SciELO - Scientific Electronic Library Online

 
vol.71 issue4Secondary hypoparathyroidism to omeprazole prolonged use in a dog: case reportEvolutionary aspects on the origin, distribution and ramifications of the ischiadicus nerve in the giant anteater (Myrmecophaga tridactyla) author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

Share


Arquivo Brasileiro de Medicina Veterinária e Zootecnia

Print version ISSN 0102-0935On-line version ISSN 1678-4162

Arq. Bras. Med. Vet. Zootec. vol.71 no.4 Belo Horizonte July/Aug. 2019  Epub Oct 10, 2019

https://doi.org/10.1590/1678-4162-9809 

Medicina Veterinária

Padronização de uma PCR para diagnóstico molecular de Microsporum canis em amostras de pelos e crostas de cães e gatos

Standardization of a pcr for molecular diagnosis of microsporum canis in samples of fur and crusts of dogs and cats

1Universidade Federal Rural de Pernambuco ˗ Recife, PE

2Universidade Federal Rural da Amazônia ˗ Belém, PA


RESUMO

Objetivou-se neste estudo padronizar um protocolo de reação em cadeia da polimerase (PCR) para detecção de Microsporum canis em amostras de pelos e/ou crostas de cães e gatos. Foram selecionadas 48 amostras previamente identificadas por meio de cultura. Destas, 23 foram positivas para dermatófitos no cultivo. Padronizou-se a PCR a partir de primers desenhados para o alvo M. canis. Sessenta e um por cento (14/23) das amostras positivas para dermatófitos foram identificadas como M. canis em cultura. Desse total, 71,4% (10/14) apresentaram um fragmento de 218pb compatível com o esperado para a espécie fúngica alvo dessa reação. Observou-se uma sensibilidade de 71,4% e especificidade de 100% na PCR, além de uma boa concordância entre essas técnicas de diagnóstico (Kappa: 0,78; P<0,0001). O protocolo utilizado neste estudo apresentou alta especificidade na detecção de M. canis diretamente de amostras de pelos e/ou crostas de cães e gatos, viabilizando um diagnóstico mais rápido e específico, podendo esse protocolo ser empregado como um método confirmatório para agilizar a detecção de M. canis.

Palavras-chave: cães; gatos; dermatófitos; PCR; pelos

ABSTRACT

The aim of this study was to standardize a Polymerase Chain Reaction protocol (PCR) for the detection of Microsporum canis in fur and/or crusts of dogs and cats. 48 samples previously identified by culture were selected. Of these, 23 were positive for dermatophytes in culture. PCR was standardized from drawn primers whose target is M. canis. A total of 61% (14/23) of the dermatophyte positive samples were identified as M. canis in culture. Of this total, 71.4% (10/14) presented a fragment of 218bp compatible with that expected for the fungal species target of the reaction. A sensitivity of 71.4% and specificity of 100% in the PCR were observed, in addition to a good agreement between the techniques (Kappa: 0.78; P< 0.0001). The protocol used in this study showed high specificity in the detection of M. canis directly from fur and/or crusts of dogs and cats, making possible a faster and more specific diagnosis. This protocol could be used as a confirmatory method, speeding the detection of M. canis.

Keywords: dogs; cats; dermatophytes; fur; PCR

INTRODUÇÃO

A dermatofitose acomete várias espécies animais, além de ser uma zoonose em que a maioria dos casos relatados em humanos tem como agente causador Microsporum canis, devido ao contato direto com cães e principalmente gatos infectados que estão envolvidos em aproximadamente 50% dos casos (Muller e Kirk, 1996; Quinn et al., 2005). É considerável o aumento no número de casos de dermatofitoses humanas causadas por fungos zoofílicos nos últimos anos (Brilhante et al., 2000; Brillowska-Dabrowska et al., 2013).

A identificação laboratorial dos dermatófitos depende do seu crescimento em meio de cultura apropriado e devidamente suplementado, da avaliação minuciosa de seus aspectos macro e micromorfológicos, além de pessoal capacitado. Um desenvolvimento atípico da colônia pode resultar em um acréscimo no tempo de identificação ou resultado falso-negativo. Esses fatores podem ocasionar um diagnóstico tardio ou errôneo (Coelho et al., 2008; Shehata et al., 2008; Cruz, 2010).

Métodos moleculares têm sido desenvolvidos e vêm contribuindo de maneira significativa na identificação desses agentes e de suas espécies, sobretudo a técnica da reação em cadeia da polimerase (PCR), por ser uma técnica sensível, específica e rápida (Faggi et al., 2001; Vergara et al., 2006; Shehata et al., 2008; Brillowska-Dabrowska et al., 2013).

Variações da PCR também têm sido utilizadas na tentativa de padronizar uma técnica para viabilizar um diagnóstico mais rápido e específico, principalmente quando se refere à micologia humana (Gräser et al., 1998; Jackson et al., 1999; Faggi et al., 2001; Liu et al., 2001; Shehata et al., 2008; Mirzahoseini et al., 2009; Brillowska-Dabrowska et al., 2013), no entanto, em relação à micologia veterinária, há carência de profissionais qualificados, de técnicas específicas para o diagnóstico e de identificação fúngica, além da escassez na publicação de artigos científicos, pois, na maioria das vezes, os artigos citam amostras de animais como parte da pesquisa e não como objetivo principal dela (Faggi et al., 2001; Cano et al., 2005).

Dessa forma, uma PCR capaz de detectar um agente zoonótico, em nível de espécie e envolvido na maioria dos casos de dermatofitose humana e animal, utilizando-se apenas amostras biológicas, pode ser de grande importância para o diagnóstico não só para a medicina veterinária mas também para a medicina humana. Para tanto, objetivou-se neste estudo padronizar um protocolo de reação em cadeia da polimerase (PCR) para detectar Microsporum canis em amostras de pelos e/ou crostas de cães e gatos.

MATERIAL E MÉTODOS

A pesquisa foi desenvolvida no Laboratório de Doenças Infecciosas dos Animais Domésticos, da Universidade Federal Rural de Pernambuco˗DMV/UFRPE. O projeto foi submetido e aprovado pela Comissão de Ética no Uso de Animais da Universidade Federal Rural de Pernambuco (UFRPE), Recife, Brasil (Licença nº 003/2014).

Para padronização da PCR para M. canis, foram utilizadas 48 amostras de pelos e/ou crostas de cães e gatos, sendo 23 positivas e 25 negativas para dermatófitos na técnica de cultivo.

O DNA das 48 amostras de pelos e crostas foi extraído utilizando-se o kit de extração DNeasy Blood & Tissue (QIAGEN®, Hilden ˗ Germany), de acordo com o seguinte protocolo: em um tubo tipo Eppendorf contendo 180µL de tampão ATL, acrescentaram-se os pelos e/ou as crostas, que foram homogeneizados em vórtex por 15 segundos; em seguida, foram adicionados 20µL de proteinase K, e essa suspensão foi homogeneizada rapidamente em vórtex e incubada em banho seco com agitação a 56°C por uma hora e 1500rpm; foram acrescentados, após esse período, 4µL de RNase à suspensão, que foi homogeneizada e incubada em temperatura ambiente por cinco minutos, e, logo após, foi levada ao vórtex, ao qual foram adicionados 200µL de tampão AL; em seguida, adicionaram-se 200µL de etanol (96˗100%) e novamente a solução foi homogeneizada no vórtex.

Foram preparados tubos de coleta acoplados aos filtros (embalagens individuais) e transferiram-se 600µL, ou o que se conseguiu do conteúdo do tubo anterior, para nova centrifugação a 6080xg/1min; logo após, o tubo de coleta (a parte de baixo) foi trocado e foram adicionados 500µL do tampão AW1, bem como foi realizada outra centrifugação a 6080xg/1 min. Novamente o tubo de coleção foi substituído e 500µL do tampão AW2 foram adicionados. Realizou-se outra centrifugação a 18630xg/3min; a parte de baixo (ou tubo de coleta) foi substituída por um tubo tipo Eppendorf® (1,5mL) devidamente identificado com 100µL do tampão AE.

Os tubos foram, então, incubados em temperatura ambiente por 10 minutos e, em seguida, centrifugados a 6080xg/1min; o filtro (coluna) foi retirado e descartado, e os tubos, devidamente identificados, foram acondicionados no freezer (-20°C).

Os primers foram desenhados e analisados por meio de ferramentas disponibilizadas no GenBank/NCBI. Após as avaliações, os primers escolhidos foram: Mc Fw: 5’ CCTCCCCAGTAACCACCCA 3’ e Mc Rv: 5’ GCATATCAATAAGCCGGAGG 3’, que amplificam um fragmento de 218pb.

As reações de amplificação do DNA foram otimizadas para um volume final de 12,5µL, contendo: 2,5μL de DNA genômico; 0,5μL de cada primer a 10μM; 2,75μL de água Milli-Q ultrapura e 6,25μL de Top Taq™ Master Mix (QIAGEN®, Hilden ˗ Germany). Foi utilizada, como controle negativo, água ultrapura e, como controle positivo, o DNA extraído de colônias de M. canis (URM 6273), M. gypseum (URM 6921) e T. mentagrophytes (URM 6211), provenientes da Coleção de Culturas ˗ Micoteca URM ˗ Departamento de Micologia, Centro de Ciências Biológicas da Universidade Federal de Pernambuco (CCB/UFPE).

O protocolo térmico padronizado foi o seguinte: desnaturação inicial a 94°C por sete minutos, seguida por 30 ciclos de 95ºC por 30 segundos, 60ºC por um minuto e 72ºC por 30 segundos, finalizando com uma extensão a 72ºC por seis minutos.

Após a amplificação, o produto de PCR foi corado com Blue Green Loading Dye I (LGC Biotecnologia), plotado em gel de agarose 3% e colocado em cuba de eletroforese com tampão tris-acetato-EDTA (1X) (Amresco®) para posterior visualização sob a luz ultravioleta e fotodocumentação.

Para o estudo de concordância entre a cultura fúngica e a PCR, utilizou-se o coeficiente de Kappa (K), e a interpretação dos valores de K adotada foi: 0,00 - 0,20 = concordância fraca; 0,21 - 0,40 = regular; 0,41 - 0,60 = moderada; 0,61 - 0,80 = boa; 0,81- 1,00 = muito boa; valores negativos são interpretados como equivalentes a 0,00 (Landis e Koch, 1977). Para o cálculo de concordância, utilizou-se o programa computacional Bioestat, versão 5.0 (Ayres et al., 2007).

RESULTADOS

Das 23 amostras previamente identificadas na cultura como dermatófitos, 14 foram M. canis, quatro M. gypseum, três T. mentagrophytes, uma M. nanum e uma Trichophyton sp.

Das 14 amostras identificadas como M. canis na cultura, em 10 (71,4%) observou-se um fragmento de 218pb compatível com o esperado para a espécie fúngica alvo da reação.

Na Tab. 1, estão os resultados obtidos após análise estatística comparativa entre cultura e PCR para M. canis. A Fig. 1 demonstra um fragmento de 218pb, amplificado por meio do DNA extraído de uma amostra de pelo previamente identificada em cultura como positiva para M. canis.

Tabela 1 Análise de concordância, sensibilidade e especificidade entre resultados da cultura e da PCR para Microsporum canis isolados de amostras clínicas de cães e gatos atendidos no Hospital Veterinário da UFRPE 

PCR Exame microbiológico Valor de P Kappa (K) Sens. (%) Espec. (%)
Positivo Negativo
F.A. F.R. (%) F.A. F.R. (%)
Positivo 10 100,0 - - ˂0,0001 0,78 71,4 100,0
Negativo 4 10,5 34 89,5

F.A: frequência absoluta; F.R.: frequência relativa; Sens.: sensibilidade; Espec.: especificidade.

Figura 1 PCR utilizando DNA de amostras clínicas positivas para dermatófitos em cultura. Gel de agarose 3%. M: marcador de peso molecular 100pb (LGC biotecnologia); 1: T. mentagro-phytes; 2: M. canis; 3: M. gypseum; 4: Trichophyton sp.; 5: M. nanum; 6: M. canis (URM 6273); 7: M. gypseum (URM 6921); 8: T. mentagrophytes (URM 6211); 9: controle negativo. 

DISCUSSÃO

Após a padronização do protocolo de PCR utilizando as 48 amostras clínicas, verificou-se a amplificação somente das amostras identificadas como M. canis, demonstrando alta especificidade dos primers desenhados, em que, mesmo tendo como base o DNA de outros fungos e até mesmo de outras espécies pertencentes ao mesmo gênero, não houve anelamento por parte dos iniciadores (Fig. 1).

Comparando-se os resultados da cultura fúngica com os da PCR, observou-se uma sensibilidade de 71,4% e uma especificidade de 100%, o que demonstra a aplicabilidade desse protocolo, evidenciado também pelo valor do Kappa (0,78), que, segundo Landis e Koch (1977), revela uma boa concordância entre as técnicas.

Diferente do presente estudo, Liu et al. (2001) desenvolveram uma PCR M. canis específica, porém utilizaram DNA extraído de colônias de dermatófitos e não dermatófitos, isoladas de amostras biológicas humanas, assim como de cepas ATCC. No protocolo estabelecido neste estudo, foi utilizado o DNA extraído diretamente das amostras de pelos, o que pode dificultar o processo de detecção do agente, pois, além de a quantidade e a qualidade de DNA extraído serem inferiores, segundo Rodrigues et al. (2006), compostos orgânicos e inorgânicos, bem como substâncias como bile e sais, também podem inibir a PCR em amostras biológicas, como tecido animal.

Brillowska-Dabrowska et al. (2013) desenvolveram uma PCR M. canis específica e observaram 100% de sensibilidade e especificidade, utilizando 130 isolados clínicos de dermatófitos, 10 leveduras ou fungos miceliais, 12 amostras de pelo e pele de animais (cobaias) com ou sem infecção experimental por M. canis e 35 amostras de pacientes humanos, incluindo sete amostras positivas para M. canis e 15 amostras negativas para dermatófitos, o que demonstra a aplicabilidade dessa PCR para a detecção do agente na rotina laboratorial.

Várias técnicas moleculares têm sido aplicadas para a identificação laboratorial de espécies de dermatófitos, sendo consideradas mais estáveis, rápidas e precisas do que aquelas que se baseiam nas características fenotípicas (Gutzmer et al., 2004; Shehata et al., 2008).

Machouart-Dubach et al. (2001), ao compararem a cultura com a PCR-RFLP utilizando amostras clínicas, observaram que 74 das 75 amostras analisadas foram concordantes nos resultados em ambas as técnicas e, diante disso, consideraram a técnica molecular adequada para o diagnóstico rápido da dermatofitose.

Vergara et al. (2006) também padronizaram uma técnica de PCR para o diagnóstico de dermatófitos e observaram uma concordância de 93,3% entre os resultados obtidos na PCR e aqueles obtidos com os métodos tradicionais de diagnóstico, quando analisaram 30 cepas pertencentes a esse grupo de fungos. No entanto, quando analisaram o DNA de 30 amostras clínicas (pele, unha e pelos) positivas e negativas, em cultura, de pacientes humanos com infecção ativa, observaram 100% de concordância entre os resultados obtidos, o que sugeriu que a PCR é uma técnica que oferece grandes vantagens na identificação dos fungos dermatófitos.

Essas vantagens vão desde a redução no tempo para obtenção do resultado, pois a PCR possui sensibilidade e especificidade similares à cultura, até a redução de custos, considerando-se que um diagnóstico precoce e específico pode evitar um tratamento tardio ou ineficiente ou um prolongamento dele.

Outro ponto a ser destacado é que a dermatofitose consiste em uma zoonose e há relatos de insensibilizações por parte de M. canis à terbinafina (Brillowska-Dabrowska et al., 2013), ou seja, o desenvolvimento de técnicas que visem ao diagnóstico preciso e precoce de espécies fúngicas com potencial zoonótico não só irá contribuir para a clínica médica veterinária como também para a saúde pública.

CONCLUSÃO

O protocolo padronizado neste estudo apresentou uma alta especificidade na detecção de M. canis diretamente de amostras de pelos e/ou crostas de cães e gatos, viabilizando um diagnóstico mais rápido e específico, o qual pode ser empregado como um método confirmatório capaz de agilizar a detecção do agente em questão.

REFERÊNCIAS

AYRES, M.; AYRES JÚNIOR, M.; AYRES, D.L.; SANTOS, A.S. BioEstat 5.0: aplicações estatísticas nas áreas das ciências biológicas e médicas. Belém: MCT/IDSM/CNPq, 2007. 364p. [ Links ]

BRILHANTE, R.S.N.; PAIXÃO, G.C.; SALVINO, L.K. et al. Epidemiologia e ecologia das dermatofitoses na cidade de Fortaleza: o Trichophyton tonsurans como importante patógeno emergente da Tinea capitis. Rev. Soc. Bras. Med. Trop., v.33, p.417-425, 2000. [ Links ]

BRILLOWSKA-DABROWSKA, A.; MICHALEK, E.; SAUNTE, D.M.L. et al. PCR test for Microsporum canis identification. Med. Mycol., v.51, p.576-579, 2013. [ Links ]

CANO, J.; REZUSTA, A.; SOLÉ, M. et al. Inter-single-sequence-repeat-PCR typing as a new tool for identification of Microsporum canis strains. J. Dermatol. Sci., v.39, p.17-21, 2005. [ Links ]

COELHO, A.C.; ALEGRIA, N.; RODRIGUES, J. Isolamento de dermatófitos em animais domésticos em Vila Real, Portugal. Arq. Bras. Med. Vet. Zootec., v.60, p.1017-1020, 2008. [ Links ]

CRUZ, L.C.H. Dermatófitos. In: CRUZ, L.; CELSO HYGINO, C. Micologia veterinária. 2.ed. Rio de Janeiro: Revinter, 2010. p.111-142. [ Links ]

FAGGI, E.; PINI, G.; CAMPISI, E. et al. Application of PCR to distinguish common species of dermatophytes. J. Clin. Microbiol., v.39, p.3382-3385, 2001. [ Links ]

GRÄSER, Y.; EL FARI, M.; PRESBER, W. et al. Identification of common dermatophytes (Trichophyton, Microsporum, Epidermophyton) using polymerase chain reactions. Br. J. Dermatol., v.138, p.576-582, 1998. [ Links ]

GUTZMER, R.; MOMMERT, S.; KÜTTLER, U. et al. Rapid identification and differentiation of fungal DNA in dermatological specimens by LightCycler PCR. J. Med. Microbiol., v.53, p.1207-1214, 2004. [ Links ]

JACKSON, C.J.; BARTON, R.C.; EVANS, E.G.V. Species identification and strain differentiation of dermatophyte fungi by analysis of ribosomal-DNA intergenic spacer regions. J. Clin. Microbiol., v.37, p.931-936, 1999. [ Links ]

LANDIS, J.R.; KOCH, G.G. The measurement of observer agreement for categorical data. Biometrics, v.33, p.159-174, 1977. [ Links ]

LIU, D.; PEARCE, L.; LILLEY, G. et al. A specific PCR assay for the dermatophyte fungus Microsporum canis. Med. Mycol., v.39, p.215-219, 2001. [ Links ]

MACHOUART-DUBACH, M.; LACROIX, C.; CHAUVIN, M.F. et al. Rapid discrimination among dermatophytes, scytalidium spp., and other fungi with a pcr-restriction fragment length polymorphism ribotyping method. J. Clin. Microbiol., v.39, p.685-690, 2001. [ Links ]

MIRZAHOSEINI, H.; OMIDINIA, E.; SHAMS-GHAHFAROKHI, M. et al. Application of PCR-RFLP to rapid identification of the main pathogenic dermatophytes from clinical specimens. Iran. J. Public Health, v.38, p.18-24, 2009. [ Links ]

MULLER, G.H.; KIRK, R.W. Dermatologia de pequenos animais. Rio de Janeiro: Interlivros, 1996. 1130p. [ Links ]

QUINN, P.J.; MARKEY, B.K.; CARTER, M.E. et al. Dermatófitos. In: QUINN, P.J.; MARKEY, B.K.; CARTER, M.E.; DONNELLY, W.J.; LEONARD, F.C. Microbiologia veterinária e doenças infecciosas. Porto Alegre: Artmed, 2005. p.224-228. [ Links ]

RODRIGUES, J.J.S.; SILVA, R.C.; SIQUEIRA, M.M. Técnicas de biologia molecular aplicadas ao diagnóstico. In: ROSSETI, M.L.; SILVA, C.M.D.; RODRIGUES, J.J.S. Doenças infecciosas: diagnóstico molecular. Rio de Janeiro: Guanabara Koogan, 2006. p.16-40. [ Links ]

SHEHATA, A.S.; MUKHERJEE, P.K.; ABOULATTA, H.N. et al. Single-step PCR using (GACA) 4 primer: utility for rapid identification of dermatophyte species and strains. J. Clin. Microbiol., v.46, p.2641-2645, 2008. [ Links ]

VERGARA, C.C.; PARCHA, C.; PINEDA, J.; ARENAS, E.R. Estandarización de una técnica de amplificación genómica (PCR) para el diagnóstico de dermatofitos. Cienc. Trab., v.8, p.167-171, 2006. [ Links ]

Recebido: 12 de Fevereiro de 2017; Aceito: 04 de Janeiro de 2018

Creative Commons License Este é um artigo publicado em acesso aberto sob uma licença Creative Commons