SciELO - Scientific Electronic Library Online

 
vol.51 issue1Use of superficial peroneal nerve graft for treating peripheral nerve injuriesReconstruction of medial patellofemoral ligament using quadriceps tendon combined with reconstruction of medial patellotibial ligament using patellar tendon: initial experience author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

Share


Revista Brasileira de Ortopedia

Print version ISSN 0102-3616On-line version ISSN 1982-4378

Rev. bras. ortop. vol.51 no.1 São Paulo Jan./Feb. 2016

https://doi.org/10.1016/j.rboe.2015.12.013 

Artigos Originais

Células mesenquimais do estroma da medula óssea tratadas com extrato de tendão bovino adquirem o fenótipo de tenócitos maduros

Lívia Maria Mendonça Augusto* 

Diego Pinheiro Aguiar2 

Danielle Cabral Bonfim2 

Amanda dos Santos Cavalcanti2 

Priscila Ladeira Casado2 

Maria Eugênia Leite Duarte2 

2Instituto Nacional de Traumatologia e Ortopedia, Rio de Janeiro, RJ, Brasil


RESUMO

OBJETIVO:

O estudo avalia a diferenciação in vitro das células mesenquimais isoladas do estroma da medula óssea em tenócitos após tratamento com extrato de tendão bovino.

MÉTODOS:

Tendões bovinos foram usados para confecção do extrato e estocados a -80 °C. Células mesenquimais do estroma da medula óssea (BMSCs) de três doadores foram usadas para os testes de citotoxicidade por MTT e diferenciação celular por qPCR.

RESULTADOS:

Os dados mostram que células mesenquimais do estroma da medula óssea tratadas por até 21 dias em presença do extrato de tendão bovino diluído em concentrações crescentes (1:10, 1:50 e 1:250) promovem a ativação da expressão de biglican, colágeno tipo I e fibromodulina.

CONCLUSÃO:

Nossos resultados mostram que o extrato de tendão bovino é capaz de promover a diferenciação das BMSCs em tenócitos.

Palavras-chave: Tendão; Células mesenquimais do estroma da medula óssea; Tenócitos

ABSTRACT

OBJECTIVE:

This study evaluated in vitro differentiation of mesenchymal stromal cells isolated from bone marrow, in tenocytes after treatment with bovine tendon extract.

METHODS:

Bovine tendons were used for preparation of the extract and were stored at -80 °C. Mesenchymal stromal cells from the bone marrow of three donors were used for cytotoxicity tests by means of MTT and cell differentiation by means of qPCR.

RESULTS:

The data showed that mesenchymal stromal cells from bone marrow treated for up to 21 days in the presence of bovine tendon extract diluted at diminishing concentrations (1:10, 1:50 and 1:250) promoted activation of biglycan, collagen type I and fibromodulin expression.

CONCLUSION:

Our results show that bovine tendon extract is capable of promoting differentiation of bone marrow stromal cells in tenocytes.

Keywords: Tendon; Mesenchymal stromal cells from bone marrow; Tenocytes

Introdução

O tendão é um tecido especializado composto por tendoblastos e tenócitos embebidos em uma matriz extracelular composta majoritariamente por Colágeno tipo I. Os tenócitos têm potencial limitado de proliferação e conferem, assim, uma baixa capacidade regenerativa ao tendão.1and2

As lesões tendíneas constituem um grave problema na prática ortopédica e geram altos custos para o sistema público de saúde, além de impactar na qualidade de vida dos pacientes afetados. Embora os tratamentos clínicos objetivem a regeneração, os métodos atualmente disponíveis ainda são ineficazes. Dessa forma, disfunções no tendão levam à incapacidade física definitiva.3,4and5

As células mesenquimais isoladas do estroma da medula óssea (BMSCs, do inglês, Bone Marrow Stromal Cells) são conhecidamente uma opção terapêutica promissora no campo da terapia celular e bioengenharia de tecidos musculoesqueléticos. 5,6,7and8 Não obstante, sua associação a biomateriais sintéticos tem sido proposta como opção aos tratamentos modernos que visam à reconstrução tendínea, como a enxertia alógena, autógena ou xenógena. 9and10 O uso de BMSCs autólogas em enxertos biossintéticos visa a melhorar os resultados de cirurgias conservadoras e reduzir o tempo de recuperação das propriedades biomecânicas pré-lesionais.11 Além disso, a baixa imunogenicidade das BMSCs permite seu uso alogênico e minimiza a necessidade de imunossupressão do receptor.12

Apesar de seu significativo potencial terapêutico, pouco ainda se sabe acerca dos mecanismos e das vias de sinalização envolvidos na determinação e progressão da diferenciação das BMSCs para a via tenogênica. Considerando que BMSCs parecem responder a estímulos presentes em extratos de tecidos maduros sadios e apresentam características fenotípicas específicas,13and14 desenvolvemos a hipótese de que extratos de tendão pudessem induzir a diferenciação das BMSCs em tenócitos. Dessa forma, o presente estudo tem como objetivo avaliar a influência do tratamento de BMSCs humanas com diferentes concentrações de extrato de tendão bovino na diferenciação in vitro para a via tenocítica.

Material e métodos

Isolamento e expansão das células mesenquimais do estroma da medula óssea humana

As BMSCs foram isoladas a partir de descartes cirúrgicos de artroplastia de quadril obtidos de cinco pacientes (dois homens e três mulheres) entre 45-60 anos, sem comorbidades. O consentimento informado foi obtido de todos os indivíduos após a aprovação do protocolo do estudo pelo Comitê de Ética Institucional. Após a coleta no centro cirúrgico, as amostras foram armazenadas em frascos estéreis com o meio de cultivo de Dulbecco modificado por Iscove (IMDM; Iscove's Modified Dulbecco's Medium; Sigma-Aldrich, St. Louis, MO) suplementado com 20% de soro fetal bovino (SFB; Gibco, Grand Island, NY) a 4° C por até 18 horas. Para o isolamento da fração celular total, as medulas foram ressuspensas em solução salina tamponada (PBS, Phosphate Buffer Saline) e mecanicamente dissociadas de fragmentos ósseos. As suspensões celulares obtidas foram coletadas em tubos de 50 mL e centrifugadas por 5 min a 836 xg a 4 °C. Em seguida, as células foram ressuspensas em 50 mL de IMDM suplementado com 20% de SFB e contadas com uma câmara de Neubauer. Depois, 6 × 105 células mononucleares foram distribuídas em frascos de cultura de 75 cm2 em 10 mL de IMDM com 20% de SFB e acondicionadas a 37 °C e 5% CO2. Após três dias, a fração não aderente foi removida por meio de lavagem com PBS e o meio de cultivo trocado. Após 14 dias, as células foram removidas com solução de Tripsina 0,125% EDTA 0,78 mM e expandidas.

Preparo do extrato de tendão bovino

Foram obtidos cinco tendões de calcâneo bovino. Os tendões foram macerados mecanicamente e em seguida triturados com um homogeneizador elétrico de 20 Watts de potência, na proporção de 1 g de tecido para 2 ml de IMDM sem SFB.15 O extrato do tecido foi centrifugado a 836 g por cinco minutos a 8 °C e posteriormente acondicionado a -80 °C por no máximo dois meses.

Análise da viabilidade celular pelo método de MTT

BMSCs foram cultivadas em placas de 24 poços, na densidade de 2,5 × 104 células/poço e tratadas com extrato de tendão bovino diluído nas proporções de 1:10, 1:50 ou 1:250 v/v em meio IMDM suplementado com 10% de soro fetal bovino (SFB). A viabilidade celular foi avaliada após 24, 72, 120 e 168 horas após o tratamento, na presença de MTT (thiazolyl blue tetrazolium bromide, Sigma Aldrich) na concentração de 25 mg/ml. Concentrações iguais de dimetilsulfóxido (DMSO) foram usadas como controle negativo. A avaliação colorimétrica foi feita em comprimento de onda de 550 nm, com o leitor SIRIO S SEAC (Burladingen, Alemanha).

Análise da expressão gênica por qPCR

BMSCs foram cultivadas sob as diferentes condições experimentais descritas anteriormente (1:10, 1:50 ou 1:250 v/v) por sete, 14 e 21 dias. Em seguida, as células foram lavadas e o RNA total foi extraído pelo método do Trizol(r) (Invitrogen Corp., Carlsbad, CA, USA) e tratado com DNase (Ambion(r) DNA-free(tm) DNase Treatment (Life Technologies), conforme as instruções do fabricante. A integridade e a quantidade do RNA foram avaliadas por eletroforese em gel desnaturante e por meio do espectrofotômetro NanodropTM 1000 (Thermo Fisher Scientific Inc). A transcrição reversa para a síntese do DNA complementar (cDNA) foi feita em duplicata, a partir de 1,0 µg de RNA, com o sistema ImProm-II(tm) Reverse Transcription System (Promega) conforme protocolo do fabricante. A qPCR foi feita com o sistema de detecção Power Sybr Green Master MIX(r) (Applied Biosystems, Molecular Probes, Inc) no equipamento Step One (Applied Biosystems, Molecular Probes, Inc). Foram usados primers dos genes constitutivos (rDNA 28S e actina) como controle do experimento. A expressão dos genes de colágeno tipo I, Biglican e Fibromodulina foi normalizada em relação à expressão do gene constitutivo ß-actina (tabela 1). O método 2-ΔΔCT13 foi usado para análise da expressão gênica dos genes alvo do estudo em relação ao gene constitutivo. Os valores expostos da expressão relativa consideram como referência o valor 1.0, fixo para o grupo controle (calibrador).

Tabela 1 Genes alvos e desenhos dos primers usados na análise de expressão gênica 

Gene alvo Número de acesso Sequencia (5'- 3') Produto (pb)
COL1A1 NM_000088.3 Senso GTGCTCCTGGTATTGCTGGT 150
antissenso GCTCTCCCTTAGCACCAGTGT
BGN NM_001711.4 Senso TGAAGTCTGTGCCCAAAGAGA 157
antissenso GCCTTCTCATGGATCTTGGA
FMOD NM_002023.4 Senso CAACACCTTCAATTCCAGCA 178
antissenso CTGCAGCTTGGAGAAGTTCA
ACTB NM_001101.3 Senso TACAATGAGCTGCGTGTGG 165
antissenso AGAGGCGTACAGGGATAGCA

COL1A1, colágeno 1 A; BGN, biglican; FMOD, fibrododulina; ACTB, beta actina; pb, tamanho do produto amplificado em pares de bases.

Resultados

Com o objetivo de avaliar a toxicidade do extrato de tendão bovino sobre as BMSCs, fez-se o ensaio de MTT. Os resultados mostram que o extrato de tendão bovino em nenhuma das concentrações testadas não altera a viabilidade das BMSCs (fig. 1). Desse modo podemos inferir que o extrato de tendão bovino não tem efeito citotóxico nas células-tronco mesenquimais.

Figura 1 Avaliação da citotoxicidade do extrato de tendão bovino nas células mesenquimais do estroma da medula óssea. C representa condição controle, 1:10, 1:50 e 1:250 representam as diluições do extrato de tendão bovino no meio IMDM, B representa a condição controle da técnica onde não há células. Em todas as condições foi usado o meio IMDM suplementado com 1% de SFB. 

Uma vez que não houve efeito citotóxico, foi testado o potencial de diferenciação do extrato de tendão bovino com o intuito de avaliar se os fatores de crescimento presentes no extrato estimulam a diferenciação das células progenitoras mesenquimais. Observamos que extrato é capaz de ativar nas BMSCs a expressão dos genes colágeno tipo I (fig. 2), biglican (fig. 3) e fibromodulina (fig. 4) durante o período de sete, 14 e 21 dias. Esses resultados mostram que o extrato de tendão bovino não é citotóxico e é capaz de induzir a expressão dos genes implicados na diferenciação tenocítica em células-tronco mesenquimais. O extrato proteico de tendão promove ainda uma indução de maneira dose dependente e em função do tempo de exposição ao extrato.

Figura 2 Expressão gênica de colágeno 1 em células mesenquimais do estroma da medula óssea tratadas com concentrações crescentes de extrato de tendão bovino (1:10, 1:50 e 1:250). Dados normalizados pela expressão do gene constitutivo ACTB. 

Figura 3 Avaliação da expressão de biglican por qPCR das células mesenquimais estromais tratadas com concentrações crescentes de extrato de tendão bovino (1:10, 1:50 e 1:250). 

Figura 4 Avaliação da expressão de fibromodulina por qPCR das células mesenquimais estromais tratadas com concentrações crescentes de extrato de tendão bovino (1:10, 1:50 e 1:250). 

Discussão

Nosso estudo mostrou o potencial do extrato de tendão bovino de induzir a diferenciação tenocítica das BMSCs e que esse extrato não tem citotoxicidade em qualquer das concentrações usadas. Em nossas análises, os resultados mostraram que existe uma janela de tempo e espaço para o sucesso na diferenciação das BMSCs em tenócitos. Destacamos que para a eficiência do procedimento as BMSCs em confluência de 70% sejam tratadas com 1:50 de extrato de tendão por sete dias. Nesse momento observamos o pico da expressão de biglican e fibromodulina, marcadores de tenócitos,16,17,18,19,20and21 o que indica o comprometimento das BMSCs com a linhagem tenocítica.O protocolo de tratamento deve seguir com o aumento da concentração de extrato, que deve ser o de 1:10 por mais 10 dias. Isso faz com que as BMSCs mantenham a expressão de Colágeno 1 e proporcionem uma matriz extracelular eficiente para manter a viabilidade das células.

Nossos resultados sugerem que no tendão há fatores de crescimento que estimulam a diferenciação de células multipotentes em células tendíneas, o que abre uma possibilidade para o campo da terapia celular no tratamento das tendinopatias. Finalmente, o potencial foi avaliado em modelo in vitro e há necessidade de validação em modelo in vivo para confirmação dos resultados. Ainda, levantamos a possibilidade de, futuramente, avaliar o potencial do extrato de tendão proveniente de tendões humanos de doadores-cadáver.

Conclusões

O conjunto de resultados mostra que o tratamento das BMSCs com extrato proteico de tendão bovino promove a diferenciação em tenócitos.

REFERÊNCIAS

1. Luo Q, Song G, Song Y, Xu B, Qin J, Shi Y. Indirect co- culture with tenocytes promotes proliferation and mRNA expression of tendon/ligament related genes in rat bone marrow mesenchymal stem cells. Cytotechnology. 2009;61(1-2):1-10. [ Links ]

2. Bi Y, Ehirchiou D, Kilts TM, Inkson CA, Embree MC, Sonoyama W, et al. Identification of tendon stem/progenitor cells and the role of the extracellular matrix in their niche. Nat Med. 2007;13(10):1219-27. [ Links ]

3. Lin Y. From collagen to tenocyte - how the equine superficial tendon responds to physiologic challenges and physical therapy. Universidade Utrecht, Faculdade Diergerneeskunde; 2005. Available from: http://dspace.library.uu.nl/bitstream/handle/1874/7411/index.htm;jsessionid=F9F0939F8C85434883E51A7B4AB1F0D6?sequence=8. [ Links ]

4. Andrade LR. Biomateriais utilizados em bioengenharia ortopédica. Rev Estud Biol. 2006;28(63):17-23. [ Links ]

5. Wang T, Xu Z, Jiang W, Ma A. Cell-to-cell contact induces mesenchymal stem cell to differentiate into cardiomyocyte and smooth muscle cell. Int J Cardiol. 2006;109(1):74-81. [ Links ]

6. Chen WH, Lai MT, Wu AT, Wu CC, Gelovani JG, Lin CT, et al. In vitro stage-specific chondrogenesis of mesenchymal stem cells committed to chondrocytes. Arthritis Rheum. 2009;60(2):450-9. [ Links ]

7. Csaki C, Matis U, Mobasheri A, Shakibaei M. Co- culture of canine mesenchymal stem cells with primary bone- derived osteoblasts promotes osteogenic differentiation. Histochem Cell Biol. 2009;131(2):251-66. [ Links ]

8. Alberton P, Popov C, Prägert M, Kohler J, Shukunami C, Schieker M, et al. Conversion of human bone marrow- derived mesenchymal stem cells into tendon progenitor cells by ectopic expression of scleraxis. Stem Cells Dev. 2012;21(6):846-58. [ Links ]

9. Juncosa-Melvin N, Boivin GP, Gooch C, Galloway MT, West JR, Dunn MG, et al. The effect of autologous mesenchymal stem cells on the biomechanics and histology of gel- collagen sponge constructs used for rabbit patellar tendon repair. Tissue Eng. 2006;12(2):369-79. [ Links ]

10. Sahoo S, Toh SL, Goh JC. A bFGF- releasing silk/PLGA-based biohybrid scaffold for ligament/tendon tissue engineering using mesenchymal progenitor cells. Biomaterials. 2010;31(11):2990-8. [ Links ]

11. Bashir J, Sherman A, Lee H, Kaplan L, Hare JM. Mesenchymal stem cell therapies in the treatment of musculoskeletal diseases. PM R J. 2014;6(1):61-9. [ Links ]

12. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402-8. [ Links ]

13. Chamberlain G, Fox J, Ashton B, Middleton J. Concise review: mesenchymal stem cells: their phenotype, differentiation capacity, immunological features, and potential for homing. Stem Cells. 2007;25(11):2739-49. [ Links ]

14. Lee IC, Wang JH, Lee YT, Young TH. The differentiation of mesenchymal stem cells by mechanical stress or/and co- culture system. Biochem Biophys Res Commun. 2007;352(1):147-52. [ Links ]

15. Dietz FR, Mukhopadhyay B, Becker G, Daniels K, Solursh M. Peripheral nerve extract effects on mesenchymal cells. Iowa Orthop J. 1996;16:46-57. [ Links ]

16. Liu XN, Yin Q, Zhang H, Zhang H, Zhu SJ, Wei YJ, et al. Tissue extracts from infarcted myocardium of rats in promoting the differentiation of bone marrow stromal cells into cardiomyocyte-like cells. Biomed Environ Sci. 2008;21(2):110-7. [ Links ]

17. Schweitzer R, Chyung JH, Murtaugh LC, Brent AE, Rosen V, Olson EN, et al. Analysis of the tendon cell fate using Scleraxis, a specific marker for tendons and ligaments. Development. 2001;128(19):3855-66. [ Links ]

18. Aslan H, Kimelman- Bleich N, Pelled G, Gazit D. Molecular targets for tendon neoformation. J Clin Investig. 2008;118(2):439-44. [ Links ]

19. Kuo CK, Tuan RS. Mechanoactive tenogenic differentiation of human mesenchymal stem cells. Tissue Eng A. 2008;14(10):1615-27. [ Links ]

20. Zhu J, Li J, Wang B, Zhang WJ, Zhou G, Cao Y, et al. The regulation of phenotype of cultured tenocytes by microgrooved surface structure. Biomaterials. 2010;31(27):6952-8. [ Links ]

21. Min BH, Han MS, Woo JI, Park HJ, Park SR. The origin of cells that repopulate patellar tendons used for reconstructing anterior cruciate ligaments in man. J Bone Joint Surg Br. 2003;85(5):753-7. [ Links ]

Trabalho desenvolvido no Instituto Nacional de Traumatologia e Ortopedia Jamil Haddad (Into), Rio de Janeiro, RJ, Brasil.

Recebido: 20 de Outubro de 2014; Aceito: 03 de Fevereiro de 2015

Creative Commons License This is an open-access article distributed under the terms of the Creative Commons Attribution License