SciELO - Scientific Electronic Library Online

 
vol.42 issue6Antibodies anti-Infectious Bursal Disease virus and viral genome detection in broilers and chickens backyard at Bahia's poultry production areaGuinea pigs experimentally infected with vaccinia virus replicate and shed, but do not transmit the virus author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Article

  • pdf in Portuguese
  • ReadCube
  • Article in xml format
  • Article references
  • How to cite this article
  • Curriculum ScienTI
  • Automatic translation
  • Send this article by e-mail

Indicators

Related links

Share


Ciência Rural

Print version ISSN 0103-8478

Cienc. Rural vol.42 no.6 Santa Maria June 2012 Epub June 05, 2012

http://dx.doi.org/10.1590/S0103-84782012005000032 

Detecção molecular de Brucella canis em cães do Município de Cuiabá, Estado de Mato Grosso

 

Molecular detection of Brucella canis in dogs of Cuiabá city, Mato Grosso State

 

 

Carla Patricia Amarante e SilvaI; Arleana do Bom Parto Ferreira de AlmeidaII; Isabela de GodoyII; Ana Carolina Pires de AraújoII; Daniel Moura de AguiarII; Valéria Régia Franco SousaII; Luciano NakazatoII; Valéria DutraII, 1

IUniversidade Federal de Mato Grosso (UFMT), 78000-000, Cuiabá, MT, Brasil. E-mail: valdutra@ufmt.br
IIUFMT, Cuiabá, MT, Brasil

 

 


RESUMO

Este estudo teve como objetivo investigar a ocorrência da brucelose causada por Brucella canis em cães no município de Cuiabá, MT, e os possíveis fatores de risco associados durante o período de 2007 a 2008. Foram analisadas 327 amostras baseadas numa amostragem aleatória simples, abrangendo os quatro distritos do município. A ocorrência da B. canis foi de 24,1% (I.C. 95%: 19,7 - 29,0%). A análise estatística dos sinais clínicos demonstrou associação de conjuntivite e ceratite com a positividade por B. canis, com um valor de odds ratio de 4,72 (I.C.95%=1,30-17,76) e Exato de Fisher de 0,0103; e 16,69 (I.C.95%=1,86-385,55) e Exato de Fisher de 0,0036, respectivamente. Os resultados obtidos neste estudo demonstraram a ocorrência da B. canis no município de Cuiabá e sugerem novas pesquisas e monitoramento, além de propor, como diagnóstico molecular para B. canis, a técnica de PCR.

Palavras-chave: brucelose, PCR, Brucella canis, cães, Cuiabá.


ABSTRACT

This study aimed to investigate the occurrence of brucellosis caused by Brucella canis in dogs in Cuiabá, State of Mato Grosso, and possible risk factors associated during the period of 2007 to 2008. Three hundred twenty seven samples were analized based on simple random sampling, covering the 04(four) districts of the municipality. The occurrence of B. canis was 24.1% (95% CI: 19.7-29.0%). The statiscal analysis showed association of conjunctivitis and keratitis with the positivity of B. canis, with an odds ratio of 4.72(95% CI=1.30-17.76) and 0.0103 for Fisher's Exact, and 16.69(95% CI=1.86-385.55) and 0.0036 for Fisher's Exact, respectively. The results of this study demonstrate the occurrence of B. canis in this city of Cuiabá, and suggest and new research and monitoring and proposes a molecular diagnostics to B. canis, the PCR techinique.

Key words: brucellosis, PCR, Brucella canis, dogs, Cuiabá.


 

 

INTRODUÇÃO

A brucelose é considerada uma zoonose de importância em saúde pública que acomete o homem e os animais (ALTON et al., 1976; CARMICHAEL et al., 1968; KEID 2006). A infecção por Brucella canis é descrita em um número limitado de animais, sendo os canídeos domésticos e silvestres os mais susceptíveis, e a doença, quando ocorre em canis, ocasiona perdas reprodutivas (MIRANDA et al., 2005).

Relatos de casos em humanos infectados foram associados ao contato com cães (MIRANDA et al., 2005), manifestando-se principalmente em tratadores de canis e em proprietários de cães infectados (SUZUKI et al., 2008). A infecção é transmitida por contato direto e indireto com animais infectados, através de tecidos fetais abortados, descargas vaginais do parto ou do abortamento, assim como urina (OLIVEIRA et al., 2010; SALGADO, 2006). Em 2010, KAO et al. relataram dois casos em humanos no Japão e, em 2011, LAWACZECK et al. relataram um caso positivo para B. canis em paciente com a Síndrome da Imunodeficiência Adquirida no Arizona (EUA). FONSECA et al. (1999) também examinaram soros humanos e encontraram 14,6% de amostras reagentes para B. canis, sendo que 11,2% dos positivos eram donas de casa que provavelmente se infectaram pelo contato com animais de estimação. A infecção através da manipulação de material positivo é descrita em laboratoristas, sendo esta bactéria classificada na categoria B de bioterrorismo (AL DAHOUK et al., 2010).

O diagnóstico de rotina das bruceloses tem sido baseado em métodos diretos (cultura) e indiretos (testes sorológicos). Os métodos sorológicos mais utilizados se baseiam em técnicas de aglutinação e/ou precipitação contra antígenos de B. ovis ou B. canis, pois estas espécies compartilham antígenos de superfície e são utilizadas para o diagnóstico da brucelose canina (KEID, 2006). Atualmente, existem outros métodos propostos para detecção da infecção no cão, incluindo ensaios de imunocromatografia (KIM et al., 2007) e método de Reação em Cadeia pela Polimerase (PCR) (KEID et al., 2007b; OLIVEIRA et al., 2010). A PCR é uma alternativa pela rapidez e sensibilidade da técnica em detectar DNA de Brucella, pois não depende da viabilidade da bactéria, nem da presença de contaminantes (KEID et al., 2007b).

Considerando a importância da brucelose canina como zoonose e do diagnóstico molecular para este agente, além da escassez de dados na cidade de Cuiabá, os objetivos do presente trabalho foram determinar a ocorrência da brucelose por B. canis pela PCR no município e verificar possíveis fatores de risco que poderiam favorecer a ocorrência da infecção.

 

MATERIAL E MÉTODOS

Área de estudo

O inquérito foi realizado no município de Cuiabá, no período de março de 2007 a março de 2008. Conforme a Lei n.3262 de 1994, criaram-se as Administrações Regionais no Município de Cuiabá, dividindo-o em Distritos Sanitários: Norte, Sul, Leste e Oeste. Os dados deste trabalho pertencem a um bairro de um dos quatro Distritos Sanitários:: Morada do Ouro (Norte), Coophema (Sul), Jardim Universitário (Leste) e Cidade Alta (Oeste).

Amostragem

O número de amostras foi calculado com base na população canina de cada bairro, com aproximadamente 694 animais por bairro, de acordo com o censo animal realizado pelo Centro de Controle de Zoonoses de Cuiabá, MT (2007), onde, no bairro Coophema, tem-se uma estimativa populacional de 486 cães; Cidade Alta com 691 cães; Jardim Universitário com 717 cães e Morada do Ouro com 879 cães. O cálculo foi executado pelo programa Epi Info 3.5.1 (2008), considerando-se a prevalência estimada de 33,16% KEID (2006), erro aceitável de 10% e nível de confiança de 95%, resultando em 71 cães no Coophema, Cidade Alta com 74 cães, Jardim Universitário com 74 cães e Morada do Ouro com 75 cães, resultando em 294 amostras, entretanto, como foram coletadas 327 amostras, todas foram testadas, totalizando um n amostral de 327.

A unidade amostral foi feita por domicílio, sem contato prévio com o proprietário. Nos bairros selecionados, foram visitadas todas as ruas e cada quinta casa, a última foi selecionada. Os animais foram submetidos ao exame clínico geral, através da inspeção e palpação. As amostras sanguíneas foram obtidas por venopunção cefálica ou jugular externa, totalizando 05 mililitros (ml). Após a coleta, as amostras sanguíneas foram acondicionadas individualmente e enviadas, devidamente refrigeradas ao laboratório e conservadas a -20°C até o momento de extração de DNA.

Extração de DNA e Reação em Cadeia pela Polimerase (PCR)

As amostras foram submetidas à extração de DNA genômico, conforme protocolo descrito por AUSUBEL et al. (1999). A seguir, foram realizados os testes moleculares pela PCR, de acordo com o protocolo descrito por KIM et al.(2006), utilizando-se os oligonucleotídeos B2N-1 (GTCGCGGATTCTACCTCACCT) e B2N-2 (TAAGCAGGTAAGAGGCAATTT) que amplificam um fragmento de 280 pares de bases(pb) do gene virB2 para a espécie Brucella canis. Os produtos amplificados foram analisados por eletroforese em gel de agarose 1,5%, corados com brometo de etídio e observados em transluminador (300nm), com marcador de massa molecular de 100pb.

Levantamento dos fatores de risco

Durante a coleta de sangue, foi aplicado um questionário a cada proprietário com abordagens referentes a sexo, raça, idade, manejo (permanência na casa, convívio com a família, acesso à rua e convívio com outros animais).

Análise estatística

Para o estudo de associação da presença de sinais clínicos e fatores de risco associados à positividade para B. canis, foi realizada análise univariada através da estimativa pontual e intervalar da odds ratio (OR) (OR foi calculado quando o P<0,05), executada pelo Epi Info 3.5.1 (2008). O resultado foi considerado significativo quando o intervalo de confiança não incluía o valor 1. O teste de hipóteses foi realizado pelo teste do Qui-quadrado ou exato de Fisher, quando necessário (teste monocaudal) (ZAR 1999), e o nível de significância adotado foi de 0,05.

 

RESULTADOS

Dos 327 animais testados, 79 (24,1%) (IC 95%: 19,7 - 29,0) foram positivos ao PCR. O bairro com maior percentual de animais positivos foi Cidade Alta com 24 (27,2%), seguidos por 21 (23,8%) no Morada do Ouro, 16 (22,8%) no Coophema e 18 (22%) no Jardim Universitário, não havendo diferença estatística entre eles. Os resultados da análise de associação entre variáveis como sexo, raça, idade, tipos de manejo, presença ou ausência de sinais clínicos e positividade por B. canis são apresentados na tabela 1.

Foi observada a associação entre a presença de conjuntivite e ceratite com a positividade por B. canis, sendo considerados estatisticamente significativos p0,05 (Tabela 2).

 

DISCUSSÃO

O presente estudo detectou pela primeira vez cães positivos para B. canis pela PCR em Cuiabá, MT, e a ocorrência dessa infeção foi de 24,1%. Em estudo anterior no mesmo município, SILVA (2010) relatou a prevalência de anticorpos contra o agente em 21,2% dos cães avaliados. Apesar desta concordância de resultados, KEID et al. (2007a) relatam que os métodos baseados em biologia molecular permitem um diagnóstico mais rápido e eficaz quando o exame de brucelose é realizado em populações caninas. Assim, o diagnóstico por PCR poderia ser usado como teste confirmatório para infecção por B. canis.

Relatos da infecção por este agente em cães vêm sendo também realizados em diferentes localidades do Brasil através da detecção de anticorpos. CAVALCANTI et al. (2006), em Salvador, ALMEIDA et al. (2004), em Alfenas, MG, AGUIAR et al. (2005), em Monte Negro, RO, e AZEVEDO et al. (2003), em Santana do Parnaíba, SP, obtiveram, respectivamente, 5,88%, 14,2%, 3,6% e 2,2% de animais positivos. As diferenças observadas entre o resultado do presente estudo e dos demais supracitados podem ser justificadas pela metodologia conduzida por testes sorológicos, o que difere do diagnóstico molecular que possui maior sensibilidade e especificidade (BRICKER, 2002; KEID et al., 2009; NOOSUD et al., 2009). Por outro lado, quando analisados canis com problemas reprodutivos, VARGAS et al. (1996), no município de Uruguaiana, RS, e MEGID et al. (1999), em Botucatu, SP, detectaram 72,7% e 57,1% de positividade, respectivamente. Nesses locais, as taxas de infeção tendem a ser mais elevadas em virtude do ambiente propício para rápida difusão da infecção (CARMICHAEL & GREENE, 1998).

Não foi observada associação entre a infecção por B. canis e a variável sexo, estando igualmente expostos tanto os machos (46,8%) como as fêmeas (53,1%). Resultados semelhantes foram descritos por PORTO et al. (2008), AZEVEDO et al. (2003), CAVALCANTI et al. (2006), embora utilizando métodos sorológicos. Neste estudo, não houve predisposição de raça, estando os animais positivos SRD (46,8%) e os com raça definida (53,1%) igualmente expostos à infecção. HOLLET (2006) relata que, apesar de ter uma maior prevalência em cães de raça pura, animais mestiços e SRD reprodutivamente ativos são suscetíveis. Resultados diferentes foram encontrados por PORTO et al. (2008), que relatam diferenças observadas entre raça na cidade de Maceió, AL. Neste caso, representado pela menor positividade nos cães com raça definida.

Em relação à idade, no presente estudo, observou-se que 70 (88,60%) dos animais positivos tinham mais de um ano de idade, mas não foi observada associação significativa entre idade e a ocorrência de positivos por B. canis, porém essa faixa etária estava em maior número de animais coletados. Resultados similares foram obtidos por PORTO et al. (2008), VASCONCELOS et al. (2008) e CAVALCANTI et al. (2006), que encontraram uma maior proporção de positivos em animais com idade superior a um ano. Isso pode ser justificado pela maturidade reprodutiva do cão, bem como pela maior possibilidade de contato com animais infectados em função da idade (CARMICHAEL & GREENE, 1998; AZEVEDO et al., 2003).

Ao analisar o tipo de manejo, foram considerados: o tempo do animal com a família, função na casa, local de permanência na casa, convivência com outros animais e acesso à rua. Após análise, não foi constatada associação significativa com a ocorrência de positividade por B. canis. Apenas AZEVEDO et al. (2003) observaram associação com cães mantidos soltos.

Em relação à presença de sinais clínicos, observou-se que 44 (55,6%) dos cães que não apresentavam e 35 (44,3%) dos que apresentavam sinais clínicos foram positivos para B. canis. HOLLET (2006) relata que os sinais clínicos variam desde formas assintomáticas, apesar de uma infecção sistêmica em curso. Os principais sinais clínicos encontrados neste estudo estão descritos na tabela 2, a qual sumariza a frequência desses sinais nos cães analisados para B. canis. De acordo com o tipo de sinal clínico, observou-se a associação entre conjuntivite e ceratite com a positividade para B. canis. A presença de lesões oculares em cães naturalmente e experimentalmente infectados por B. canis foi relatada por LEDBETTER et al. (2009), inclusive com ceratoconjuntivite.

 

CONCLUSÃO

Através dos resultados obtidos neste estudo, observou-se uma ocorrência de 24,1% para B. canis no município de Cuiabá. O perfil epidemiológico da infecção mostrou que a B. canis infecta em iguais condições os animais em relação ao sexo, raça e tipos de manejo, havendo, contudo, associação significativa entre positividade por B. canis e presença de conjuntivite e ceratite. O estudo sugere que medidas sejam adotadas, como ações locais que agilizam o controle e desenvolvam um monitoramento das regiões ou setores de maior ocorrência, juntamente com a implantação de um Programa de Controle da Brucelose Canina que viabilize e execute propostas de Ação, Vigilância e Educação em Saúde para a população.

 

COMITÊ DE ÉTICA E BIOSSEGURANÇA

O presente trabalho foi aprovado pelo Comitê de Ética e Pesquisa Animal (CEPA) - Universidade Federal de Mato Grosso (UFMT) de n° 23108.014949/11-1, sendo realizada de acordo com as normas éticas.

 

AGRADECIMENTOS

Ao professor Rodrigo Martins Soares do Departamento de Medicina Veterinária Preventiva e Saúde Animal da FMVZ- USP, por ter cedido o controle positivo para o teste.

 

REFERÊNCIAS

AGUIAR, D.M. et al. Ocorrência de anticorpos anti-Brucella abortus e anti-Brucella canis em cães rurais e urbanos do Município de Monte Negro, Rondônia, Brasil. Ciência Rural, v.35, n.5, p.1216-1219, 2005. Disponível em: <http://www.scielo.br/pdf/cr/v35n5/a39v35n5.pdf>. Acesso em: 08 jun.2010. doi: 10.1590/S0103-84782005000500039.         [ Links ]

AL DAHOUK S. et al. Differential phenotyping of Brucella species using a newly developed semi-automated metabolic system. BMC Microbiology, n.10, p. 269, 2010. Disponível em: <http://www.biomedcentral.com/1471-2180/10/269>. Acesso em: 28 mar. 2011.         [ Links ]

ALMEIDA, A.C. et al. Soroepidemiologia da brucelose canina causada por Brucella canis e Brucella abortus na cidade de alfenas, MG. Arquivo Brasileiro de Medicina Veterinária e Zootecnia, v.56, n.2, p.275-276, 2004. Disponível em: <http://www.scielo.br/pdf/abmvz/v56n2/20341.pdf>. Acesso em: 15 jul. 2010.         [ Links ]

ALTON, G.G. et al. Techniques for the brucellosis laboratory. Paris :INRA, 1976. 109p.         [ Links ]

AUSUBEL, F.M. et al. Short protocols in molecular biology. 4.ed. New York: Wiley & Sons, 1999. 1512p.         [ Links ]

AZEVEDO, S.S. et al. Inquérito sorológico e fatores de risco para a brucelose por Brucella canis em cães do Município de Santana de Parnaíba, Estado de São Paulo. Pesquisa Veterinária Brasileira, v.23, n.4, p.156-160, 2003. Disponível em: <http://www.scielo.br/pdf/pvb/v23n4/18730.pdf>. Acesso em: 17 fev. 2010.         [ Links ]

BRICKER, B.J. PCR as a diagnostic tool for Brucellosis. Veterinary Microbiology, v.2402, p.1-12, 2002. Disponível em: <www.ncbi.nlm.nih.gov/pmc/articles/PMC2931434>. Acesso em: 13 nov. 2010. doi:10.1016/S0378-1135(02)00228-6.         [ Links ]

CARMICHAEL, L.E.; BRUNER , D.W. Characterization of a newly recognized species of Brucella responsible for infectious canine abortions. Cornell Veterinarian, v.58, p.579-592, 1968.         [ Links ]

CARMICHAEL L.E.; GREENE, C.E. Canine brucellosis. In: GREENE, C.E. (Ed.). Infectious diseases of the dog and cat. 2.ed. Philadelphia: Saunders, 1998. p.248-257.         [ Links ]

CAVALCANTI, L.A. et al. Pesquisa de anticorpos anti- Brucella canis em cães provenientes da região metropolitana de Salvador. Revista Brasileira de Saúde Produção Animal, v.7, n.2, p. 176-180, 2006. Disponível em: <http://www.rbspa.ufba.br>. ISSN 1519 9940. Acesso em: 23 set. 2010.         [ Links ]

FONSECA L.S. et al. Prevalência de brucelose em diferentes grupos populacionais da cidade de Belém-PA. Revista Paraense de Medicina, v.12, n.2, p.23-28, 1999. Disponível em: <http://bases.bireme.br/cgi-bin/wxislind.exe/iah/online/?IsisScript=iah/iah.xis&src=google&base=LILACS&lang= p&nextAction=lnk&exprSearch=251421&indexSearch=ID>. Acesso em: 26 jun. 2010.         [ Links ]

HOLLET R.B. Canine brucellosis: outbreaks and compliance. Theriogenology, v.66, p.575-587, 2006. Disponível em: <http://www.tc.umn.edu/~rootk001/stfan_brucellosis.pdf>. Acesso em: 04 fev. 2010. doi:10.1016/j.theriogenology.2006.04.011.         [ Links ]

KAO T.M. et al. Human Brucella canis infections diagnosed by blood culture. Emerging Infectious Diseases, v.16, n.7, p.1183-1185, 2010. Disponível em: <http://www.cdc.gov/eid/content/16/7/pdfs/1183.pdf>. Acesso em: 12 fev. 2011. doi:10.3201/eid1607.100105.         [ Links ]

KEID, L.B. Avaliação de métodos diretos e indiretos de diagnóstico de brucelose em cães naturalmente infectados. 2006. 134f. Tese (Doutorado em Epidemiologia Experimental e Aplicada às Zoonoses - Curso de Pós-graduação em Epidemiologia Experimental e Aplicada às Zoonoses, Universidade de São Paulo. Disponível em: <http://www.cipedya.com/doc/169084>. Acesso em: 19 mar. 2010.         [ Links ]

KEID, L.B. et al. Comparison between Serological and Microbiological Tests and a PCR Based on Primers to 16S-23S rDNAInterspacer. Veterinary Research Communications, v.31, p.951-965, 2007a. Disponível em: <https://springerlink3.metapress.com/content/a8152l5265320806/resource-secured/?target=fulltext.pdf&sid= ku3p3a1ywxbfyp2lpvmggdv5&sh=www.springerlink.com>. Acesso em: 09 set. 2010. doi:10.1007/s11259-006-0109-6.         [ Links ]

KEID, L.B. et al. A polymerase chain reaction for the detection of Brucella canis in semen of naturally infected dogs. Theriogenology, v.68, p.1203-1210, 2007b. Disponível em: <http://www.theriojournal.com/article/S0093-691X(07)00015-5/abstract>. Acesso em: 22 jun. 2010. doi:10.1016/j.theriogenology.2007.01.003.         [ Links ]

KEID, L.B. et al. Comparison of agar gel immunodiffusion test, rapid slide agglutination test, microbiological culture and PCR for the diagnosis of canine brucellosis. Research in Veterinary Science, v.86, p.22-26, 2009. Disponível em: <http://www.sciencedirect.com/science/article/pii/S0034528808001161>. Acesso em: 15 dez. 2010. doi:10.1016/j.rvsc.2008.05.012.         [ Links ]

KIM, S. et al. Detection of Brucella canis and Leptospira interrogans in canine semen by Multiplex Nested PCR. Journal of Veterinary Medical Science, v.68, n.6, p.615-618, 2006. Disponível em: <http://www.jstage.jst.go.jp/article/jvms/68/6/615/_pdf>. Acesso em: 23 out.2010. doi:10.1292/jvms.68.615.         [ Links ]

KIM, J.W. et al. Evaluation of immunochromatographic assay for serodiagnosis of Brucella canis. Journal of Veterinary Medical Science, v.69, p.1103-1107, 2007. Disponível em: <http://www.jstage.jst.go.jp/article/jvms/69/11/69_1103/_article>. Acesso em: 12 mar. 2010. doi:10.1292/jvms.69.1103.         [ Links ]

LAWACZECK E. et al. Brucella canis in a HIV- infected patient. Zoonoses and Public Health, v.58, p.150-152, 2011. Disponível em: <http://onlinelibrary.wiley.com/doi/10.1111/j.1863-2378.2010.01334.x/pdf>. Acesso em: 15 jul.2011. doi: 10.1111/j.1863-2378.2010.01334.x.         [ Links ]

LEDBETTER, E.C. et al. Brucella canis endophthalmitis in 3 dogs: clinical features, diagnosis, and treatment. Veterinary Ophthalmology, v.12, n.3, p.183-191, 2009. Disponível em: <http://onlinelibrary.wiley.com/doi/10.1111/j.1463-5224.2009.00690.x/pdf>. Acesso em: 27 jul. 2010. doi: 10.1111/j.1463-5224.2009.00690.x.         [ Links ]

MEGID, J. et al. Epidemiological assessment of canine brucellosis. Arquivo Brasileiro de Medicina Veterinária e Zootecnia, v.51, n.5, p.439-440, 1999. Disponível em: <http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0102-09351999000500007&lng=en&nrm=iso>. Acesso em: 14 jul. 2011. doi: 10.1590/S0102-09351999000500007.         [ Links ]

MIRANDA K.L. et al. Brucelose canina. Caderno Técnico de Veterinária e Zootecnia, n.47, p.66-82, 2005.         [ Links ]

MORAES, C.C.G. et al. Prevalência da brucelose canina na microrregião da serra de Botucatu, São Paulo, Brasil. Arquivo Instituto Biológico, v.69, n.2, p.7-10, 2002. Disponível em: <http://www.biologico.sp.gov.br/docs/arq/V69_2/moraes.pdf>. Acesso em: 23 jun. 2010.         [ Links ]

NOOSUD, J. et al. Comparison of a serological method, a bacteriological method and 16S r RNA Brucella canis PCR for canine brucellosis diagnosis. Kasetsart Journal (National Science), v.43, p.159-164, 2009. Disponível em: <kasetsartjournal.ku.ac.th/kuj_files/2010/A1003081236275000.pdf>. Acesso em: 25 maio, 2011.         [ Links ]

OLIVEIRA M.Z.D. et al. Validation of an ELISA method for the serological diagnosis of canine brucellosis due to Brucella canis. Research in Veterinary Science, n.90, p.425-431, 2010. Disponível em: <http://www.sciencedirect.com/science/article/pii/S0034528810002407>. Acesso em: 29 jan. 2011. doi: 10.1016/ j.rvsc.2010.07.004.         [ Links ]

PORTO, W.J.N. et al. Associação entre distúrbios reprodutivos e anticorpos anti-Brucella sp em cães atendidos em clínicas particulares da cidade de Maceió. Revista Brasileira de Ciências Veterinária, v.15, n.1, p.6-9, 2008. Disponível em: <www.uff.br/rbcv/site/index.php/pages/process?file=Artigo/6/arquivo>. Acesso em: 22 jun. 2010.         [ Links ]

SALGADO, V.R. Avaliação das técnicas de cultivo microbiológico e soroaglutinação rápida em cartão com e sem 2-mercaptoetanol no diagnóstico da brucelose canina. 2006. 146f. Dissertação (Mestrado em Medicina Veterinária) - Curso de Pós-graduação da Faculdade de Medicina Veterinária e Zootecnia, Universidade Estadual Paulista. Disponível em: <http://www.athena.biblioteca.unesp.br/exlibris/bd/bbo/33004064022P3/2006/salgado_vr_me_botfmvz.pdf>. Acesso em: 18 jun. 2010.         [ Links ]

SILVA, G.C.P. Soroprevalência de aglutininas anti-leptospira e reação anti-brucella em cães, Mato Grosso, Brasil. 2010. 100f. Dissertação (Mestrado em Ciências Veterinárias) -Curso de Pós-graduação em Ciências Veterinárias, Universidade Federal de Mato Grosso. Disponível em: <http://www.dominiopublico.gov.br/pesquisa/DetalheObraForm.do?select_action=&co_obra=194738>. Acesso em: 20 jun. 2011.         [ Links ]

SUZUKI, E.Y. et al. Brucelose canina: revisão de literatura. Revista Científica Eletrônica de Medicina Veterinária, ano 6, n.10, p.1-4, 2008. ISSN: 1679-7353. Disponível em: <http://www.revista.inf.br/veterinaria10/revisao/edic-vi-n10-RL11.pdf>. Acesso em: 23 jun. 2010.         [ Links ]

VARGAS, A.C. et al. Brucelose canina: relato de caso. Ciência Rural, v.26, n.2, p.305-308, 1996. Disponível em: <http://www.scielo.br/pdf/cr/v26n2/a24v26n2.pdf>. Acesso em: 25 out. 2010. doi: 10.1590/S0103-84781996000200024.         [ Links ]

VASCONCELOS, R.T.J. et al. Soroprevalência e fatores de risco associados à infecção por Brucella canis em cães da cidade de Campina Grande, estado da Paraíba. Revista Brasileira de Saúde e Produção Animal - RBSPA, v.9, n.3, p.436-442, 2008. Disponível em: <http://www.rbspa.ufba.br ISSN 15199940>. Acesso em: 27 jul. 2010.         [ Links ]

ZAR J.H. Biostatistical analysis. 4.ed. Upper Saddle River: Prentice Hall, 1999. 663p.         [ Links ]

 

 

Recebido para publicação 23.08.11
Aprovado em 08.02.12
Devolvido pelo autor 20.04.12
CR-5882

 

 

1 Autor para correspondência.