SciELO - Scientific Electronic Library Online

 
vol.69 issue5Spinal cord compression caused by melanoma in brown coat horse author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

Share


Arquivo Brasileiro de Medicina Veterinária e Zootecnia

On-line version ISSN 1678-4162

Arq. Bras. Med. Vet. Zootec. vol.69 no.5 Belo Horizonte Sept./Oct. 2017

http://dx.doi.org/10.1590/1678-4162-9288 

Comunicação

Imunogenicidade da proteína M recombinante de Streptococcus equi subsp. equi coadministrada com um adjuvante molecular

Immunogenicity of recombinant M protein of Streptococcus equi subsp. equi co administered with a molecular adjuvant

L.F. Maciel1 

C.G. Magalhães1 

C.M. Moraes2 

M.C. Rosa1 

M. Mendonça3 

A.N. Moreira1 

L.A. Dummer1 

P.F. Finger1 

M.R.A. Ferreira1 

F.P.L. Leite1 

F.R. Conceição1  * 

1Universidade Federal de Pelotas - Pelotas, RS

2Universidade Federal do Pará - Instituto de Medicina Veterinária - Faculdade de Veterinária - Castanhal, PA

3Universidade Federal Rural de Pernambuco - Garanhuns, PE

ABSTRACT

The strangles is an infectious disease that affects horses from all ages and causes important economic losses in the equine-related business. The aim of this work was to evaluate the immunogenicity of the recombinant M protein from Streptococcus equi (rSeM) co-administered with the recombinant heat-labile enterotoxin B subunit from Escherichia coli (rLTB) in mice and horses. A total of 72 female Balb-c mice were divided into eight groups and 18 horses were divided into six groups. The animals were inoculated by intramuscular (IM) or intranasal (IN) routes with different treatments of rSeM, rLTB and/or Al(OH)3. The results obtained in both species, independent of administration routes, demonstrated that rSeM + rLTB had higher levels of specific serum immunoglobulins, however, in mucosal immunity the increase was not identified. Thus, the use of rSeM as vaccine antigen and rLTB as adjuvant can be a potential tool in the control of equine strangles.

Keyword: Strangles; Streptococcus equi; rSeM and rLTB

O Brasil possui o maior rebanho de equinos da América Latina e o terceiro maior do mundo. O agronegócio relacionado à criação de cavalos vem crescendo no cenário nacional e é responsável pela geração de cerca de três milhões de empregos (Brasil, 2016). A criação de animais de alta qualidade eleva a perspectiva de crescimento do setor, porém a ocorrência de doenças infecciosas pode contrapor essa tendência.

A adenite equina, causada por Streptococcus equi subsp. equi, é uma das enfermidades mais relevantes entre aquelas que acometem o trato respiratório de equinos e, com isso, a busca por vacinas mais eficientes é importante, uma vez que aquelas atualmente disponíveis no Brasil apresentam eficácia de apenas 50% (Libardoni, 2015). A vacinação contra S. equi é recomendada em instalações onde a doença é um problema endêmico ou em animais com risco de exposição ao patógeno. É uma doença distribuída de forma uniforme em todas as regiões do estado do Rio Grande do Sul (RS), terceiro maior rebanho do país, sendo prevalente em 5,86% dos rebanhos (Libardoni et al., 2016).

Considerando que o uso de adjuvantes é importante para aumentar, modular e/ou prolongar a resposta imune, a subunidade B da enterotoxina termolábil de Escherichia coli (LTB), atóxica, vem se destacando principalmente como adjuvante molecular da imunidade de mucosa (imunidade local), potencializando a resposta imune humoral e celular antígeno-específica (Fischer et al., 2010; Hora et al., 2011). Entretanto, a sua avaliação como adjuvante molecular parenteral (imunidade sistêmica) ainda foi pouco explorada. Assim, o objetivo deste trabalho foi avaliar, em camundongos e equinos, a imunogenicidade da proteína M de S. equi subsp. equi (SeM) coadministrada com a LTB, sendo ambas as proteínas produzidas por meio da tecnologia do DNA recombinante.

A expressão da LTB recombinante (rLTB) foi realizada segundo Fischer et al. (2010). Para expressar a SeM recombinante (rSeM), a sequência codificadora da SeM de S. equi (GenBank U73162) foi amplificada por PCR, utilizando-se os oligonucleotídeos: 5’CGGGATCCTCGAGGTTAGTCGTAC3’ (forward) e 5’GGGGTACCTTAGTTTTCTTTGCGT3’ (reverse) e clonada no vetor de expressão pAE, gerando o vetor pAE/sem, utilizado para transformar E. coli Top 10 competente (Invitrogen, EUA). A seleção dos transformantes foi realizada em meio Luria-Bertani (LB ( 1% triptona, 0,5% extrato de levedura, 1% NaCl) com 100(g/mL de ampicilina (Sigma-Aldrich, EUA).

Os clones pAE/sem e pAE/ltb foram usados para transformar por choque térmico a cepa de expressão E. coli BL21 (DE3) StarTM (Invitrogen, EUA) e foram cultivados em meio LB com 100(g/mL de ampicilina. Logo que o cultivo atingiu a densidade óptica (DO600) de 0,8, a expressão foi induzida com 0,5mM de isopropil β-D-tiogalactopiranosídeo (IPTG) por três horas a 37°C. A solubilização dos corpos de inclusão de rSeM foi realizada em tampão contendo N-Lauroylsarcosine (100mM Tris, 200mM NaCl, 0,2% de N-Lauroylsarcosine, pH 8,0) e de rLTB, em tampão contendo ureia (100mM Tris, 200mM NaCl, 6M de ureia, pH 8,0). As proteínas recombinantes foram dialisadas contra o mesmo tampão, porém sem os agentes desnaturantes. Ambas as proteínas foram concentradas com polietilenoglicol (PEG) e quantificadas pelo método de Bradford. A caracterização de rSeM e rLTB foi realizada por eletroforese em gel desnaturante de poliacrilamida (SDS-PAGE) 12% e Western blot (WB) com anticorpo monoclonal (MAb) anti-6xHis (Sigma-Aldrich, EUA).

Para a avaliação da imunogenicidade, foram utilizados 72 camundongos Balb/c, de seis a oito semanas, fêmeas, divididos em oito grupos. Os animais foram inoculados nos dias zero, 14 e 21, por via intramuscular (IM) ou intranasal (IN) (aplicação com micropipeta) (Tab. 1). Amostras de sangue foram coletadas por punção do plexo venoso retro-ocular nos dias zero, sete, 14, 21 e 42, para obtenção de soro, e conservadas a -20°C até a utilização.

Tabela 1 Formulações vacinais e doses utilizadas para inocular camundongos 

Grupo Via de administração Formulações vacinais Dose n*
1 IM rSeM + Al(OH)3 25µg + 10% 9
2 IM rSeM + rLTB 25µg + 10µg 9
3 IM rSeM + rLTB + Al(OH)3 25µg + 10µg + 10% 9
4 IM rLTB + Al(OH)3 10µg + 10% 9
5 IM rSeM 25µg 9
6 IN rSeM 25µg 9
7 IN rSeM + rLTB 25µg + 10µg 9
8 IN rLTB 10µg 9

*n= número de animais por grupo.

Os níveis séricos (dias zero, sete, 14, 21 e 42) e a titulação de imunoglobulinas (Igs) séricas anti-rSeM de camundongos (dia 42) foram realizados mediante ELISA indireto. Placas de 96 cavidades (Cralplast, Brasil) foram sensibilizadas com 12µg/mL de rSeM diluída em tampão carbonato-bicarbonato pH 9,6 (TCB) e mantidas a 4°C por 18h. Para avaliação dos níveis séricos de Igs séricas anti-rSeM, os soros foram diluídos de 1:200. Já para a titulação de Igs séricas anti-rSeM, os soros foram diluídos de 1:200 a 1:145800 para os grupos inoculados por via IM e de 1:40 a 1:320 para os grupos inoculados por via IN. Anti-Igs totais de camundongo conjugadas com peroxidase (Sigma-Aldrich, EUA) foram acrescentadas na diluição 1:4000. A reação foi revelada com solução cromógena (ortofenilenodiamina ( OPD; 0,2M tampão citrato-fosfato pH 4,0; 0,01% de H2O2), e a leitura da DO realizada a 450nm (DO450), após 15min da adição do revelador. Cada etapa foi incubada a 37°C por 1,5h e, entre cada uma delas, foram realizadas três lavagens com PBS + Tween 0,05% (v/v) (PBS-T).

Equinos com baixos títulos de Igs séricas anti-rSeM foram selecionados para avaliação das formulações vacinais. Com isso, 28 animais, de um a 19 anos de idade, sem histórico de garrotilho, foram distribuídos em sete grupos. A inoculação dos cavalos foi realizada nos dias zero e 28, por via IM ou IN (aplicação com spray) (Tab. 2). O sangue foi coletado, por punção da veia jugular, nos dias zero, 28 e 42. Secreção nasal dos equinos foi coletada como previamente descrito por Nelson et al. (1998). Também foram coletados swabs da língua dos cavalos em uma área padronizada por este grupo de 9cm2 (3cm x 3cm). O conteúdo nasal e o da língua foram imersos em 5mL de PBS contendo 5mM de EDTA, 1mM de PMSF, 0,5% de gelatina, 0,05% de Tween 80 e 0,05% de NaN3, homogeneizados em vórtex para liberação do material, centrifugados em 13.000rpm por 10min e o sobrenadante estocado a -20°C até o uso.

Tabela 2 Formulações vacinais e doses utilizadas para inocular cavalos 

Grupo Via de administração Forumulação Dose *n Idade
1 IN PBS 2mL 4 1, 3, 4, 6
2 IN rSeM 100µg 4 1#, 3, 4, 9
3 IN rSeM + rLTB 100µg + 50µg 4 1#, 3, 4#, 11
4 IM PBS 2mL 4 3, 3, 4, 6
5 IM rSeM 100µg 4 1#, 3, 4#, 19
6 IM rSeM + rLTB 100µg + 50µg 4 3, 3, 4, 9
7 IM rSeM + Al(OH)3 100µg + 15% 4 2, 3#, 9, 19

*n= número de animais por grupo.

#Animais desenvolveram garrotilho durante o experimento e foram excluídos das análises.

Os títulos de Igs anti-rSeM no soro dos cavalos foram determinados por meio de ELISA indireto com amostras coletadas do dia 42. Para tal, as placas foram sensibilizadas com 100µL/poço de rSeM (12µg/mL) diluída em TCB e mantidas a 4°C por 18h, depois foram bloqueadas com leite em pó 5% (Molico; p/v). Para a titulação, foram feitas diluições de 1:1000 a 1:16000. Em seguida, anti-IgG de cavalo conjugado à peroxidase (Sigma-Aldrich, EUA) foi adicionado na diluição 1:6000. A reação foi revelada usando-se solução cromógena e avaliada a DO450 após 15 minutos. Cada etapa foi incubada a 37°C por 1,5h e entre cada uma delas foram realizadas três lavagens com PBS-T.

Para avaliação de IgA secretora anti-rSeM, 200µL de amostra foram aplicados diretamente na placa previamente sensibilizada com rSeM, e incubada em temperatura ambiente por 18h. Após, foi acrescentado anti-IgA de cavalo conjugado à peroxidase (Bethyl Laboratories, EUA), na diluição 1:2000 por duas horas a 37°C. A reação foi revelada usando-se solução cromógena por 15 minutos, e foi feita leitura na DO450.

A análise estatística foi realizada por meio do teste T Students, no software GraphPad Prism 5, para determinar as diferenças significativas (P<0,05) entre médias aritméticas.

Este trabalho foi aprovado pelo Comitê de Ética em Experimentação Animal (Ceea) da Universidade Federal de Pelotas (protocolo n° 2354-2014). Os animais foram mantidos e manuseados de acordo com os requisitos legais previstos na Lei Nacional de Proteção aos Animais de Experimentação (Brasil, 2008).

A amplificação da sequência codificadora da proteína SeM resultou em um fragmento de 1600pb, conforme esperado. A clonagem no vetor de expressão pAE foi caracterizada por restrição enzimática e por PCR (dados não mostrados). As proteínas rSeM e rLTB foram reconhecidas por meio de WB, utilizando-se anticorpo anti-6xHis (dados não mostrados). A expressão de rSeM em E. coli gerou uma proteína com massa molecular aparente de 58kDa, o que confirma os resultados descritos por Galáne e Timoney (1987), e a expressão de rLTB, uma proteína de aproximadamente 14kDa (Fischer et al., 2010).

Na avaliação dos níveis séricos de Igs anti-rSeM nos diferentes dias, os camundongos inoculados por via IN não apresentaram diferença em relação ao controle, assim como aos animais inoculados por via IM. Todos os animais dos grupos inoculados por via IM com diferentes formulações contendo rSeM apresentaram incremento nos níveis de Igs anti-rSeM sete dias após a primeira dose, em comparação ao grupo controle, e se mantiveram até os 42 dias (Fig. 1A e 1C). Foi observado um aumento significativo de pelo menos 14 vezes no título médio de Igs totais anti-rSeM (dia 42) induzidas pelas formulações vacinais contendo rSeM em relação ao controle (rLTB + Al(OH)3), no soro dos camundongos inoculados via IM. Nos camundongos inoculados via IN, o grupo rSeM + rLTB apresentou maior título médio de Igs, porém a diferença entre os grupos não foi significativa (Fig. 1B).

Figura 1 Níveis séricos (A e C) e título médio (dia 42) de Igs séricas totais anti-rSeM (B e D) nos camundongos inoculados com diferentes formulações vacinais contendo rSeM. (A e B) camundongos inoculados via intramuscular. (C e D) camundongos inoculados por via intranasal. Asterisco (*) representa diferenças significativas entre os níveis de anticorpos dos grupos vacinados e não vacinados (P<0,05). 

O título médio de Igs séricas anti-rSeM em cavalos vacinados por via IM é apresentado na Fig. 2A. Somente o grupo rSeM + rLTB apresentou diferença estatística em relação ao controle (PBS), apesar de ser observado um aumento de, no mínimo, quatro vezes no título sérico de anticorpos em todos os grupos vacinados com formulações contendo a proteína rSeM. No tocante à vacinação por via IN em cavalos, o título médio de Igs totais anti-rSeM aumentou significativamente no grupo rSeM + rLTB relativamente ao controle (PBS) (Fig. 2B). Nos cavalos vacinados por via IM ou IN, não foi detectado incremento nos níveis de IgA secretora anti-rSeM com as amostras de swab nasal e de língua (dados não mostrados).

Figura 2 Título médio de Igs séricas totais anti-rSeM de cavalos inoculados via intramuscular (A) e intranasal (B) com diferentes formulações vacinais contendo rSeM. Asterisco (*) representa diferenças significativas entre os níveis de anticorpos dos grupos vacinados e não vacinados (P<0,05). 

O presente estudo mostrou que a rSeM é bastante imunogênica, como descrito por Moraes (2008), uma vez que camundongos e cavalos tiveram aumento nos títulos de Igs séricas anti-rSeM, até mesmo quando o antígeno recombinante foi administrado sem adjuvante. A formulação rSeM + rLTB foi o que estimulou o maior título de Igs séricas anti-rSeM em ambas as espécies, independentemente da via de administração, demonstrando o papel adjuvante da rLTB, o que corrobora dados obtidos em estudos anteriores (Conceição et al., 2006; Fischer et al., 2010; Hora et al., 2011). É importante observar que a rLTB gerou títulos semelhantes de anticorpos em comparação com o adjuvante comumente utilizado em vacinas comerciais, o Al(OH)3, podendo ser uma alternativa viável para utilização em formulações vacinais de interesse veterinário. Entretanto, a rLTB não mostrou sinergismo com o Al(OH)3, visto que os camundongos vacinados com essa combinação apresentaram título médio de Igs séricas anti-rSeM levemente inferior aos demais tratamentos.

A imunidade ante a infecção por S. equi pode ser presumida por meio da avaliação do título de anticorpos anti-SeM por ELISA indireto, sendo considerados elevados, na maioria dos cavalos, títulos superiores a 1:1600 e, provavelmente, capazes de conferir imunidade à doença (Mallicote, 2015). Os resultados aqui apresentados demonstram um título superior a 1:5000 nos cavalos inoculados por via IM, sugerindo uma possível proteção no tocante à infecção por S. equi.

Neste estudo, não foi detectado um aumento nos níveis de IgA secretora anti-rSeM, talvez porque os cavalos tenham sido inoculados com apenas duas doses de 100(g de rSeM. Sheoran et al. (2002) conseguiram induzir resposta imune de mucosa específica em cavalos usando três doses, sendo a primeira vacinação com 500µg e as demais com 300µg de uma fração da proteína SeM fusionada à subunidade B da toxina colérica, que apresenta mais de 80% de homologia com a LTB (Simmons et al., 2001). Flock et al. (2004), ao utilizarem outros antígenos de S. equi com LTB, obtiveram maiores títulos de IgA na mucosa nasal de cavalos por meio da combinação de vias subcutânea e intranasal. Isso sugere que talvez a combinação de vias de administração e/ou ainda o aumento no número de doses vacinais e concentração de antígeno em cada dose poderiam estar envolvidos numa melhor estimulação da imunidade de mucosa.

Os resultados obtidos neste trabalho demonstram a potencial utilização de rSeM como antígeno vacinal e da rLTB como adjuvante molecular, tendo em vista que a formulação foi imunogênica e inócua para camundongos e cavalos. Porém, mais estudos devem ser realizados para determinar a concentração de antígeno e o número de doses adequadas, assim como para avaliar a eficácia dessa vacina a campo.

REFERÊNCIAS

BRASIL. Conselho Nacional de Controle de Experimentação Animal. Lei Nacional de Proteção aos Animais de Experimentação. Lei nº 11.794. Diário Oficial, Brasília, 8 out. 2008. [ Links ]

BRASIL. Ministério da Agricultura pecuária e desenvolvimento. Lei Nº 11.794, de 8 de outubro de 2008. Disponível em: <http://www.agricultura.gov.br/animal/especies/equideos>. Acessado em 15 jan. 2016. [ Links ]

CONCEIÇÃO, F.R.; MOREIRA, A.N.; DELLAGOSTIN, O.A. A recombinant chimera composed of R1 repeat region of Mycoplasma hyopneumoniae P97 adhesin with Escherichia coli heat-labile enterotoxin B subunit elicits immune response in mice. Vaccine, v.24, p.5734-5743, 2006. [ Links ]

FISCHER, G.; CONCEICAO, F.R.; LEITE, F.P.L. et al. Recombinant Escherichia coli heat-labile enterotoxin B subunit humoral adjuvant effect depends on dose and administration route. World J. Microbiol. Biotechnol., v.26, p.489-95, 2010. [ Links ]

FLOCK, M.; JACOBSSON, K.; FRYKBERG, L. et al. Recombinant Streptococcus equi proteins protect mice in challenge experiments and induce immune response in horses. Infect. Immun., v.72, p.3228-3236, 2004. [ Links ]

GALÁN, J.E.; TIMONEY, J.F. Molecular analysis of the M protein of Streptococcus equi and cloning and expression of the M protein gene in Escherichia coli. Infect. Immun., v.55, p.3181-3187, 1987. [ Links ]

HORA, V.P.; CONCEIÇÃO, F.R.; DELLAGOSTIN, O.A.; DOOLAN, D.L. Nontoxic derivatives of LT as potent adjuvants. Vaccine, v.29, p.1538-1544, 2011. [ Links ]

LIBARDONI, F. Equinos portadores de Streptococcus equi subespécie equi: Prevalência, fatores de risco e caracterização de alelos seM. 2015. 58f. Tese (Pós-Graduação em Medicina Veterinária), Universidade Federal de Santa Maria, Santa Maria, RS. [ Links ]

LIBARDONI, F.; MACHADO, G.; GRESSLER, L.T. et al. Prevalence of Streptococcus equi subsp. equi in horses and associated risk factors in the state of Rio Grande do Sul, Brazil. Res. Vet. Sci., v.104, p.53-57, 2016. [ Links ]

MALLICOTE, M. Update on Streptococcus equi subsp equi infections. Vet. Clin. N. Am. Equine Pract., v.31, p.27-41, 2015. [ Links ]

MORAES, C.M. Produção e avaliação de proteína SeM recombinante para o controle de Adenite Equina. 2008. 79f. Tese (Doutorado em Biotecnologia) - Centro de Biotecnologia, Universidade Federal de Pelotas, RS. [ Links ]

NELSON, K.M.; SCHRAM, B.R.; MCGREGOR, M.W. et al. Local and systemic isotype-specific antibody responses to equine influenza virus infection versus conventional vaccination. Vaccine, v.16, p.1306-1313, 1998. [ Links ]

SHEORAN, A.S.; ARTIUSHIN, S.; TIMONEY, J.F. Nasal mucosal immunogenicity for the horse of a SeM peptide of Streptococcus equi genetically coupled to cholera toxin. Vaccine, v.20, p.1653-1659, 2002. [ Links ]

SIMMONS, C.P.; GHAEM-MAGAMI, M.; PETROVSKA, L. et al. Immunomodulation using bacterial enterotoxins. Scand. J. Immunol., v.53, p.218-26, 2001. [ Links ]

Recebido: 03 de Janeiro de 2017; Aceito: 19 de Janeiro de 2017

*Autor para correspondência (corresponding author) E-mail: fabricio.rochedo@ufpel.edu.br

Creative Commons License Este é um artigo publicado em acesso aberto sob uma licença Creative Commons