genótipos foram mais frequentes em animais considerados fenotipicamente susceptiveis à brucelose.

Palavras-chave: bovino, brucelose, resistência natural, Nramp1, Slc11a1

Bovine brucellosis caused by Brucella abortus is an important zoonotic disease characterized by abortion during the last trimester of pregnancy, which results in impaired fertility and decreased milk production in cows (Carvalho Neta et al., 2009). In order to select resistant cattle, identification of genes associated with natural resistance against brucellosis has been extensively investigated. In cattle, natural resistance against B. abortus has been linked to polymorphisms within the 3' untranslated region (3'UTR) (GT)n microsatellite of the Nramp1 gene, which are detectable by single-strand conformational analysis (SSCA) (Feng et al., 1996; Adams et al., 1998; Martinez et al., 2008b). The Nramp1 gene, renamed Slc11a1, encodes a transmembrane transporter of divalent cation localized in the phagolysosome, which contributes to bactericide activity of macrophage (Wyllie et al., 2002). However, association of this polymorphism to natural resistance against brucellosis was not detected in naturally or experimentally infected cows in Brazil (Paixão et al., 2007), and similar findings were observed by Kumar et al. (2005).

Ables et al. (2002) described other polymorphisms in Slc11A in cattle. However, their influence on natural resistance has been not investigated. Additionally, Martinez et al. (2008a) identified novel polymorphisms in exons of the Slc11A1 gene, based on GenBank accession number AC149748, and on information previously reported by Coussens et al. (2004). In this study, were three novel polymorphisms of bovine Slc11A1 gene, namely p.D321N (SNP4), p.P356A (SNP5) and p.Q542del (SNP6), previously described by Martínez et al., (2008a), were genotyped in cows experimentally or naturally infected with B. abortus in Brazil. The frequency of each genotype and its association to the resistant or susceptible phenotypes to brucellosis in cows were evaluated.

The resistant phenotype in experimentally infected cows was based on the occurrence of normal parturition in spite of a challenge with a high inoculum of B. abortus during gestation. Fifty-nine crossbred heifers ranging from 20 to 30 months of age were used in this experiment as previously described (Poester et al., 2006, Paixão et al., 2007). All heifers were serologically negative for brucellosis before challenge, as assessed by the rose bengal plate agglutination test (RBPAT). The heifers underwent estrous synchronization followed by artificial insemination. Pregnancy was confirmed by ultrasonography at 35 days after insemination. Between six and seven months of pregnancy, the heifers were challenged by conjunctival administration of the virulent B. abortus strain 2308. Each heifer was inoculated with 50µL in each eye (total of 100µL per heifer) of a bacterial suspension containing 3.0x108CFU/mL. They were then observed permanently until abortion or calving. This experimental protocol was approved by the local Committee for Ethical Use of Experimental Animals (CETEA-UFMG, protocol 028/05). Cows were euthanized by electrocution after intravenous administration of 15 to 20mg/kg of body weight of xylazine (Coopazine, Coopers, Brazil), and then necropsied within 48 hours after abortion or parturition. Fragments of liver were collected from cows and stored at -20ºC for subsequent DNA extraction by guanidinium thiocyanate protocol (Paixão et al., 2007).

A crossbred herd with high rate of abortion and a high seroprevalence of B. abortus (>50%) was used in this study. No records of vaccination against brucellosis were available for this herd. One hundred lactating cows were selected for collection of blood and serum. Serum samples were analyzed for detection of anti-B. abortus antibodies by RBPAT, standard tube agglutination test (STAT) and 2-mercaptoethanol (2-ME) test. Results were expressed as positive or negative for the RBPAT, and complete agglutination at a dilution of 1:25 or higher was considered positive by 2-ME test. Resistant phenotype in naturally infected cows was based on negative serological results to Brucella diagnostic test (AAT and 2M) since all cows in the herd had been exposed to a high challenge considering the large number of cows serologically positive, with reproductive history of abortion due to B. abortus confirmed by bacteriology of vaginal swab. Blood sample collected in EDTA tubes were used to DNA extraction. DNA from white blood cells was extracted using the guanidinium thiocyanate protocol (Paixão et al., 2007).

DNA samples were subjected to genotyping by PCR to detect three new polimorphisms of coding regions Nramp1 using primers: SNP4-F 5'GGCTTGGAGGTCTGATTTTC and SNP4-R 5'CGTTGGCTTGCTTACTCCTT, product of 176 bp; SNP5-F 5'CAAGGAGTAAGCAAGCCAAC and SNP5-R 5'GCTGCCTTAAGGATCAAGGA, product of 350 bp; and SNP6-F 5'TTCCTGTATGGGCTTCCTG and SNP6-R 5'CTTGCTGCCTTCACACACAT, product of 158bp. PCR amplification was performed using Taq DNA Polymerase (Invitrogen, USA), with the following parameters: an initial incubation at 94ºC for 5min, followed by 33 cycles of 95ºC for 1min, 56ºC for 1min and 72ºC for 1min and finally 4 min at 72ºC. To detect the SNP (single nucleotide polymorphism), 20-100ng of the amplicons were directly subjected to SSCA analysis by mixing the amplicons (v/v) with denaturing 2X SSCA loading buffer (95% formamide, 0.6% bromophenol blue and 0.6% xylene cyanole), heating at 94ºC for 5min, snap chilling on ice and loading onto 29:1 acrylamide:bis-acrylamide 8% polyacrylamide gels prepared with TBE buffer. Electrophoresis was allowed to run at 10ºC and 4W for 15 hours and gels were then silver stained (Barroso et al., 1997).

The frequencies of polymorphisms of bovine Slc11A1 with a resistant or susceptible phenotype in experimental or natural infections with B. abortus are summarized in Tables 1 and 2. The homozygous genotypes CC from SPN4 and AA from SPN5 were more frequent in susceptible naturally infected cows. These results indicate a link between Slc11A1 genotype and actual resistance, which supports the notion that Slc11A1 genotyping may eventually provide an approach for genetic selection of brucellosis-resistant cattle. Although there are still controversial results regarding influence of Slc11A1 alleles on natural resistance against brucellosis (Paixão et al., 2007; Martinez et al., 2008b), this study is a significant contribution towards the development of a protocol for selection of genetically resistant cattle.

This work was supported by CNPq (Conselho Nacional de Desenvolvimento Científico e Tecnológico, Brasília, Brazil) and FAPEMIG (Fundação de Amparo a Pesquisa do Estado de Minas Gerais, Belo Horizonte, Brazil). RLS is recipient of a fellowship from CNPq.

ABLES, G.P.; NISHIBORI, M.; KANEMAKI, M. et al. Sequence analysis of the NRAMP1 genes from different bovine and buffalo breeds. J. Vet. Med. Sci. v.64, p.1081-1083, 2002.         [ Links ]

ADAMS, L.G.; TEMPLETON, J.W. Genetic resistance to bacterial diseases of animals. Rev. Sci. Tech. Off. Int. Epizoot., v. 7, p.200-219, 1998.         [ Links ]

BARROSO, A.; DUNNER, S.; CANÕN, J. Use of a single strand conformation polymorphism analysis to perform a simple genotyping of bovine k- casein A and B variants. J. Dairy Res., v.64, p.535-540, 1997.         [ Links ]

CARVALHO NETA, A.V.; MOL, J.P.; XAVIER, M.N. et al. Pathogenesis of bovine brucellosis. Vet. J., v.184, p.146-155, 2010.         [ Links ]

COUSSENS, P.M.; COUSSENS, M.J.; TOOKER, B.C. et al. Structure of the bovine natural resistance associated macrophage protein (NRAMP) gene and identification of a novel polymorphism. DNA Seq., v.15, p.15-25, 2004.         [ Links ]

FENG, J.; LI, Y.; HASHAD, M. et al. Bovine natural resistance associated macrophage protein 1 (Nramp1) gene. Genome Res., v.6, p.956-964, 1996.         [ Links ]

KUMAR, N.; MITRA, A.; GANGULY, I. et al. Lack of association of brucellosis resistance with (GT)(13) microsatellite allele at 3'UTR of NRAMP1 gene in Indian zebu (Bos indicus) and crossbred (Bos indicus x Bos taurus) cattle. Vet. Microbiol., v.111, p.139-143, 2005.         [ Links ]

MARTÍNEZ, R.; DUNNER, S.; BARRERA, G. Novel variants within the coding regions of the Slc11A1 gene identified in Bos taurus and Bos indicus breeds. J. Anim. Breed Genet., v.125, p.57-62, 2008a.         [ Links ]

MARTÍNEZ, R.; TORO, R.; MONTOYA, F. et al. Bovine SLC11A1 3' UTR SSCP genotype evaluated by a macrophage in vitro killing assay employing a Brucella abortus strain. J. Anim. Breed Genet., v.125, p.271-279, 2008b.         [ Links ]

PAIXÃO, T.A.; POESTER, F.P.; CARVALHO NETA, A.V. et al. NRAMP1 3' untranslated region polymorphisms are not associated with natural resistance to Brucella abortus in cattle. Infect. Immun., v.75, p.2493-2499, 2007.         [ Links ]

POESTER, F.P.; GONÇALVES, V.S.P.; PAIXÃO, T.A. et al. Efficacy of strain RB51 vaccine in heifers against experimental brucellosis. Vaccine, v.24, p.5327-5334, 2006.         [ Links ]

WYLLIE, S.; SEU, P.; GOSS, J.A. The natural resistance-associated macrophage protein 1 Slc11a1 (formerly Nramp1) and iron metabolism in macrophages. Microbes Infect., v.4, p.351-359, 2002.         [ Links ]

Recebido em 6 de março de 2012
Aceito em 1 de agosto de 2012

All the contents of this site, except where otherwise noted, is licensed under a Creative Commons Attribution License.