SciELO - Scientific Electronic Library Online

 
vol.69 issue5Factor analysis as a tool to estimate association among individual proteins and other milk components with casein micelle size and cheese yieldPrepubic urethral transposition in a male dog with extensive stenosis of the pelvic urethra author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

Share


Arquivo Brasileiro de Medicina Veterinária e Zootecnia

On-line version ISSN 1678-4162

Arq. Bras. Med. Vet. Zootec. vol.69 no.5 Belo Horizonte Sept./Oct. 2017

http://dx.doi.org/10.1590/1678-4162-9439 

Communication

Abortion and fetal death in bitches due anemia caused by vector-borne diseases

Abortamento e morte fetal em cadelas devido anemia causada por doenças transmitidas por vetores

D.A.C. Freire1 

I.V.P.M. Oliveira1 

H.I.P. Ferreira1 

V.C.P. Andrade2 

C.R.F. Silva2 

J.K. Kurissio3 

L.S. Ullmann3 

C.D. Malossi3 

S.F. Joaquim3 

J.P. Araújo Júnior3 

H. Langoni2 

C. Calabuig1 

J. Megid1 

J.M.A.P. Antunes1  * 

1Universidade Federal Rural do Semi-Árido -UFERSA/RN - Mossoró, RN

2UNESP - Universidade Estadual Paulista - Botucatu, SP

3IBTEC - Instituto de Biotecnologia - UNESP - Universidade Estadual Paulista - Botucatu, SP

RESUMO

Doenças infecciosas são as maiores responsáveis por falhas reprodutivas (FR) em cadelas, causando aborto, morte fetal e natimortalidade. Este estudo teve como objetivo investigar a associação entre agentes infecciosos, FR inexplicáveis e anemia em cadelas. Todas as amostras maternas e fetais foram negativas para a presença dos principais agentes infecciosos causadores de FR: herpes vírus canino 1, Neospora caninum, Brucella spp. e B. canis, enquanto agentes como o de Leishmania spp., parvovírus canino, Ehrlichia canis e Anaplasma platys foram encontrados em sangue materno. Coinfecções de A. platys/E. canis e A. platys/Leishmania spp. foram diagnosticadas. Os resultados indicam que os animais com anemia causadas por doenças transmitidas por vetores podem ser mais suscetíveis a sofrerem FR do que animais com valores hematológicos normais.

Palavras-chave: Anaplasma; Ehrlichia; Leishmania; falhas reprodutivas

Many authors consider male infertility and mistimed breeding as the major causes of reproductive failure (RF) in bitches. However, once these causes are excluded, the role of infectious diseases in pregnancy losses should be addressed. The impact of infectious diseases on the normal progression of pregnancy can be associated with the direct action of the infectious agents or their toxins, inducing placentitis that leads to fetal death (Givens and Marley, 2008). In dogs, the viral action of the canid herpesvirus 1 (CaHV-1) and the bacterium Brucella canis have been found to be the main causes of reproductive problems. In Brazil, leishmaniasis, parvoviruses, and tick-borne diseases (Anaplasma platys and Ehrlichia canis) are endemic, particularly in the North-East region, and all these pathogens can cause anemia. Apart from these agents, previous studies on reproductive disorders in dogs have neglected other pathogens such as Neospora caninum (Greene, 2012). Due to the lack of research concerning potential causes of RF, this study was designed to investigate the association between infectious agents, unexplained RF (abortion, stillbirth, or fetal death), and anemia in bitches.

Samples from 36 pregnant dogs (20 with RF and 16 without RF) treated at the Veterinary Hospital Jerônimo Dix-Huit Rosado Maia-HOVET in the Federal Rural University of the Semi-Arid (UFERSA) in Mossoró/RN, North-East Brazil, were obtained according to the Ethics Committee on Animal Use (CEUA) under license number 23091.006326/2014-88 (date of approval March 3rd, 2015). Depending on the clinical condition: RF (unhealthy) or without RF (healthy), tissue samples were collected through ovariosalpingohisterectomy, Caesarean, parturition, and through the post-mortem examination of the uterus, placenta, and fetus. Blood samples were collected after the RF episodes or after parturition in healthy bitches, and a complete blood count (CBC) was performed in both groups. In both groups, using a STRATEC Molecular kit (Invitek), DNA was extracted from the female dogs (blood/serum for all bitches, and uterus/placenta in unhealthy group) and from fetus (amniotic fluid, fetal abdominal fluid, and pool of liver/spleen and kidney/lung) of the bitches with RF. The samples were subjected to molecular/serological immunodiagnostic tests, both for detection of pathogens related to RF and for anemia (hemoglobin, erythrocytes, and hematocrit below the reference values, Table 1). A Chi-square test was used to determine if there was a relation between the presence/absence of the infectious pathogens and RF. In addition, an analysis of variance (ANOVA) was conducted to determine if RF was related to the blood biochemistry parameters measured (anemia).

Table 1 Molecular and serologic tests used for detection of pathogens in bitches 

Molecular Test Microorganism Analyzed material Sequence 5´ - 3´
qPCR* Canid herpesvirus1 Blood, fetal fluid, pool of spleen+kidneys, pool of liver+lungs ACAGAGTTGATTGATAGAAGAGGTATG
CTGGTGTATTAAACT TTGAAGGCTTTA
6-FAM- TCTCTGGGGTCTTCATCCTTAT CAAATGCG- BHQ1
PCR Brucella spp. Blood and placenta ACATAGATCGCAGGCCAGTCA
AGATACCGACGCAAACGCTAC
HRM-qPCR* Ehrlichia spp. E. canis Blood and pool of spleen+kidneys CTCAGAACGAACGCTGG
ACCATTTCTARTGCTATYCCRTACTA
qPCR Anaplasma platys Blood TTTTTGTCGTAGCTTGCTATGATA
TGTGGGTACCGTCATTATCTTCCCCA
qPCR Neospora caninum Blood and pool of spleen+kidneys GTGAGAGGTGGGATACG
GTCCGCTTGCTCCCTA
qPCR Canine parvovirus Blood and pool of spleen+kidneys CAT TGG GCT TAC CAC CAT TT
CCA ACC TCA GCT GGT CTC AT
PCR Leishmania spp. Blood GGGTTGGTGTAAAATAGGG
CAGAACGCCCCTACCCG
Serologic test Microorganism Analyzed material Kits, antigen, and antibody
AGID* Brucella canis Serum B. ovis Reo 198 surface antigen test kit (Tec-Par)
RBT* Brucella abortus Serum B. abortus 1119-3 antigen (Biological Institute)
2ME-SAT* Brucella abortus Serum B. abortus antigen (Tec-Par)
SAT* Brucella abortus Serum B. abortus antigen (Tec-Par)
IFAT* Leishmania major Serum anti IgG Leishmania major (Center of Zoonosis Control)

*qPCR, Real Time PCR for Canid herpesvirus1; HRM, High Resolution Melting for Ehrlichia spp. E. canis; AGID, Immunodiffusion agar gel for B. canis; RBT, Rose Bengal acidification test for B. abortus; SAT, Serum agglutination Test for B. abortus; 2ME, 2-mercaptoethanol for B. abortus; IFAT, Immunofluorescence Assay for L. major.

None of the animals tested positive for the main infectious causes of RF in bitches in either group (Table 2). Canine parvovirus (CPV) was detected in the maternal blood without hematological alterations, and fetal tissues had signs of autolysis, which probably occurred after the infection (Table 3). For leishmaniasis, five females (C2, C4, C6, C9, C16; RF group) were serologically positive (Table 2). Excepting C16, the other four animals also had co-infection with A. platys; C6, C9 and C16 also had anemia with CBC with characteristics of infection (leukocytosis with neutrophilia), and C9 was positive for leishmaniasis in PCR (Table 2). Some bitches (C1, C3, C7, C13, Tab.2) presented co-infection of E. canis/A. platys, demonstrating anemia and thrombocytopenia (except female C3 which showed only anemia and CBC with characteristics of infection).

Table 2 Results of molecular/serological tests, CBC and microscopy of bitches with reproductive problems 

Bitches AGID B.canis RBT B.abortus 2ME-SAT B.abortus SAT B.abortus IFAT L.major a qPCR CaHV-1 PCR B.canis PCR Parvovirus PCR N.caninum qPCR Leishmania spp. HRM- qPCR E.canis qPCR A.platys Smear A.platys A T CBC
B1 - - - - - - - - - - + + + + + -
B2 - - - - 80 - - - - - - - + - - +
B3 - + - - - - - - - - + - + + - +
B4 - - - - 40 - - - - - - - + - - +
B5 - - - - - - - + - - - - - - - -
B6 - - - - 40 - - - - - - - + + + +
B7 - + - - - - - - - - + - + + + -
B8 - + - - - - - - - - - - - + - -
B9 - - - - 160 - - - - + - - + + - +
B10 - + - - - - - - - - - - - - - +
B11 - + - - - - - - - - + - - - - +
B12 - - - - - - - - - - - - + + - +
B13 - - - - - - - - - - + + + + + -
B14 - - - - - - - - - - - - - - - +
B15 - - - - - - - - - - - - + + - +
B16 - + - - 80 - - - - - - - - + - +
B17 - + - - - - - - - - - - - + - +
B18 - + - - - - - - - - + - - - - +
B19 - - - - - - - - - - - + - - + -
B20 - + - - - - - + - - - - - - - -

* AGID, Immunodiffusion agar gel for B. canis; RBT, Rose bengal acidification test for B. abortus; SAT, Serum agglutination test for B. abortus; 2ME, 2-mercaptoethanol for B. abortus; IFAT, Immunofluorescence assay for L. major, a Titration of antibodies; qPCR, Real Time PCR for CaHV-1, Leishmania spp., A.platys; HRM, High Resolution Melting for E.canis ; CBC, Complete blood count consistent with infection; CaHV-1, Canid herpesvirus 1; A, Anaemia; T, Thrombocytopenia

The other females with ehrlichiosis/anaplasmosis had at least one alteration in the CBC and alterations in the fetuses that suggest an infectious pathogen (Table 3). The presence or absence of the pathogen did not significantly explain the occurrence of RF (χ2 = 0.02, P>0.05, n = 20). Regarding the hematological data, a relation between anemia and RF in the animals was observed when considering the erythrocytes (F 32.2, DF= 1.33, P<0.05, Figure 1a), hemoglobin levels (F = 32.8, DF = 1.33, P<0.05, Figure 1b), and the haematocrit (F = 35, DF = 1.33, P<0.05, Figure 1c). This indicates a significant difference between animals who suffered RF (unhealthy group), and those who did not experience RF (healthy group). About the data in Tab. 2 and 3, CaHV-1, brucellosis, and neosporosis may cause abortion of fetuses in late pregnancy and foetal autolysis (Greene, 2012). A previous work also did not find B. canis or CaHV-1 in maternal tissues of bitches with RF (Mir et al., 2013). Since dogs are vaccinated for CPV, RF associated with this disease is unlikely to occur due to mass population immunity (Givens and Marley, 2008). Leishmaniasis is zoonotic and endemic in North-Eastern Brazil (Costa et al., 2014); it is a systemic disease, which can lead to anemia and placentitis (Oliveira et al., 2015).

Table 3 Post mortem exam of maternal/fetal tissues, fetuses, and gestational age of each female with reproductive disorders  

Animala Fetuses Uterus Placenta Fetal description GA
C1 F1 Diffusely red mucosa Blackened and green-yellow areas Well-developed fetus 61
C2 F1/F2 Diffusely red mucosa Blackened and green-yellow linear area Autolysis 54
C3 F1/F2 Diffusely red mucosa Autolysed Autolysis 58
C4 F1 No alterations Blackened placenta No alterations 59
F2 Blackened placenta No alterations
F3 Blackened placenta Kidneys red with black dots
F4 Blackened placenta Distended gall bladder
F5 Blackened placenta No alterations
C6 F1 Diffusely red mucosa with blackened areas Autolysed Autolysis 60
C11 F1 No alterations Autolysed Heart with severe congestion 59
F2 Autolysed Heart with severe congestion
C12 F1 No alterations Thickened placenta No alterations 47
F2 Thickened placenta No alterations
F3 Acute and diffuse liver pallor
F4 Thickened placenta Diffuse purplish spots located in the anterior and posterior limbs, and in the left cervical region
C14 F1 Mucosa thickened and diffusely red Autolysed Autolysis 60
C15 F1 No alterations Autolysed Autolysis 60
F2 Autolysis
C16 F1 Diffusely red mucosa with blackened areas Autolysed Undergoing autolysis 55
C20 F1 Diffusely red mucosa with areas of greenish colour Undergoing autolysis Undergoing autolysis 54
F2 Autolysis Undergoing autolysis
F3 Autolysis Undergoing autolysis

aFemale dogs (C5, C7, C8, C9, C10, C13, C17, C18, C19) had abortion episodes at home and the owners did not bring the fetuses to the Veterinary Hospital. GA: Gestational age in days

Figure 1 Reproductive failures (RF) in bitches due to anemia. Blood analysis comparing females that suffered of RF (unhealthy) and females that did not suffer of RF (healthy). A, Quantification of erythrocytes (mean ± standard error; in 1x106/mm3); B, Number for hemoglobin (mean ± standard error; in g/dL); C, Quantification of haematocrit (mean ± standard error; in %). 

The other four animals also had co-infection with A. platys, so we cannot infer which disease caused the anemia. Their features in fetuses (Table 3) suggest a pathogenesis of infectious origin. Ehrlichiosis and anaplasmosis are related as emerging zoonotic diseases (Arraga-Alvarado et al., 2014), which are not associated with RF in animals. These pathogens may have caused weakness and consequently RF. Thrombocytopenia in dogs with leishmaniasis (C6), ehrlichiosis (C1, C7, C13), and anaplasmosis (C1, C7, C13, C19) is expected; however, RF was not previously described as a clinical sign (Borin et al., 2009). The presence of these pathogens induces anemia, which can increase the likelihood of RF. Anemia has been associated with animals chronically infected with multisystemic diseases (anaplasmosis, ehrlichiosis, or leishmaniasis), and clinical signs vary with the severity of the disease and the presence of co-infections (Borin et al., 2009; Ferreira et al., 2014). Genetic diversity of E. canis strains can express different forms of hematological and clinical manifestations of the disease. However, previous studies on clinical signs of anaplasmosis, ehrlichiosis, or leishmaniasis were conducted in nonpregnant animals. The co-infection of E. canis and A. platys in nonpregnant dogs resulted in more pronounced anemia and thrombocytopenia (Gaunt et al., 2010). Maternal and perinatal mortality is significantly higher in anemic women (Bencaiova et al., 2012). Maternal systemic diseases can result in fever, anemia, or endotoxemia, which in turn can result in RF (Givens and Marley, 2008). The endotheliochorial placenta of dogs allows high blood supply to the fetus. Maternal infections by intracellular parasites can lower oxygen levels in the blood transported to the fetus, leading to RF. The principal reproductive pathogens were not found in this study, which suggests that the systemic disease diagnosed in the maternal blood is related to RF. Hence, bitches with anemia caused by vector-borne diseases are significantly more likely to experience RF than those with normal hematological values (Figure 1).

REFERENCES

ARRAGA-ALVARADO, C.M.; QUROLLO, B.A.; PARRA, O.C. et al. Case report: molecular evidence of Anaplasma platys infection in two women from Venezuela. Am. J. Trop. Med. Hyg., v.91, p.1161-1165, 2014. [ Links ]

BENCAIOVA, G.; BURKHARDT, T.; BREYMANN, C. Anemia-prevalence and risk factors in pregnancy. Eur. J. Intern. Med., v.23, p.529-533, 2012. [ Links ]

BORIN. S.; CRIVELENTI, L.Z.; FERREIRA, F.A. Aspectos epidemiológicos, clínicos e hematológicos de 251 cães portadores de mórula de Ehrlichia spp. naturalmente infectados. Arq. Bras. Med. Vet. Zootec., v.61, p.566-571, 2009. [ Links ]

COSTA, K.F.L.; AMÓRA, S.S.A.; COUTO, C.F. et al. Awareness of visceral leishmaniasis and its relationship to canine infection in riverside endemic areas in Northeastern Brazil. Rev. Soc. Bras. Med. Trop., v.47, p.607-612, 2014. [ Links ]

FERREIRA, R.F.; CERQUEIRA, A.M.F.; CASTRO, T.X. et al. Genetic diversity of Ehrlichia canis strains from naturally infected dogs in Rio de Janeiro, Brazil. Braz. J. Vet. Parasitol., v.23, p.301-308, 2014. [ Links ]

GAUNT, S.; BEALL, M.; STILLMAN, B. et al. Experimental infection and co-infection of dogs with Anaplasma platys and Ehrlichia canis: hematologic, serologic and molecular findings. Parasite. Vector., v.3, p.33, 2010. [ Links ]

GIVENS, D.M.; MARLEY, M.S.D. Infectious causes of embryonic and fetal mortality. Theriogenology, v.70, p.270-285, 2008. [ Links ]

GREENE, C.E. (Ed.). Infectious diseases of the dog and cat. St. Louis: Elsevier, 2012. 1376p. [ Links ]

MIR, F.; FONTAINE, E.; ALBARIC, O. et al. Findings in uterine biopsies obtained by laparotomy from bitches with unexplained infertility or pregnancy loss: an observational study. Theriogenology, v.79, p.312-322, 2013. [ Links ]

OLIVEIRA, V.V.G.; ALVES, L.C.; SILVA JUNIOR, V.A. Transmission routes of visceral leishmaniasis in mammals. Ciênc. Rural.; v.45, p.1622-1628, 2015. [ Links ]

Received: December 09, 2016; Accepted: January 19, 2017

*Autor para correspondência (corresponding author) E-mail: joao.antunes@ufersa.edu.br

Creative Commons License This is an open-access article distributed under the terms of the Creative Commons Attribution License