SciELO - Scientific Electronic Library Online

 
vol.65 issue1Comparative study of maniçoba hay crude protein in relation to alfafa hay crude protein in the diet of rabbitsCarcass characteristics and empty body of Charolais cattle of different categories slaughtered at similar degree of fatness author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

Share


Arquivo Brasileiro de Medicina Veterinária e Zootecnia

Print version ISSN 0102-0935

Arq. Bras. Med. Vet. Zootec. vol.65 no.1 Belo Horizonte Feb. 2013

http://dx.doi.org/10.1590/S0102-09352013000100039 

ZOOTECNIA E TECNOLOGIA E INSPEÇÃO DE PRODUTOS DE ORIGEM ANIMAL

 

Polimorfismos genéticos da kappa-caseína e da beta-lactoglobulina e produção de leite em bovinos

 

Kappa-casein and beta-lactoglobulin genetic polymorphisms and milk yield in bovines

 

 

A.T. StippI; P.R. BignardiI; R.C. Poli-FredericoI; K. SivieriII; M.R. CostaIII,*

IUniversidade Norte do Paraná – UNOPAR – Londrina, PR
IIUniversidade Estadual Paulista – UNESP – Araraquara, SP
IIIUniversidade Federal de Mato Grosso do Sul – UFMS – Campo Grande, MS

 

 


RESUMO

As variantes gênicas da beta-lactoglobulina (β-LG) e da kappa-caseína (κ-CN) bovinas são associadas à produção, qualidade e características de processamento do leite. O objetivo deste trabalho foi analisar as frequências dos genótipos AA, AB e BB, por meio da técnica de PCR-RFLP, da β-LG e da κ-CN bovinas, e suas associações com a produção de leite (kg leite/dia) em bovinos das raças Girolanda, Holandesa e Jersey. Para a κ-CN, a frequência do genótipo AA foi maior nos animais das raças Holandesa (37%) e Girolanda (63%). Na raça Jersey, houve predomínio do genótipo BB (60%). Para a β-LG, o genótipo AB foi o mais encontrado nas raças Girolanda (54%) e Holandesa (58%), enquanto nos animais da raça Jersey houve predomínio do genótipo BB (45%). Houve associação do alelo B da κ-CN com maior produtividade leiteira nas raças Girolanda e Holandesa, e do alelo A da β-LG com maior produtividade de leite na raça Jersey. As variantes genéticas da κ-CN podem ser usadas como marcadores na seleção para a produtividade leiteira nas raças Girolanda e Holandesa. Para a raça Jersey, as variantes da β-LG seriam mais adequadas para essa seleção.

Palavras-chave: leite, proteínas do soro do leite, caseínas, frequência de genótipos


ABSTRACT

Bovine beta-lactoglobulin (β-LG) and kappa-casein (κ-CN) genic variants are associated with productivity, quality and processing features of milk. The objective of this study was to analyze through the PCR-RFLP technique, the frequency of AA, AB and BB genotypes of bovine β-LG and κ-CN, and their association to milk production (kg milk/day) in Girolanda, Holstein and Jersey cattle. For κ-CN, the frequency of the AA genotype was higher in Holstein (37%) and Girolanda (63%), while there was a predominance of the BB genotype in Jersey (60%). For β-LG, the BB genotype was the most found in Girolanda (54%) and Holstein (58%), while there was a predominance of the BB genotype (45%) in Jersey. There was a positive association between B allele of κ-CN and milk production in the Girolanda and Holstein cattle and between A allele of β-LG and milk production in the Jersey cattle. Genetic variants of κ-CN could be used as markers for the selection for productivity in Girolanda and Holstein cattle. The genetic variants of β-LG would be more appropriate for this selection in the Jersey breed.

Keywords: milk, whey proteins, caseins, frequency of genotypes


 

 

INTRODUÇÃO

O polimorfismo genético com relação às proteínas lácteas, em particular kappa-caseína (κ-CN) e beta-lactoglobulina (β-LG), tem sido associado a diferenças na composição, características de processamento e qualidade do leite, além de parâmetros de produtividade (Lin et al., 1986; Aleandri et al., 1990; Fox e McSeweeney, 2003). Diferentes versões de uma sequência de DNA em um determinado local cromossômico (locus) são chamadas de alelos. O polimorfismo genético ocorre quando diferentes formas alélicas de um mesmo locus gênico podem ser observadas na frequência de pelo menos 1% em uma população (Watson e Berry, 2006).

A beta-lactoglobulina foi a primeira proteína láctea na qual o polimorfismo foi detectado (Aschaffenburg e Drewry, 1955). Desde então, foram descobertos polimorfismos nos genes que codificam as caseínas e grande parte das principais proteínas do soro do leite (Fox e McSweneey, 2003). Diferenças entre genótipos podem alterar a estrutura primária das proteínas e resultar em alterações de suas propriedades físico-químicas (Hill et al., 1996).

Dentre as cinco variantes genéticas principais, A-E, da β-LG em bovinos, A e B são as mais frequentes. A β-LG apresenta uma molécula com 162 aminoácidos e as variantes A e B diferem nas posições 64 e 118. A variante A possui ácido aspártico na posição 64 e valina na 118, enquanto a variante B apresenta glicina e alanina nessas posições (Fox e McSweneey, 2003).

Já foram encontradas diversas variantes genéticas da κ-CN, sendo A e B as mais frequentes. As variantes A e B diferem nos aminoácidos 136 e 148, respectivamente. Para a variante A na posição 136, a treonina é substituída por isoleucina; e na posição 148, para a variante B, o ácido aspártico é substituído por alanina (Alexander et al., 1988).

A β-LG é a proteína encontrada em maior concentração no soro de leite bovino, representando cerca de 50% das proteínas do soro e 12% do total de proteína no leite. Já a k-caseína, apesar de estar em relativamente baixa proporção comparada às outras caseínas (12%), é essencial na estabilização das micelas de caseínas no leite (Walstra et al., 2006).

A identificação de genes polimórficos que codificam as principais proteínas do leite pode permitir uma melhor compreensão do comportamento do leite durante o processamento pela indústria (Paterson et al., 1999). Esses genes que codificam as proteínas do leite podem ser úteis como marcadores genéticos para critérios de seleção e cruzamentos de animais de gado leiteiro. Além disso, investigações de associações entre polimorfismo e características quantitativas e qualitativas do leite podem direcionar sua utilização pela indústria.

O presente estudo teve como objetivos avaliar a frequência dos genótipos AA, AB e BB da kappa-caseína e da beta-lactoglobulina bovinas nas raças Girolanda, Holandesa e Jersey, e verificar a possível associação desses genótipos com a produção de leite.

 

MATERIAL E MÉTODOS

A produtividade leiteira de cada animal foi calculada através da média dos últimos seis meses (kg leite/ dia) de lactação.

Para extração do DNA, foram coletados 5mL de sangue da circulação periférica, em tubo estéril contendo anticoagulante EDTA (6%) de animais das raças Holandesa (n=38), Girolanda (n=48) e Jersey (n=42), previamente selecionados de rebanhos de uma fazenda experimental, Tamarana-PR. Os tubos com sangue foram transportados e mantidos refrigerados até a realização da extração do DNA. O DNA genômico de cada animal foi extraído a partir de 1mL da massa leucocitária do sangue coletado, utilizando o PureLinkTM Genomic DNA Extraction Mini kit (Invitrogen Biosicence). O DNA extraído foi mantido em ultrafreezer (-73 a -80 ºC) até a realização das análises.

As amostras de DNA foram submetidas à amplificação por meio da reação em cadeia da polimerase (PCR) e à clivagem por meio da técnica de polimorfismo de tamanho de fragmentos de restrição (RFLP) de acordo com os procedimentos descritos por Medrano e Aguilar-Cordoba (1990ab). Os oligonucleotídeos iniciadores (primers) utilizados foram sintetizados (Invitrogen® ) conforme as sequências:

5'ATCATTTATGGCCATTCCACCAAAG3' (JK5) e 5'GCCCATTTCGCCTTCTCTGTAACAGA3' (JK3) para a κ-CN, e

5'GTCCTTGTGCTGGACACCGACTACA3' (BLGP3) e

5'CAGGACACCGGCTCCCGGTATATGA3' (BLGP4) para a β-LG.

As amplificações foram realizadas em termociclador Multigene II (Labnet International Inc.). Em todas as reações de amplificação, utilizou-se um controle negativo (sem DNA), para confirmar a ausência de contaminação na execução da análise. O DNA amplificado foi mantido em ultrafreezer até a realização do RFLP. Para a confirmação da amplificação das amostras, realizou-se eletroforese em gel de agarose a 0,8%, em cuba horizontal de acrílico com tampão de corrida TBE 1X a 60 volts, por 60 minutos, utilizando SYBR SAFE® como corante.

O produto da PCR passou pela análise de RFLP utilizando as enzimas de restrição Hinf I para κ-CN e Hae III para a β-LG para clivagem a 37ºC por 12 horas. Os fragmentos de DNA resultantes foram separados em gel de poliacrilamida 6% com corrida a 70 V e depois corados com nitrato de prata.

Os resultados obtidos foram analisados por meio de análise de variância e teste Tukey, a 5% de significância.

 

RESULTADO E DISCUSSÃO

O produto amplificado para a proteína κ-CN correspondeu a um fragmento de 350 pares de bases (pb), do éxon IV do gene para a κ-CN bovina. Esse fragmento foi clivado pela endonuclease Hinf I, cujo sítio de reconhecimento é a sequência GANTC. Como resultado, o genótipo AA apresentou três fragmentos de 132, 134 e 84pb, o genótipo BB, dois de 266 e 84pb, e o genótipo AB, quatro fragmentos de 266, 134, 132 e 84pb.

Para a proteína β-LG, o produto amplificado do DNA correspondeu a um fragmento de 262 pb, do éxon IV do gene da β-LG. A digestão com a enzima Hae III tem como sítio de reconhecimento a sequência GGCC. Para o genótipo AA foram encontradas três bandas de 153, 79 e 74pb, para o genótipo BB, três bandas de 109, 79 e 74pb, e para o genótipo AB, quatro bandas de 153, 109, 79 e 74pb. Na Fig. 1 mostram-se as frequências genotípicas encontradas nas três raças estudadas.

Para a κ-CN, a raça Girolanda apresentou maior número de animais com genótipo AA, 63%, enquanto a Jersey apresentou maior frequência do genótipo BB, 60%. Na raça Holandesa foram encontradas frequências similares para os três genótipos possíveis, ~30% cada. Botaro et al. (2009) avaliaram rebanhos do interior do estado de São Paulo e encontraram uma frequência do genótipo AA de 67% na raça Girolanda e de 71% na raça Holandesa. Buchberger (1995) relatou menores frequências do alelo A na raça Jersey, que variou entre 0,49 e 0,32. A alta frequência do alelo A do gene da κ-CN na raça Girolanda provavelmente está relacionada à sua origem em cruzamentos das raças Gir e Holandesa. Sabe-se que há uma alta frequência do genótipo AA na raça Gir (Valente, 1996; Rodrigues, 2006).

Relatos da literatura apontam que o alelo B da kappa-caseína tem efeito significativo sobre a qualidade do leite para a produção de queijo (Mao et al., 1992). Van der Berg et al. (1992) encontraram alta frequência do alelo B na raça Jersey e afirmaram que a presença desse alelo contribuiu com 8 a 10% na composição proteica do leite. Assim, o leite produzido por vacas de genótipo BB mostraram maior rentabilidade na produção de queijos quando comparadas às vacas de genótipo AA.

Ng-Kwai-Hang et al. (1987) verificaram que o leite de animais com genótipo BB para a κ-CN apresenta maiores teores de αs1-CN, κ-CN, soroalbumina e imunoglobulinas, e menores de β-CN, β-LG e α-La. O alelo B, em geral, também é associado às melhores características para o processamento industrial do leite. A utilização de leite oriundo de animais com esse genótipo resulta em menor tempo de coagulação para o preparo de queijo, formação de coágulo com maior densidade devido ao menor tamanho da micela, assim como uma maior produção de queijo em relação ao leite de vacas com o genótipo AA para a κ-CN (Medrano e Aguilar-Cordoba, 1990 a; Hallén et al., 2007).

Para a β-LG, o genótipo AB foi o mais frequente nas raças Girolanda (54%) e Holandesa (58%), enquanto na raça Jersey a maior frequência foi do genótipo BB (45%) (Fig. 1). Frequências similares foram observaram em diversos locais por outros autores.

Rodrigues (2006), ao avaliar rebanhos de Minas Gerais, obteve uma frequência de 57% para o genótipo AB da β-LG na raça Girolanda. Na raça Holandesa, Celik (2003) observou maior frequência (53%) do genótipo BB na Nova Zelândia, enquanto Ojala et al. (1997), na California, e Orner e Elmaci (2006), na Turquia, do genótipo AB (51-56%). Para a raça Jersey, vários autores verificaram maior frequência para o heterozigoto AB, de 43% na Holanda (Paterson et al., 1999), 51% na Nova Zelândia (Hill et al., 1993) e 58% na Califórnia (Ojala et al., 1997).

Vários estudos foram realizados sobre o efeito dos genótipos da β-LG sobre a produção de leite. O genótipo AA tem demonstrado ter efeito favorável sobre a quantidade de proteínas e o rendimento na produção de leite, enquanto os efeitos positivos do genótipo BB têm sido relacionados ao maior teor de gordura (Bovenhuis et al., 1992) e caseína (Lodes et al., 1997). Isso acarreta maior rendimento na produção de queijos e implicações na textura e caracterização sensorial de produtos lácteos. Além disso, o alelo B da β-LG está relacionado a maior estabilidade térmica do leite (Fox e McSwenney, 2003).

Segundo Molina et al. (2006), há interação entre as variantes genéticas de κ-CN e β-LG, as quais apresentam combinação mais favorável entre a κ-CN A e a β-LG AA, e a κ-CN B e a β-LG AB para maior conteúdo proteico no leite da raça Holandesa.

Houve associação do genótipo para κ-CN com a produtividade (P<0,05) nas raças Girolanda e Holandesa (Tab. 1). Nos animais da raça Girolanda, o genótipo BB foi o que apresentou maior produção de leite, enquanto na raça Holandesa os genótipos AB e BB mostraram maior produção do que os AA. A produtividade leiteira foi associada com os genótipos da β-LG somente para a raça Jersey, na qual os genótipos AA e AB apresentaram a maior produtividade. As diferenças encontradas não foram significativas (P>0,05) para as raças Holandesa e Girolanda com relação aos genótipos da β-LG.

Para cada proteína, valores com letras distintas na coluna diferem entre si (P<0,05).

Não há um consenso na literatura sobre a influência dos alelos A e B do gene para a κ-CN sobre a produtividade leiteira (Fox e McSwenney, 2003). Alguns estudos com as raças Holandesa e Girolanda, não verificaram correlação entre as variantes genéticas da κ-CN e a produtividade (Lin et al., 1986; Ng-Kwai-Hang et al., 1990), enquanto outros sugeriram que, para animais da raça Holandesa, Ayrshire e Jersey, a κ-CN AA (Bovenhuis et al., 1992) ou a κ-CN AB (Kim et al., 1996) ou a κ-CN BB (Pupkova, 1980) são positivamente associadas com a produção leiteira.

Com relação à β-LG, Jairam e Nair (1983) e Marziali e Ng-Kwai-Hang (1986) observaram maior produção de leite para vacas da raça Holandesa com genótipo BB. Já nos trabalhos de Comberg et al. (1964), Atroshi et al. (1982) e Bovenhuis et al. (1992), a variante A foi relacionada com maior produção de leite em bovinos das raças Jersey e Gir. Cowan et al. (1992) não encontraram diferença na produção leiteira entre os genótipos da beta-lactoglobulina bovina.

Essas diferenças entre estudos com a mesma raça ocorrem, provavelmente, em função de outros fatores, como clima e alimentação (Fox e McSwenney, 2003), os quais podem variar entre os diversos experimentos.

 

CONCLUSÃO

No presente estudo, os genótipos AA, AB e BB para a kappa-caseína e para beta-lactoglobulina bovinas foram encontrados em diferentes frequências nas três raças avaliadas. Além disso, foi verificada associação do alelo B da κ-CN com maior produtividade leiteira nas raças Girolanda e Holandesa e do alelo A da β-LG com maior produtividade leiteira na raça Jersey. Esses resultados indicam que as variantes genéticas da κ-CN podem ser usadas como marcadores na seleção para a produtividade leiteira para as raças Girolanda e Holandesa e as variantes da β-LG nessa seleção para a raça Jersey. O conhecimento desses dados genotípicos permitiria um direcionamento mais adequado dos cruzamentos e a seleção de animais precocemente, contribuindo significativamente para a melhoria na produção de leite nesses rebanhos.

 

REFERÊNCIAS

ALEANDRI, R.; BUTTAZZONI, L.G.; SCHNEIDER, J.C. et al. The effects of milk protein polymorphisms on milk components and cheese producing ability. J. Dairy Sci., v.73, p.241-255, 1990.         [ Links ]

ALEXANDER, L.J.; STEWART, A.F.; MACKINLAY, A.G.; KAPELINSKAYA, T. V. Isolation and characterization of the bovine kappa-casein gene. Eur. J. Biochem., v.178, p.395-401, 1988.         [ Links ]

ASCHAFFENBURG, R.; DREWRY, J. Occurrence of different beta-lactoglobulins in cow's milk. Nature, v.176, p.218-219, 1955.         [ Links ]

ATROSHI, F.; KANGASNIEMI, R.; HONKANON-BUZALSKI, T. Betalactoglobulin phenotypes in Finnish Ayrshire and Friesian cattle with special reference to mastitis indicators. Acta Vet. Scand., v.22, p.135, 1982.         [ Links ]

BOTARO, B.G.; LIMA, Y. V. R.; CORTINHAS, C.S. et al. Effect of the kappa-casein gene polymorphism, breed and seasonality on physicochemical characteristics, composition and stability of bovine milk. Rev. Bras. Zootec., v.38, p.2447-2454, 2009.         [ Links ]

BOVENHUIS, H.; JOHAN, A.M.; ARENDONK, V.; KORVER, S. Association between milk protein polymorphisms and milk production traits. J. Dairy Sci., v.75, p.2549-2559, 1992.         [ Links ]

BUCHBERGER, J. Genetics polymorphisms of milk protein: differences between breeds. Bull. Int. Dairy Fed., n.304, p.5-6, 1995.         [ Links ]

CELIK, S. Beta-Lactoglobulin genetic variants in Brown Swiss breed and association with compositional properties and rennet clotting time of milk. Int. Dairy J., v.13, p.727-731, 2003.         [ Links ]

COMBERG, G.H.; MEYER, H.; GROWING, M. Correlation between beta-lactoglobulin types in cattle and age at first calving, milk yield and fat contents and distribution of protein fraction. Zuchtungskunde, v.36, p.248-255, 1964.         [ Links ]

COWAN, C.M.; DENTINE, M.R.; COYLE, T. Chromosome substitution effects associated with k-casein and β-lactoglobulin in Holtein cattle. J. Dairy Sci., v.75, p.1097-1104, 1992.         [ Links ]

FOX, P.F.; McSWEENEY, P.L.H. Advanced dairy chemistry: proteins. 3. ed. New York: Kluwer Academic, 2003. v.1. 740p.         [ Links ]

HALLEN, E.; ALLMERE, T.; NASLUND, J. et al. Effect of genetic polymorphism of milk proteins on rheology of chymosin-induced milk gels. Int. Dairy J., v.17, p.791-799, 2007.         [ Links ]

HILL, J.P. The relationship between beta-lactoglobulin phenotypes and milk composition in New Zealand dairy cattle. J. Dairy Sci., v.76, p.281-286, 1993.         [ Links ]

HILL, J.P.; BOLAND, M.J.; CREAMER, L.K. et al. Effect of the bovine beta-lactoglobulin phenotype on the properties of beta-lactoglobulin, milk composition and dairy products. Macromol. Inter. Food Technol., v.650, p.281-294, 1996.         [ Links ]

JAIRAM, B.T.; NAIR, P.G. Genetic polymorphisms of milk protein and economic characters in dairy animals. Indian J. Anim. Sci., v.53, p.1-8, 1983.         [ Links ]

KIM, S.; NG-KWAI-HANG, K.F.; HAYES, J.F. The relationship between milk protein phenotypes and lactation traits in Ayrshires and Jerseys. Asian-Aust. J. Anim. Sci., v.9, p.685-693, 1996.         [ Links ]

LIN, C.Y.; McALLISTER, K.F.; NG-KWAIHANG, K.F. Effects of milk protein loci on first lactation production in dairy cattle. J. Dairy Sci., v.69, p.704-712, 1986.         [ Links ]

LODES, A.; BUCHEBERGER, J.; KRAUSE, I. et al. The influence of genetic variants of milk proteins on the compositional and technological properties of milk: 3. Content of protein, casein, whey protein and casein number. Milchwissenschaft, v.52, p.3-8, 1997.         [ Links ]

Mao, I.L.; Buttazozoni, L.G.; Aleandri, R. Effects of Polymorphic milk protein genes on milk yield and composition traits in Holstein cattle. Acta Agr. Scand., v.42, p.1-7, 1992.         [ Links ]

MARZIALI, A.S.; NG-KWAIN-HANG, K.F. Effects of milk composition and genetic polymorphism on cheese composition. J. Dairy Sci., v.69, p.2533-2542, 1986.         [ Links ]

MEDRANO, J.F.; AGUILAR-CORDOVA, E. Genotyping of bovine kappa-casein loci following DNA sequence amplification. Bio/Technol., v.8, p.144-146, 1990a.         [ Links ]

MEDRANO, J.F.; AGUILAR-CORDOVA, E. Polymerase chain reaction amplification of bovine β-lactoglobulin genomic sequences and identification of genetic variants by RFLP analysis. Anim. Biotechnol., v.1, p.73-77, 1990b.         [ Links ]

MOLINA, L.H.; KRAMM, J.; BRITO, C. et al. Protein composition of milk from Holstein-Friesian dairy cows and its relationship with the genetic variants A and B of kappa-casein and beta-lactoglobulin (Part I). Int. J. Dairy Technol., v.59, p.183-187, 2006.         [ Links ]

NG-KWAI-HANG, K.F.; HAYES, J.F.; MOXLEY, J.E.; MONARDES, H.G. Relationships between milk protein polymorphisms and major milk constituents in Holstein-Friesian cows. J. Dairy Sci., v.69, p.22-26, 1986.         [ Links ]

NG-KWAI-HANG, K.F.; HAYES, J.F.; MOXLEY, J.E.; MONARDES, H.G. Variation in milk protein concentration associated with genetic polymorphism and environmental factors. J. Dairy Sci., v.70, p.563-570, 1987.         [ Links ]

NG-KWAI-HANG, K.F.; MONARDES, H.G.; HAYES, J.F. Association between genetic polymorphism of milk proteins and production traits during three lactations. J. Dairy Sci., v.73, p.3414-3420, 1990.         [ Links ]

OJALA, M.; FAMULA, T.R.; MEDRANO, J.F. Effects of milk protein genotypes on the variation for milk production traits of Holstein and Jersey cows in California. J. Dairy Sci., v.80, p.1776-1785, 1997.         [ Links ]

ORNER, Y.; ELMACI, C. Milk protein polymorphisms in Holstein cattle. Int. J. Dairy Technol., v.59, p.180-182, 2006.         [ Links ]

PATERSON, G.R.; MacGIBBON, A.K.H.; HILL, J.P. Influence of kappa-casein and beta-lactoglobulin phenotype on the heat stability of milk. Int. Dairy J., v.9, p.375-376, 1999.         [ Links ]

PUPKOVA, G.V. Milk protein polymorphism and milk production of Estonian Black Pied cows. Dairy Sci. Abstr., v.45, p.6620, 1980.         [ Links ]

RODRIGUES, S.G. Estudo das frequências dos alelos A e B dos genes da kappa-caseína e beta-lactoglobulina e suas associações com produção de leite em bovinos F1 Girolando. 2006. 30f. Tese (Doutorado em Ciência Animal) – Universidade Federal de Minas Gerais, Belo Horizonte.         [ Links ]

VALENTE, E.P. Levantamento das frequências dos fenogrupos do sistema B de grupos sanguíneos e dos alelos A e B do gene da k-caseína em populações das raças Holandesa e Gir do Estado de Minas Gerais. 1996. 69f. Dissertação (Mestrado em Medicina Veterinária) - Escola de Veterinária da Universidade Federal de Minas Gerais, Belo Horizonte.         [ Links ]

Van der Berg, G.; Escher, J.T.M.; DE Konning, P.J.; Bovenhuis, H. Genetic polymorphism of κ- casein and β-lactoglobulin in relation to milk composition and processing. Neth. Milk Dairy J., v.46, p.145-168, 1992.         [ Links ]

WALSTRA, P.; WOUTERS, J.T.M.; GEURTS, T.J. Dairy science and technology. 2nd ed. Boca Raton: Taylor & Francis, 2006. 782p.         [ Links ]

WATSON, J.D.; BERRY, A. DNA: the secret of life. New York: Alfred A. Knopf, 2006. 446p.         [ Links ]

 

 

Recebido em 16 de junho de 2011
Aceito em 10 de setembro de 2012

 

 

*Autor para correspondência (corresponding author)
Email: marcela.rezende@ufms.br

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License