mecA positive Staphylococcus spp. in bovine mastitis, milkers, milking environment, and the circulation of different MRSA clones at dairy cows farms in the Northeast region of Brazil

Staphylococcus spp. mecA positivo em mastite bovina, ordenhadores, ambiente de ordenha e circulação de diferentes clones de MRSA em fazendas de vacas leiteiras na região Nordeste do Brasil

ABSTRACT:

This study detected the presence and distribution of mecA in Staphylococcus spp. in the dairy production environment at farm level in Brazil. We analyzed 335 samples of mastitis cow milk, 15 samples of nostrils and hand swabs from milkers, 14 teat cup swabs, and 9 milking buckets swabs. Initially, the samples were subjected to microbiological analysis to detect Staphylococcus spp. and then S. aureus and mecA positive isolates were identified by PCR. All S. aureus isolates carrying the mecA genes were subjected to DNA macro-restriction analysis by Pulsed-Field Gel Electrophoresis (PFGE). The mecA gene was detected in 6/335 (1.78%) of mastitis cow milk, 5/15 (33.3%), and 5/15 (33.3%) of nostrils and hand swab, and 4/14 (28.5%) of the teat cup isolates. MRSA genotyping was performed by PFGE, a total of seven pulsotypes were grouped in two clusters. This study identified the occurrence and spread of MRSA at dairy environment of farms, and also the existence of distinct genetic profiles between isolates.

Key words:
S. aureus; mecA gene; multidrug resistance; animal health; dairy production.

RESUMO:

Este estudo teve como objetivo detectar a presença e distribuição de mecA em Staphylococcus spp. no ambiente de produção leiteira em fazendas no Brasil. Foram analisadas 335 amostras de leite de vaca com mastite, 15 amostras de swabs de narinas e mãos de ordenhadores, 14 swabs de teteiras e nove swabs de baldes de ordenha. Inicialmente, as amostras foram submetidas a análises microbiológicas para detecção de Staphylococcus spp. e os isolados positivos foram identificados por PCR para S. aureus e mecA. Todos os isolados de S. aureus portadores do gene mecA foram submetidos à análise de macrorrestrição do DNA por Pulsed-Field Gel Electrophoresis (PFGE). O gene mecA foi detectado em 6/335 (1,78%) de leite de vaca com mastite, 5/15 (33,3%) e 5/15 (33,3%) de swab de narinas e de mãos, e 4/14 (28,5%) de teteiras. A genotipagem de MRSA realizada por PFGE identificou um total de sete pulsotipos, que foram agrupados em dois clusters. Este estudo identificou a ocorrência e disseminação de MRSA no ambiente das fazendas leiteiras, e também a existência de perfis genéticos distintos entre os isolados.

Palavras-chave:
S. aureus; gene mecA; multirresistência a medicamentos; saúde animal; produção de leite.

INTRODUCTION:

Mastitis is a plurietiological and multifactorial disease that is often caused by bacteria of the genus Staphylococcus. These bacteria is opportunistic pathogen associated with a wide variety of infections in humans and animals (WILLE et al., 2014; WONG, 2002).

Another concern related to mastitis caused by Staphylococcus spp. is the emergence of antimicrobial resistant strains, such as Methicillin-Resistant Staphylococcus (MRS) (LIM et al., 2013). Emergence of MRS strains results from modifications in the sites of antimicrobial action in the Staphylococcus Chromosome Cassettes (SCCmec), the acquisition of SCCmec occurred in the early 1960s, being considered a determining event in the evolution of this bacterial genus, which result in multiresistant isolates, especially to beta-lactams (CRISOSTOMO et al., 2001).

Twelve types of SCCmec that harbor mecA and/or mecC are now known; both these genes encode an altered penicillin binding proteins (PBP) called PBP2a/PBP2’ and a peptideoglycan transpeptidase that result in a decreased affinity for this class of antimicrobials (KIM et al., 2012; BAIG et al., 2018; LEE et al., 2018). This encoding allows Staphylococcus spp. to maintain its biosynthesis even at concentrations considered to be inhibitory to these antimicrobials (LIVERMORE, 2000; PATERSON et al., 2014).

MRS strains have been identified in cases of bovine mastitis in various parts of the world such as Great Britain, Korea, and Germany (FEßLER et al., 2010; LIM et al., 2013; PATERSON et al., 2014). Contact between humans and animals positive for MRS and vice versa, may also favor pathogen transmission between species, and the environment may be a source of infection for both (JUHÁSZ-KASZANYITZKY et al., 2007). In Brazil, few studies have identified cases of mastitis caused by MRS (SOARES et al., 2012; MATOS, 2014; SANTOS et al., 2016; MELO et al., 2018). However, no study conducted in the country has evaluated and detected the presence of MRS isolates in cases of mastitis, workers, and the milking environment, and a possible genetic correlation between MRS isolates from various sources in the agricultural environment. This demonstrated the need to conduct research that contributes to the epidemiology of infection with this pathogen in Brazil.

Considering the aspects mentioned above, this study detected the presence and distribution of mecA in Staphylococcus spp. in the dairy production environment at farm level in Brazil and determined the genetic relationship between mecA positive S. aureus.

MATERIALS AND METHODS:

Sample collection

Five dairy farms (A, B, C, D and E) located in different regions of Pernambuco State, Northeastern Brazil, were included in the present study. These five family farms had a total of 169 animals in lactation, being the milk from all those sampled. Milk samples collected from 676 udder quarters were subjected to the California Mastitis Tests (CMT) and those that were equal to or greater than one cross (+) (319 samples) or reported positive in the routine strip cup test (16 samples) were selected for microbiological testing. A total of 335 individual quarters were collected after antisepsis with alcohol at 70º GL. A veterinarian using sterile gloves performed the collection. Then they were stored in sterile microtubes.

Also, samples from dairy environment (mechanical milking equipment and milking buckets) and milkers (hands and nasal cavities) were obtained by using swabs and subjected to microbiological analysis. Of the five farms studied, two used mechanical milking; in these farms, swabs were collected from the teat sets (forming pools of each equipment). In the three farms that performed manual milking, swabs were collected from the buckets used for milking.

A total of 15 samples of nostrils and hand swabs from milkers, 14 samples from teat taps and nine samples of milking buckets were also obtained. The distribution of collected samples by farm is described in table 1. All samples were transported under refrigeration to the laboratory, where microbiological and molecular analyses were performed.

Table 1
Distribution of collected samples in the five dairy farms (A-E) included in the present study.

Dairy farms	Lactating cows	-------Milk------			--------------Milkers-------------		------------------Environment---------------
		CMT1	SCT2	Hands	Nasal	Teat cup	Milking buckets
A	32	55	6	3	3	-	2
B	15	15	0	2	2	-	2
C	43	96	1	3	3	4	-
D	61	100	8	4	4	-	5
E	18	53	1	3	3	10	-
Total	169	319	15	15	15	14	9

• ¹Reagent teat in the California Mastitis Test; ² Reagent teat in the Strip Cup Test.

Isolation and preliminary identification of Staphylococcus spp.

Isolation of Staphylococcus spp. of the milk samples was performed by direct plating of all samples on manitol salt agar (Difco Laboratories Inc., Detroit, USA), followed by incubation at 37 °C for 24-48 h. All swabs (samples of nostrils and hand swabs from milkers, samples from teat taps and samples of milking buckets) were inoculated into 9 mL Mueller Hinton broth (Difco Laboratories Inc., Detroit, USA) containing 6.5% NaCl, incubated overnight at 37 ºC and plated on manitol salt agar (Difco Laboratories Inc., Detroit, USA). Then, after incubation at 37 °C for 24-48 h isolated colonies which showed a distinct morphology (size and color) were subjected to Gram staining, catalase and coagulase tests, as well as mannitol fermentation (CARTER, 1998).

Subsequently, the isolates were subjected to molecular techniques for proper identification and characterization and determination of oxacillin minimum inhibitory concentration.

DNA extraction and PCR reactions

The genomic DNA of all isolates identified in preliminary tests as Staphylococcus spp. was extracted as previously described by FAN et al. (1995). The DNA obtained was quantified using a spectrophotometer at 260 nm absorbance readings. The identification of S. aureus was performed by PCR targeting nuc, whereas detection of MRS was performed by targeting mecA gene and mecC gene (Table 2). Reactions for both genes contained a final volume of 12.5 µL, consisting of 100 ng of isolated DNA, 0.5 µL of each primer (10 pmol), 6.25 µL of Go Taq Green Master Mix (Promega Corporation, Madison, USA), and 2.5 µL of ultrapure Milli-q water. The PCR products were subjected to 2% agarose gel electrophoresis for 60 minutes at 100 V. At the end of the run, BlueGreen-stained gels (LGC biotechnology) were visualized under ultraviolet light and imaged. For mecA and nuc genes detection, the S. aureus N315 strain was used as a positive control and for mecC detection, S. aureus LGA251 was used as positive control in all PCR reactions.

Table 2
Target genes and oligonucleotide sequences used to identify Staphylococcus aureus and Methicillin Resistant Staphylococcus.

Gene	Primer	Sequence	Fragment size (pb)	Reference
nuc	1	GCGATTGATGGTGATACGGT AGCCAAGCCTTGACGAACTAAAGC	270	BRAKSTA et al. (1992)
	2
mecA	2W	TGGTATGTGGAAGTTAGATTGGGAT CTAATCTCATATGTGTTCCTGTATTGGC	155	NAKAGAWA et al. (2005)
	2X
mecC	F	CATTAAAATCAGAGCGAGGC TGGCTGAACCCATTTTTGAT	188	PATERSON et al. (2012)
	R

Determination of minimum inhibitory concentration (MIC)

All isolates harboring the MRS genes were subjected to a broth microdilution assay to assess their resistance to methicillin, according the protocol described by the Clinical and Laboratory Standards Institute (CLSI, 2018). Oxacillin was used as a reference antimicrobial at concentrations of 16, 8, 4, 2, 1, 0.5 and 0,25 µg/mL.

For inoculum preparation, isolates were plated in non-selective solid medium (Mueller Hinton Agar, SIGMA-ALDRICH) and incubated at 37 °C for 24h. Isolated colonies were suspended in 0.9% saline until turbidity equivalent to 0.5 McFarland standard; this suspension contains approximately 1 x 10⁸ CFU/mL. Subsequently, the bacterial suspension was inoculated into Mueller Hinton broth (SIGMA-ALDRICH). Samples were processed in triplicate and a final volume of 100μL was distributed to each well of the 96-well micloplate. Plate microdilutions were incubated at 35 °C for 24h and OD readings at 620 nm were taken on the Elisa microplate reader (Multiskan Go Thermo Scientific).

MRSA PFGE genotyping

All S. aureus isolates carrying the MRS genes were subjected to DNA macro-restriction analysis according to the methodology described by ANDRÉ et al. (2008). Digestion with restriction enzymes was performed after 1/5 of the plugs were cut and transferred to tubes containing 150 µL of 1x TE buffer, where 30 U of SmaI (Promega Corporation, Madison, WI, USA) restriction enzyme was added. The reaction was performed overnight at 25 °C and plugs were transferred to 1% agarose gel wells. Electrophoresis performed with CHEF-DR III System (Bio-Rad Laboratories,Hercules, CA, USA). Electrophoresis was performed following the following parameters: 5-40 s for 21 h, at an angle of 120°, 6V/cm, in 0.5x TBE buffer maintained at 14 °C. The Salmonella enterica serotype Braenderup H9812 (CDC) digested with 20 IU of XbaI (Promega Corporation^®, Madison, WI, USA) was used as a marker (RIBOT et al., 2006). The obtained gels were developed in an immersion bath with intercalating UniSafe Dye (Uniscience, Brazil) and were visualized with a transilluminator under ultraviolet light and imaged for further analysis. Images were analyzed using BioNumerics v.6.6.4 software (Applied Maths, Kortrijk, Belgium). A dendrogram was obtained by the Unweighted Pair Group Method with Arithmetic Mean (UPGMA) grouping, using the Dice similarity coefficient and the 2% tolerance and optimization degree (TENOVER et al., 1995).

RESULTS:

The results of isolation, identification of Staphylococcus spp. and the mecA carriage of the samples of mastitis cow milk, milkers, and milking utensils are shown in table 3. All isolates were negative for mecC gene. The frequency of MRS mastitis was 1.78% (6/335), and of this total, most cases were caused by MRSA (83%; 5/6). At MIC all MRS isolates were sensitive for oxacillin as determined by CLSI (2018).

Table 3
Isolation, molecular identification of Staphylococcus spp. and mecA positive samples from mastitis cow milk, milkers, and milking utensils.

Sample	n¹	Isolation of Staphylococcus spp.2	Molecular identification of ---------Staphylococcus spp.3--------		Molecular identification of methicillin ----------------resistance5----------------
			S. aureus	Sna4	MRSA6	MRSNA7
Mastitis cow milk	335	114/335 (34.3%)	42/114 (36.8 %)	72/114 (63.1 %)	5/335 (1.49%)	1/335 (0.29%)
Milkers hand swab	15	11/ 15 (80%)	7/11 (63.6%)	4/11 (36.3%)	3/15 (20%)	2/15 (13.3%)
Milkers nostrils swab	15	13/15 (86.6%)	2/13 (15.3%)	11/13 (84.7%)	1/15 (6.6%)	4/15 (26.6%)
Teat cup swab	14	14/14 (100%)	4/14 (28.5%)	10/14 (71.5%)	1/14 (7.1%)	3/14 (21.4%)
Milking bucket swab	9	7/9 (88.8%)	6/7 (85.7%)	1/7 (14.3%)	0/9 (0%)	0/9 (0%)

• ¹Samples collected. ²Based on phenotypical characteristics. ³Based on PCR for nuc. ⁴ Staphylococcus non-aureus. ⁵Based on PCR for mecA.
• ⁶MRSA - Methicillin Resistant Staphylococcus aureus (MRSA); ⁷MRSNA - Methicillin Resistant Staphylococcus non-aureus (MRSNA).

The genetic profiles of 10 MRSA isolates identified in the present study were revealed by PFGE after macrorestriction performed with the enzyme SmaI (Figure 1). The isolates were grouped into seven pulsotypes (I-VII) within two clusters (I and II). Cluster I grouped four MRSA isolates (12 MNC, 6 MH, 1 TC and 4 MNC) which shared at least 73.1% similarity. Interesting, only MRSA isolates recovered from human and teat cup (from dairy farms B, C, and D) were grouped in this cluster.

Figure 1
PFGE profiles obtained after DNA macrorestriction (SmaI) of 10 MRSA isolates recovered at different sources (I and II: clusters; MH: milker hand; MNC: milker nasal cavity; TC: teat cup; RAT: right anterior teat; RRT: right rear teat; LAT: left anterior teat; I-VII: pulsotypes; ND: not digested) from five (A, B, C, D, and E) dairy farms located in Pernambuco state, Brazil. Similarities between the identified PFGE pulsetypes were estimated using the Dice coefficient (2%).

Cluster II grouped five MRSA isolates (163 RAT, 164 RRT, 30 RRT, 24 LAT and 32 RAT) recovered from samples of mastitis cow milk at farms A and E. It was possible to detect a greater genetic similarity between them (at least 94.2%). Isolates 163 RAT, 164 RRT and 30 RRT shared the same genetic profile (pulsotype V); although, they originated from farms far away (over 200 km), indicating that genetically similar MRSA strains are widespread in different regions of Pernambuco state, Brazil. The 3MN isolate was not digested by the enzyme SmaI; and therefore, it was not possible to determine its genetic correlation with other MRSA isolates.

DISCUSSION:

Staphylococcus spp. is one of the main causative agents of mastitis in dairy herds (KREWER et al., 2015; PRIBUL et al., 2011). Our data are in accordance with the literature, that reports infection rates of MRS from 0.05% to 47.6% in bovine mastitis (PU et al., 2014b; SAINI et al., 2012). It is important to highlight that only samples with positive results in CMT or in routine strip cup test were tested for MRS in the present study.

Nowadays, antimicrobial resistant bacteria are considered one of the major public health concern worldwide. Mastitis is the most common cause of antimicrobial use in dairy herds, so bovine milk is considered as potential source of multidrug-resistant bacteria in the agricultural environment (CHANDRASEKARAN et al., 2014a). This minimizes the effectiveness of current treatments and the ability to control infectious diseases in animals and humans, facilitating the spread of bacteria resistant to antimicrobials (LEE, 2006; JAMROZY et al., 2012; LIM et al., 2013; CHANDRASEKARAN et al., 2014b; SILVA et al., 2020), mainly due to the close relationship established in dairy farms between different animal species and humans (KAMAL et al., 2013; SILVA et al., 2014a; RAYMUNDO et al., 2018).

Methicillin is not an antimicrobial used in the treatment of mastitis in cows. However, MRS is a generic term that corresponds to a virtual resistance against practically all β-lactams, except the last generation cephalosporins; when MRS identification occurs, the isolate is considered multiresistant (PEACOCK & PATERSON, 2015).

The results presented in this study are in addition to others performed in the country that have identified cases of bovine mastitis due to MRSA and MRS . It should serve as a warning to animal health authorities regarding the improvement of programs for the control and rational use of antimicrobials in veterinary medicine (SOARES et al., 2012; MATOS, 2014; SILVA et al., 2014b; SANTOS et al., 2016; MELO et al., 2018). High use of antimicrobials or their indiscriminate use contributes to the selection and persistence of MRS strains; and consequently, their spread throughout the agricultural environment. One of the strategies to verify MRS spread in this environment is to collect samples from animals and other sources such as workers and the environment (JAMROZY et al., 2012; LIM et al., 2013).

In this study, MRS was identified in the nostrils and hands of milkers and in environmental samples (teat cups). With respect to samples from milkers, a high percentage of MRSA was detected on the hands, whereas MRSNA was the most identified in the nostrils. Identification of MRS in humans has been reported frequently, especially in cases of nosocomial infection, which has generated considerable concern among public health professionals (RABELO et al., 2014). As in this study, there are also reports of microorganism identification in dairy farm workers in other countries. VAN LOO et al. (2007) they investigated the origin of a new type of MRSA in the Netherlands and concluded that the new strain is of animal origin (pigs and probably cows). The authors suggested the occurrence of MRSA transmission between animals and humans. LIM et al. (2013) determined the presence and persistence of MRSA in milk, farm environment and farmers on 22 dairy farms in Korea, the microorganism was detected in all types of samples. The two studies suggested that people who work or live in close contact with cows are at increased risk of being colonized and infected with MRSA. However, humans can also serve as a source of infection for the environment and animals if they are already infected (JUHÁSZ-KASZANYITZKY et al., 2007). Thus there is a need to monitor microorganisms at the interface of dairy cows and humans (SCHMIDT et al., 2017).

As indicated in the literature, the detection of MRS in teat cups indicate a possible circulation between cows isolates and the environment or humans and the environment, as these utensils are handled by the milkers (FEßLER et al., 2012; LIM et al., 2013). Sample collection from teat cups was performed immediately after milking according to the method proposed by PLETINCKX et al. (2013). Detection of MRS in these utensils soon after milking indicates that these may be a source of transmission and a good indicator of the presence of MRS in dairy farms.

The results at MIC (values of 0.5 µg / mL - 2.0 µg / mL) may indicate the existence of susceptible oxacillin mecA Positive (OS-MRS) isolates. Divergence between genotypic and phenotypic resistance has been reported in literature (KAMAL et al., 2013; PU et al., 2014). Phenotypic tests may have limitations due to the occurrence of hetero resistance, where only certain subsets of bacterial cells express the resistant phenotype, and generate false negatives (PENN et al., 2013). Further, regulatory systems such as mecI-mecR1 and bla, present in some strains carrying the mecA gene, may control the oxacillin resistance phenotype (MCKINNEY et al., 2001). According to LIU et al. (2016), higher the expression of bla gene regulators, the lower is the expression of mecA gene, and consequently, the isolates have phenotypic sensitivity to oxacillin. OLIVEIRA & DE LENCASTRE (2011) suggested that other unidentified determinants are involved in the transcriptional control of mecA and that elucidating the nature of these determinants is relevant for a complete understanding of the molecular mechanisms controlling the phenotypic expression of resistance, and that this may contribute to the development of new therapeutic strategies.

Our results suggested the existence of different sources of contamination in the studied farms, since different MRSA subtypes were identified by PFGE in animals, environment and humans. However, the identification of isolates with similar genetic profiles in samples of mastitis cow milk from different dairy farms indicates that some strains are disseminated in this region, and may be endemic MRSA clonal profiles (SANTOS et al., 2016). According to our results, genetic related strains adapted to colonize the mammary glands of animals may be disseminated in the state of Pernambuco, Brazil. In addition, at least one MRSA isolate was identified in each on farm included in the study.

CONCLUSION:

The present study described the existence of MRS in samples of mastitis cow milk, milkers, and milking utensils and the presence of distinct clonal complex MRSA in dairy cow farms in the Northeast region of Brazil. It also serves as a reference for conducting other studies related to the epidemiology of multiresistant bacteria in the country and implementing control programs and taking measures to improve biosecurity in the dairy farms to avoid the spread of MRS strains.

ACKNOWLEDGEMENTS

To the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES, financing code 001) for granting research grants to the first author and to Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) for the financial support (Process number 409107/2018-2).

REFERENCES

• ANDRÉ, M. C. D. P. B. et al. Comparison of Staphylococcus aureus isolates from food handlers, raw bovine milk and Minas Frescal cheese by antibiogram and pulsed-field gel electrophoresis following SmaI digestion. Food Control, v.19, n.2, p.200-207, 2008. Available from: <Available from: https://linkinghub.elsevier.com/retrieve/pii/S0956713507000679 >. Accessed: Dec. 10, 2020. doi: 10.1016/j.foodcont.2007.03.010.
  » https://doi.org/10.1016/j.foodcont.2007.03.010.» https://linkinghub.elsevier.com/retrieve/pii/S0956713507000679
• BAIG, S. et al. Novel SCC mec type XIII (9A) identified in an ST152 methicillin-resistant Staphylococcus aureus Infection, Genetics and Evolution, v.61, p.74-76, jul. 2018. Available from: <Available from: https://linkinghub.elsevier.com/retrieve/pii/S1567134818301126 >. Accessed: Dec. 05, 2020. doi: 10.1016/j.foodcont.2007.03.010.
  » https://doi.org/10.1016/j.foodcont.2007.03.010.» https://linkinghub.elsevier.com/retrieve/pii/S1567134818301126
• BRAKSTAD, O. G. et al. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. Journal of clinical microbiology, v.30, n.7, p.1654-60, jul. 1992. Available from: <Available from: https://jcm.asm.org/content/jcm/30/7/1654.full.pdf Accessed: Dec. 06, 2020. doi: 10.1128/jcm.30.7.1654-1660.1992.
  » https://doi.org/10.1128/jcm.30.7.1654-1660.1992.» https://jcm.asm.org/content/jcm/30/7/1654.full.pdf
• CARTER, G. R. Fundamentos de bacteriologia e micologia veterinária. Editora Roca, 1988, 197-198 p. 1998.
• CHANDRASEKARAN, D. et al. Pattern of antibiotic resistant mastitis in dairy cows. Veterinary World, v.7, n.6, p.389-394, 2014a. Available from: Available from: http://www.veterinaryworld.org/Vol.7/June-2014/5.pdf Accessed: Dec. 10, 2020. doi: 10.14202/vetworld.2014.389-394.
  » https://doi.org/10.14202/vetworld.2014.389-394.» http://www.veterinaryworld.org/Vol.7/June-2014/5.pdf
• CHANDRASEKARAN, D. et al. A study on methicillin resistant Staphylococcus aureus mastitis in dairy cows. Journal of Applied and Natural Science, v.6, n.2, p.356-361, 2014b. Available from: Available from: https://doi.org/10.31018/jans.v6i2.427 Accessed: Dec. 7, 2020. doi: 10.31018/jans.v6i2.427.
  » https://doi.org/10.31018/jans.v6i2.427.» https://doi.org/10.31018/jans.v6i2.427
• Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing, Twenty- Eigth Informational Supplement, M100-S28. Pennsylvania,USA: CLSI, 2018. Available from: <Available from: https://www.facm.ucl.ac.be/intranet/CLSI/CLSI-2018-M100-S28.unlocked.pdf >. Accessed: Dec. 09, 2020.
  » https://www.facm.ucl.ac.be/intranet/CLSI/CLSI-2018-M100-S28.unlocked.pdf
• CRISOSTOMO, M. I. et al. The evolution of methicillin resistance in Staphylococcus aureus: Similarity of genetic backgrounds in historically early methicillin-susceptible and -resistant isolates and contemporary epidemic clones. Proceedings of the National Academy of Sciences, v.98, n.17, p.9865-9870, 14 ago. 2001. Available from: <Available from: http://www.pnas.org/cgi/doi/10.1073/pnas.161272898 >. Accessed: Dec. 8, 2020. doi: 10.1073/pnas.161272898.
  » https://doi.org/10.1073/pnas.161272898.» http://www.pnas.org/cgi/doi/10.1073/pnas.161272898
• FAN, H. H. et al. Application of polymerase chain Reaction with Arbitrary Primers to Strain Identification of Mycoplasma gallisepticum Avian Diseases, v.39, n.4, p.729-735, 1995. Available from: <Available from: https://doi.org/10.2307/1592409 >. Accessed: Dec. 8, 2020. doi: 10.2307/1592409.
  » https://doi.org/10.2307/1592409.» https://doi.org/10.2307/1592409
• FEßLER, A. et al. Characterization of methicillin-resistant Staphylococcus aureus ST398 from cases of bovine mastitis. Journal of Antimicrobial Chemotherapy, v.65, n.4, p.619-625, 1 abr. 2010. Available from: <Available from: http://dx.doi.org/10.1093/jac/dkq021 >. Accessed: Dec. 09, 2020. doi: 10.1093/jac/dkq021.
  » https://doi.org/10.1093/jac/dkq021.» http://dx.doi.org/10.1093/jac/dkq021
• FEßLER, A. T. et al. Characterization of methicillin-resistant Staphylococcus aureus CC398 obtained from humans and animals on dairy farms. Veterinary Microbiology, v.160, n.1-2, p.77-84, nov. 2012. Available from: <Available from: http://dx.doi.org/10.1016/j.vetmic.2012.05.005 >. Accessed: Dec. 09, 2020. doi: 10.1016/j.vetmic.2012.05.005.
  » https://doi.org/10.1016/j.vetmic.2012.05.005.» http://dx.doi.org/10.1016/j.vetmic.2012.05.005
• JAMROZY, D. M. et al. Comparative genotypic and phenotypic characterisation of Methicillin-Resistant Staphylococcus aureus ST398 Isolated from Animals and Humans. PLoS ONE, v.7, n.7, p.e40458, 2012. Available from: <Available from: https://dx.plos.org/10.1371/journal.pone.0040458 >. Acessed: Dec. 11, 2020. doi: 10.1371/journal.pone.0040458.
  » https://doi.org/10.1371/journal.pone.0040458.» https://dx.plos.org/10.1371/journal.pone.0040458
• JUHÁSZ-KASZANYITZKY, É. et al. MRSA transmission between cows and Humans. Emerging Infectious Diseases, v.13, n.4, p.630-632, 2007. Available from: <Available from: http://dx.doi.org/10.3201/eid1304.060833 >. Accessed: Dec. 11, 2020. doi: 10.3201/eid1304.060833.
  » https://doi.org/10.3201/eid1304.060833.» http://dx.doi.org/10.3201/eid1304.060833
• KAMAL, R. M. et al. MRSA detection in raw milk, some dairy products and hands of dairy workers in Egypt, a mini-survey. Food Control, v.33, n.1, p.49-53, set. 2013. Available from: <Available from: http://dx.doi.org/10.1016/j.foodcont.2013.02.017 >. Accessed: Dec. 11, 2020. doi: 10.1016/j.foodcont.2013.02.017.
  » https://doi.org/10.1016/j.foodcont.2013.02.017.» http://dx.doi.org/10.1016/j.foodcont.2013.02.017
• KIM, C. et al. Properties of a novel PBP2A protein Homolog from Staphylococcus aureus Strain LGA251 and Its Contribution to the β-Lactam-resistant Phenotype. Journal of Biological Chemistry, v.287, n.44, p.36854-36863, 2012. Available from: <Available from: http://dx.doi.org/10.1074/jbc.M112.395962 >. Accessed: Dec. 11, 2020. doi: 10.1074/jbc.M112.395962.
  » https://doi.org/10.1074/jbc.M112.395962.» http://dx.doi.org/10.1074/jbc.M112.395962
• KREWER, C. C. et al. Resistance to antimicrobials and biofilm formation in Staphylococcus spp. isolated from bovine mastitis in the Northeast of Brazil. Tropical Animal Health and Production, v.47, n.3, p.511-518, 30 mar. 2015. Available from: https://doi.org/10.1007/s11250-014-0752-9. Accessed: Dec. 05, 2020. doi: 10.1007/s11250-014-0752-9.
  » https://doi.org/https://doi.org/10.1007/s11250-014-0752-9» https://doi.org/10.1007/s11250-014-0752-9.
• LEE, A. S. et al. Methicillin-resistant Staphylococcus aureus Nature Reviews Disease Primers, v.4, n.1, p.1-23, 2018. Available from: <Available from: http://dx.doi.org/10.1038/nrdp.2018.33 Accessed: Dec. 5, 2020. doi: 10.1038/nrdp.2018.33.
  » https://doi.org/10.1038/nrdp.2018.33.» http://dx.doi.org/10.1038/nrdp.2018.33
• LEE, J. Occurrence of methicillin-resistant Staphylococcus aureus strains from cattle and chicken, and analyses of their mecA, mecR1 and mecI genes. Veterinary Microbiology, v.114, n.1-2, p.155-159, 2006. Available from: <Available from: http://dx.doi.org/10.1016/j.vetmic.2005.10.024 >. Accessed: Dec. 05, 2020. doi: 10.1016/j.vetmic.2005.10.024.
  » https://doi.org/10.1016/j.vetmic.2005.10.024.» http://dx.doi.org/10.1016/j.vetmic.2005.10.024
• LIM, S. et al. Transmission and persistence of methicillin-Resistant Staphylococcus aureus in Milk, Environment, and Workers in Dairy Cattle Farms. Foodborne Pathogens and Disease, v.10, n.8, p.731-736, 2013. Available from: <Available from: http://dx.doi.org/10.1089/fpd.2012.1436 Accessed: Dec. 06, 2020. doi: 10.1089/fpd.2012.1436.
  » https://doi.org/10.1089/fpd.2012.1436.» http://dx.doi.org/10.1089/fpd.2012.1436
• LIU, P. et al. Effect of bla regulators on the susceptible phenotype and phenotypic conversion for oxacillin-susceptible mecA -positive staphylococcal isolates. Journal of Antimicrobial Chemotherapy, v.71, n.8, p.2105-2112, 2016. Available from: <Available from: http://dx.doi.org/10.1093/jac/dkw123 >. Accessed: Dec. 06, 2020. doi: 10.1093/jac/dkw123.
  » https://doi.org/10.1093/jac/dkw123.» http://dx.doi.org/10.1093/jac/dkw123
• MCKINNEY, T. K. et al. Transcription of the gene mediating methicillin resistance in Staphylococcus aureus (mecA) is corepressed but not coinduced by cognate mecA and beta -lactamase regulators. Journal of Bacteriology, v.183, n.23, p.6862-6868, 2001. Available from: <Available from: http://jb.asm.org/cgi/doi/10.1128/JB.183.23.6862-6868.2001 >. Accessed: Dec. 06, 2020. doi: 10.1128/JB.183.23.6862-6868.2001.
  » https://doi.org/10.1128/JB.183.23.6862-6868.2001.» http://jb.asm.org/cgi/doi/10.1128/JB.183.23.6862-6868.2001
• MELO, D. A. et al. Characterization of coagulase-negative staphylococci and pheno-genotypic beta lactam resistance evaluation in samples from bovine Intramammary infection. Arquivo Brasileiro de Medicina Veterinária e Zootecnia, v.70, n.2, p.368-374, 2018. Available from: <Available from: http://dx.doi.org/10.1590/1678-4162-9209 >. Accessed: Dec. 06, 2020. doi: 10.1590/1678-4162-9209.
  » https://doi.org/10.1590/1678-4162-9209.» http://dx.doi.org/10.1590/1678-4162-9209
• NAKAGAWA, S. et al. Gene sequences and specific detection for Panton-Valentine leukocidin. Biochemical and Biophysical Research Communications, v.328, n.4, p.995-1002, 2005. Available from: <Available from: https://linkinghub.elsevier.com/retrieve/pii/S0006291X05000586 >. Accessed: Dec. 07, 2020. doi: 10.1016/j.bbrc.2005.01.054.
  » https://doi.org/10.1016/j.bbrc.2005.01.054.» https://linkinghub.elsevier.com/retrieve/pii/S0006291X05000586
• OLIVEIRA, D. C. et al. Methicillin-resistance in Staphylococcus aureus is Not Affected by the Overexpression in Trans of the mecA Gene Repressor: A Surprising Observation. PLoS ONE, v.6, n.8, p.e23287, 2011. Available from: <Available from: http://dx.plos.org/10.1371/journal.pone.0023287 >. Accessed: Dec. 07, 2020. doi: 10.1371/journal.pone.0023287.
  » https://doi.org/10.1371/journal.pone.0023287.» http://dx.plos.org/10.1371/journal.pone.0023287
• PATERSON, G. K. et al. Prevalence and properties of mecC methicillin-resistant Staphylococcus aureus (MRSA) in bovine bulk tank milk in Great Britain. Journal of Antimicrobial Chemotherapy, v.69, n.3, p.598-602, 2014. Available from: <Available from: http://dx.doi.org/10.1093/jac/dkt417 Accessed: Dec. 15, 2020. doi: 10.1093/jac/dkt417.
  » https://doi.org/10.1093/jac/dkt417.» http://dx.doi.org/10.1093/jac/dkt417
• PEACOCK, S. J. et al. Mechanisms of methicillin resistance in Staphylococcus aureus Annual Review of Biochemistry, v.84, n.1, p.577-601, 2015. Available from: <Available from: https://www.annualreviews.org/doi/10.1146/annurev-biochem-060614-034516 >. Accessed: Dec. 15, 2020. doi: 10.1146/annurev-biochem-060614-034516.
  » https://doi.org/10.1146/annurev-biochem-060614-034516.» https://www.annualreviews.org/doi/10.1146/annurev-biochem-060614-034516
• PENN, C. et al. Wound infections caused by inducible meticillin-resistant Staphylococcus aureus strains. Journal of Global Antimicrobial Resistance, v.1, n.2, p.79-83, jun. 2013. Available from: <Available from: http://dx.doi.org/10.1016/j.jgar.2013.03.009 >. Accessed: Dec. 12, 2020. doi: 10.1016/j.jgar.2013.03.009.
  » https://doi.org/10.1016/j.jgar.2013.03.009.» http://dx.doi.org/10.1016/j.jgar.2013.03.009
• PLETINCKX, L. J. et al. Evidence of possible methicillin-resistant Staphylococcus aureus ST398 spread between pigs and other animals and people residing on the same farm. Preventive Veterinary Medicine, v.109, n. 3-4, p. 293-303, maio 2013. Available from: <Available from: http://dx.doi.org/10.1016/j.prevetmed.2012.10.019 >. Accessed: Dec. 11, 2020. doi: 10.1016/j.prevetmed.2012.10.019.
  » https://doi.org/10.1016/j.prevetmed.2012.10.019.» http://dx.doi.org/10.1016/j.prevetmed.2012.10.019
• PRIBUL, B. R. et al. Bacterial resistance and bacteriocins action in Staphylococcus aureus isolated from bovine mastitis. Arquivo Brasileiro de Medicina Veterinaria e Zootecnia, v.63, n.3, p.744-748, 2011. Available from: <Available from: https://www.scielo.br/pdf/abmvz/v63n3/v63n3a29.pdf >. Accessed: Dec. 13, 2020. doi: 10.1590/S0102-09352011000300029.
  » https://doi.org/10.1590/S0102-09352011000300029.» https://www.scielo.br/pdf/abmvz/v63n3/v63n3a29.pdf
• PU, W. et al. High incidence of oxacillin-susceptible mecA-Positive Staphylococcus aureus (OS-MRSA) associated with bovine mastitis in China. PLoS ONE, v.9, n.2, p.e88134, 2014. Available from: <Available from: https://doi.org/10.1371/journal.pone.0088134 >. Accessed: Dec. 13, 2020. doi: 10.1371/journal.pone.0088134.
  » https://doi.org/10.1371/journal.pone.0088134.» https://doi.org/10.1371/journal.pone.0088134
• RABELO, M. A. et al. The occurrence and dissemination of methicillin and vancomycin-resistant Staphylococcus in samples from patients and health professionals of a university hospital in Recife, State of Pernambuco, Brazil. Revista da Sociedade Brasileira de Medicina Tropical, v.47, n.4, p. 437-446, 2014. Available from: http://dx.doi.org/10.1590/0037-8682-0071-2014. Accessed: Dec. 04, 2020. doi: 10.1590/0037-8682-0071-2014
  » https://doi.org/http://dx.doi.org/10.1590/0037-8682-0071-2014» https://doi.org/10.1590/0037-8682-0071-2014
• RAYMUNDO, N. K. L. et al. Consumer profile and problems associated with uninspected raw milk consumption in western Paraná. Arquivos do Instituto Biológico, v.84, n.0, p.1-8, 2018. Available from: http://dx.doi.org/10.1590/1808-1657000872016. Acessed: Dec 04, 2020. doi: 10.1590/1808-1657000872016.
  » https://doi.org/http://dx.doi.org/10.1590/1808-1657000872016» https://doi.org/10.1590/1808-1657000872016.
• RIBOT, E. M. et al. Standardization of Pulsed-Field Gel Electrophoresis Protocols for the Subtyping of Escherichia coli O157:H7, Salmonella, and Shigella for PulseNet. Foodborne Pathogens and Disease, v.3, n.1, p.59-67, 2006. Available from: <Available from: https://doi.org/10.1089/fpd.2006.3.59 >. Accessed: Dec. 08, 2020. doi: 10.1089/fpd.2006.3.59.
  » https://doi.org/10.1089/fpd.2006.3.59.» https://doi.org/10.1089/fpd.2006.3.59
• ROLLIN, B. Ethics, science, and antimicrobial resistance. Journal of Agricultural and Environmental Ethics, v.14, p.29-37, 2001. Available from: <Available from: https://doi.org/10.1023/A:1011315022587 >. Accessed: Dec. 09, 2020. doi: 10.1023/A:1011315022587.
  » https://doi.org/10.1023/A:1011315022587.» https://doi.org/10.1023/A:1011315022587
• SAINI, V. et al. Antimicrobial resistance profiles of common mastitis pathogens on Canadian dairy farms. Journal of Dairy Science, v.95, n.8, p.4319-4332, 2012. Available from: <Available from: https://doi.org/10.3168/jds.2012-5373 >. Accessed: Dec. 10, 2020. doi: 10.3168/jds.2012-5373.
  » https://doi.org/10.3168/jds.2012-5373.» https://doi.org/10.3168/jds.2012-5373
• SANTOS, F. F. et al. Presence of mecA-positive multidrug-resistant Staphylococcus epidermidis in bovine milk samples in Brazil. Journal of Dairy Science, v.99, n.2, p.1374-1382, 2016. Available from: <Available from: http://dx.doi.org/10.3168/jds.2015-9931 >. Accessed: Dec. 10, 2020. doi: 10.3168/jds.2015-9931.
  » https://doi.org/10.3168/jds.2015-9931.» http://dx.doi.org/10.3168/jds.2015-9931
• SCHMIDT, T. et al. Molecular characterization of Staphylococcus aureus isolated from bovine mastitis and close human contacts in South African dairy herds: genetic diversity and inter-species host transmission. Frontiers in Microbiology, v.8, p.511, 2017. Available from: <Available from: https://doi.org/10.3389/fmicb.2017.00511 >. Accessed: Dec. 04, 2020. doi: 10.3389/fmicb.2017.00511.
  » https://doi.org/10.3389/fmicb.2017.00511.» https://doi.org/10.3389/fmicb.2017.00511
• SILVA, N. C. C. et al. Methicillin-resistant Staphylococcus aureus of lineage ST398 as cause of mastitis in cows. Letters in Applied Microbiology, v.59, n.6, p.665-669, 2014a. Available from: <Available from: http://doi.wiley.com/10.1111/lam.12329 >. Accessed: Dec. 04, 2020. doi: 10.1111/lam.12329.
  » https://doi.org/10.1111/lam.12329.» http://doi.wiley.com/10.1111/lam.12329
• SILVA, N. C. C. et al. Characterization of methicillin-resistant coagulase-negative staphylococci in milk from cows with mastitis in Brazil. Antonie van Leeuwenhoek, v.106, n.2, p.227-233, 2014b. Available from: <Available from: https://doi.org/10.1007/s10482-014-0185-5 >. Accessed: Dec. 04, 2020. doi: 10.1007/s10482-014-0185-5.
  » https://doi.org/10.1007/s10482-014-0185-5.» https://doi.org/10.1007/s10482-014-0185-5
• SILVA, J. G. et al. First report of a livestock-associated methicillin-resistant Staphylococcus aureus ST126 harbouring the mecC variant in Brazil. Transbound and Emergence Disease, v.67, n.5, 2020. Available from: <Available from: https://doi.org/10.1111/tbed.13771 >. Accessed: Dec. 15, 2020. doi: 10.1111/tbed.13771.
  » https://doi.org/10.1111/tbed.13771.» https://doi.org/10.1111/tbed.13771
• SOARES, L. C. et al. Antimicrobial resistance and detection of mecA and blaZ genes in coagulase-negative Staphylococcus isolated from bovine mastitis. Pesquisa Veterinaria Brasileira, v.32, n.8, p.692-696, 2012. Available from: <Available from: http://dx.doi.org/10.1590/S0100-736X2012000800002 >. Accessed: Dec. 16, 2020. doi: 10.1590/S0100-736X2012000800002.
  » https://doi.org/10.1590/S0100-736X2012000800002.» http://dx.doi.org/10.1590/S0100-736X2012000800002
• TENOVER, F. C. et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. Journal of clinical microbiology, v.33, n.9, p. 2233-9, 1995. Available from: <Available from: https://jcm.asm.org/content/33/9/2233 >. Accessed: Dec. 10, 2020. doi: 10.1128/jcm.33.9.2233-2239.1995.
  » https://doi.org/10.1128/jcm.33.9.2233-2239.1995.» https://jcm.asm.org/content/33/9/2233
• VAN LOO, I. et al. Emergence of methicillin-resistant Staphylococcus aureus of animal origin in humans. Emerging Infectious Diseases, v.13, n.12, p.1834-1839, 2007. Available from: <Available from: http://dx.doi.org/10.3201/eid1312.070384 >. Accessed: Dec. 10, 2020. doi: 10.3201/eid1312.070384.
  » https://doi.org/10.3201/eid1312.070384.» http://dx.doi.org/10.3201/eid1312.070384
• WILLE, H et al. Communications orales libres COL 08-Infections ostéo-articulaires Infection post-arthrodèse rachidienne: étude descriptive d’une cohorte de 129 patients. Médecine et maladies infectieuses, v.44, p.15-16, 2014. Available from: <Available from: https://www.em-consulte.com/revue/MEDMAL/44/6S/table-des-matieres/ >. Accessed: Dec. 16, 2020.
  » https://www.em-consulte.com/revue/MEDMAL/44/6S/table-des-matieres/
• WONG, K S. Clinical and radiographic spectrum of septic pulmonary embolism. Archives of Disease in Childhood, v.87, n.4, p.312-315, 1 out. 2002. Available from: <Available from: http://dx.doi.org/10.1136/adc.87.4.312 >. Accessed: Dec. 10, 2020. doi: 10.1136/adc.87.4.312.
  » https://doi.org/10.1136/adc.87.4.312.» http://dx.doi.org/10.1136/adc.87.4.312

• CR-2021-0008.R2

BIOETHICS AND BIOSSECURITY COMMITTEE APPROVAL

• The entire experimental procedure is in accordance with the ethical principles adopted by the Ethics Committee for the Use of Animals from Universidade Federal Rural de Pernambuco (UFRPE), Recife, Brazil (license number 106/2017) and the Research Ethics Committee of the Universidade de Pernambuco (UPE), Recife, Brazil (CAAE number: 28833619.7.0000.5207). All persons gave their informed consent prior to their inclusion in the study.

Edited by

Editors:

Rudi Weiblen

Juliana Cargnelutti

Publication Dates

• Publication in this collection
  06 Sept 2021
• Date of issue
  2022

History

• Received
  06 Jan 2021
• Accepted
  28 May 2021
• Reviewed
  30 June 2021