Aeromonas from farmed tambaqui from North Brazil: molecular identification and pathogenic potential

Aeromonas de tambaqui de cultivo do norte do Brasil: identificação molecular e potencial patogênico

ABSTRACT:

The aim of this study was to molecularly identify different species of Aeromonas isolated from farmed tambaqui (Colossoma macropomum) from North Brazil, and evaluate their pathogenic potential by the presence of virulence genes. From the extraction of bacterial DNA, PCR (polymerase chain reaction) of the primers 16S rDNA, aerA (cytolytic enterotoxin), ast (cytotoxic enterotoxin) and act (cytotoxic enterotoxin) were performed. Of 24 isolates evaluated, eight amplified the ast gene, one amplified the act gene, but the areA gene was not amplified in any isolate. Sequencing of the 16S rRNA primer revealed a predominance of Aeromonas jandaei specie (92%). Aeromonas taiwanensis (4%), for the first time isolated from fish in Brazil, and Aeromonas hydrophila (4%) each appeared as just one isolate. Results showed that 32% of Aeromonas isolated from farmed tambaqui have considerable pathogenic potential for systemic damage, since the selected PCR primers are encoding the most common virulence genes in Aeromonas with high pathogenic intensity.

Key words:
Colossoma macropomum; polymerase chain reaction; virulence genes; Aeromonas taiwanensis

RESUMO:

O objetivo deste estudo foi identificar molecularmente diferentes espécies de Aeromonas isoladas de tambaqui (Colossoma macropomum) de cultivo do norte do Brasil e avaliar seu potencial patogênico pela presença de genes de virulência. A partir da extração do DNA bacteriano, foi realizada a PCR (reação em cadeia da polimerase) dos primers 16S rDNA, aerA (enterotoxina citolítica), ast (enterotoxina citotóxica) e act (enterotoxina citotóxica). Dos 24 isolados avaliados, oito amplificaram o gene ast, um amplificou o gene act, mas o gene areA não foi amplificado em nenhum isolado. O sequenciamento do primer 16S rRNA revelou uma predominância da espécie Aeromonas jandaei (92%). Aeromonas taiwanensis (4%), pela primeira vez isolada em peixes no Brasil, e Aeromonas hydrophila (4%) apareceram cada uma como apenas um isolado. Os resultados mostram que 32% das Aeromonas isoladas de tambaqui de cultivo apresentam considerável potencial patogênico para danos sistêmicos, uma vez que os primers de PCR selecionados estão codificando os genes de virulência mais comuns em Aeromonas com alta intensidade patogênica.

Palavras-chave:>
Colossoma macropomum; reação da polimerase em cadeia; genes de virulência; Aeromonas taiwanensis

INTRODUCTION:

Tambaqui (Colossoma macropomum) is the most native farmed fish in Brazil, with a production of 101,079 tons in 2019. From this, 73,181 tons came from the north of the country (IBGE, 2021). On the other hand, with this intensification in tambaqui production, important bacterial pathogens have been identified in these fish, with potential to cause significant economic losses in production, especially due to disease outbreaks caused by Aeromonas (VALLADÃO et al., 2018; HILSDORF et al., 2022).

Aeromonas bacteria can cause an infection characterized by septicemia and is one of the most common pathogens in tropical fish. This disease is responsible for high morbidity and mortality rates, causing considerable losses in aquaculture (MARINHO-NETO et al, 2019; AZZAM-SAYUTI et al., 2021), thus, the understanding of its pathophysiology is crucial to develop control strategies of this bacterial infection in farmed fish (MARINHO-NETO et al, 2019)

Aeromonas species are ubiquitous in diverse aquatic habitats. High stocking density and improper farm practices can increase the susceptibility of fishes to motile Aeromonas septicemia (MAS) outbreak. However, polymorphic phenotypes and genotypes can lead to misidentification of Aeromonas isolates from diseased fish (AZZAM-SAYUTI et al., 2021). So, to achieve appropriate treatment for bacterial diseases, we should first accurately identify the bacterial species, for this, conventional microbiological methods used for the identification of pathogenic bacteria are very laborious and time-consuming. Molecular methods such as polymerase chain reaction (PCR) have overcome these problems, enabling rapid and accurate identification of bacteria together with the detection of virulence genes that contribute to bacterial pathogenicity, which cannot be achieved by any other conventional microbiological method (ABOYADAK et al., 2015; KINGOMBE et al., 2010).

Molecular techniques such as polymerase chain reaction (PCR) have advantages over conventional microbiological identification methods, such as rapid diagnosis and specificity for the investigated agent (ABU‐ELALA et al., 2015), as well as the use of this technique allows the study of virulence factors of the strains, allowing to determine the potential degree of pathogenicity of a strain of interest (KIM et al., 2018). Several virulence factors have been described as important in the pathogenesis of infections caused by Aeromonas spp., among the most studied are aerolysin (AerA), cytotoxic enterotoxin (Act), and cytotonic enterotoxin (Ast). Studies that evaluated the presence of genes encoding these virulence factors observed that positive genotypes were more frequent in isolates obtained from diseased fish than from healthy fish or from environmental samples (LI et al., 2011; HU et al., 2012). Therefore, the detection of genes responsible for Aeromonas virulence is a vital tool in establishing the potential pathogenicity of the bacteria, as these virulence genes may act alone or in synergy in the establishment of infections (IGBINOSA & OKOH, 2013).

Given the above, the present study aimed to amplify the 16S rDNA gene in order to identify, at species level, strains of the genus Aeromonas isolated from farmed tambaqui from the Amazon State, North Brazil, and relate to this identification, the occurrence of different virulence genes aerolysin (aeraA) cytotoxic enterotoxin (act) and cytolytic enterotoxin (ast); and consequently, its pathogenic potential.

MATERIALS AND METHODS:

Aeromonas spp. (24 samples), were isolated from 153 juvenile tambaquis collected from 10 farms of the municipalities of Iranduba and Manacapuru, important producing municipalities in Amazonas State, Brazil. The isolation was carried out at the Embrapa Western Amazon Pisciculture Laboratory from the cranial kidney or from external lesions of the animals, as described by LEÃO et al. (2020). Animals collected for isolation were not sampled at the time of a disease outbreak.

For DNA extraction, fresh colonies were inoculated into BHI (Brain Hearth Infusion) broth for propagation. The bacteria pellets harvested were subject to genomic DNA extraction following the procedures provided by the Genomic DNA Purification Kit (Thermo Fisher Scientific) having as final product 100 µl of genomic DNA, which was stored at -20 °C. Quantification of extracted DNA was performed via Nanodrop and DNA integrity was visualized on a 0.8 % agarose gel with 1kb DNA molecular marker.

From the extracted genomic DNA, the following primers were prepared for PCR (Table 1).When performing the PCR of 16S rDNA for better results from the amplicons, the annealing temperature was changed to 59 °C, which resulted in amplification with molecular weights compatible with those expected, at approximately 800 bp. The PCR preparation, with a final volume of 25 µl, consisted of ultrapure water (16.3 µl), enzyme buffer (2.5 µl), dNTPS (1.0 µl), Taq DNA Polymerase (0.2 µl), template DNA (3.0 µl), Primer Forward (1.0 µl) and Primer Reverse (1.0 µl). The polymerase chain reaction was carried out in a Thermocycler (Applied Bioystems), in 35 cycles, with changes in the annealing temperature as indicated for each primer. After the period in the thermocycler, the PCR product was electrophoresed on a 1.5% agarose gel, and the amplicons were visualized in a transilluminator and photodocumented under UV light. At the end of the PCR of the 16s rDNA gene, the purification of this product was continued with the addition of Exo-Sap (0.3 µl) and ultrapure water (1.7 µl), with subsequent incubation in a Thermocycler (Applied Bioystems) at 37 °C for 15 min for the enzyme activation process, followed by heating at 80 °C for 15 min for the enzyme deactivation. Next, for the sequencing reaction, with a final volume of 10 µl, Big Dye buffer (1.5 µl), ultrapure water (0.3 µl), Big Dye Terminator (0.5 µl), primer F and R (0.7 µl) and the PCR product of the 16S gene (7.0 µl).

Table 1
Primers used for identification and detection of virulence genes.

Gene	Primer sequence (5’- 3’)	AT (C°)	Product size (bp)	Reference
16S rDNA	F: AGAGTTTGATYMTGGCTCAG R: CCGTCAATTCMTTTRAGTTT	59°	900	SEBASTIÃO, et al. (2015)
aerA	F: AACCGAACTCTCCAT R: CGCCTTGTCCTTGTA	55°	301	EL-GOHARY, et al. (2020)
act	F: GAGAAGGTGACCACCAAGAACA R: AACTGACATCGGCCTTGAACTC	55°	232	SAMAYANPAULRAJ, et al. (2020)
ast	F: TCTCCATGCTTCCCTTCCACT R: GTGTAGGGATTGAAGAAGCCG	55°	331	SAMAYANPAULRAJ, et al. (2020)

The PCR purification was carried out using exoSAP-IT (ThermoFisher; catalog number: 78200.200.UL), according to the manufacturer’s recommendations. The sequencing reactions were performed in a volume of 10 µL, containing 2 µL of ultrapure water, 1.5 µL of Big Dye buffer, 0.5 µL of BigDye terminator v3.1 (Thermo Fisher), 1 µL of each primer and 5 µL of the purified PCR products. The cycling conditions were 96 °C for 1 min., followed by 35 cycles at 96 °C for 15 sec., 50 °C for 15 sec., and 60 °C for 4 min. The sequencing was performed using a genetic analyzer (3,500, Thermo Fisher).

Consensus sequences was obtained manually based on the alignment of forward and reverse sequences with BLAST reference sequences as well as electropherogram analysis. Sequences obtained in this study were deposited in Genbank under accession numbers descripted in table 2. The dataset was constructed using 16S sequences of 24 isolates obtained in this study, one sequence of Aeromonas hydrophila ATCC 7966, 35 type species of Aeromonas, one sequence of Salmonella, two of Tolumonas and Pseudomonas aeruginosa were used as an outgroup. The sequences was aligned in the MAFFT online platform (https://mafft.cbrc.jp/alignment/software/) and submitted to maximum-likelihood (ML) analysis in IQ-TREE (TRIFINOPOULOS et al., 2016). The trees were visualized in the iTOL platform (https://itol.embl.de) and edited by CorelDraw 2020 software. The alignments result in 1,587 characters and the best-fit model selected by IQ-TREE was TIM+F+I+G4. The primers selected for detection of virulence genes were properly tested with annealing temperature at 55 °C.

Table 2
Identification of study strains and relationship between species and virulence genes.

Bp	Sample	GenBank accession number	Identification	Amplification of virulence genes
				AerA	Ast	Act
891	A3	OM802454	Aeromonas jandaei	-	-	+
898	A19	OM802455	Aeromonas jandaei	-	-	-
865	Px26	OM802456	Aeromonas jandaei	-	-	+
701	A38	OM802457	Aeromonas jandaei	-	-	-
738	F42	OM802458	Aeromonas jandaei	-	-	-
900	F50	OM802459	Aeromona jandaei	-	-	+
541	Px52	OM802460	Aeromonas jandaei	-	-	-
898	Px84	OM802461	Aeromonas jandaei	-	-	-
899	F84	OM802462	Aeromonas jandaei	-	-	-
897	St86	OM802463	Aeromonas jandaei	-	-	+
904	F93	OM802464	Aeromonas taiwanensis	-	-	-
867	A96	OM802465	Aeromonas jandaei	-	-	-
862	A97	OM802466	Aeromonas jandaei	-	-	-
899	A101	OM802467	Aeromonas hydrophila	-	+	+
899	F103	OM802468	Aeromonas jandaei	-	-	-
864	A120	OM802469	Aeromonas jandaei	-	-	-
898	A121	OM802470	Aeromonas jandaei	-	-	-
898	A128	OM802471	Aeromonas jandaei	-	-	-
898	A130	OM802472	Aeromonas jandaei	-	-	-
899	F131	OM802473	Aeromonas jandaei	-	-	+
901	A134	OM802474	Aeromonas jandaei	-	-	+
899	A146	OM802475	Aeromonas jandaei	-	-	-
898	A151	OM802476	Aeromonas jandaei	-	-	+
876	A153	OM802477	Aeromonas jandaei	-	-	-
899	A. hydrophila ATCC 7966	OM802478*	Aeromonas hydrophila	-	+	+

• *reference strain.

RESULTS AND DISCUSSION:

All isolates obtained in this study from Colossoma macropomum infections belong to the Aeromonas genus. The most isolates (22) grouped with the type species Aeromonas jandaei with high bootstrap support, the isolate A101 grouped with the type species A. hydrophila and the isolate F93 grouped with A. taiwanensis (Figure 1).

A. jandaei is an emerging fish pathogen associated with massive mortalities in cultured freshwater fish (ASSANE et al., 2021). In Brazil, it has already been reported Nile tilapia mass mortality caused by A. jandaei infection in farm by ASSANE et al. (2021) and in pirarucu (Arapaima gigas) by PROIETTI-JUNIOR et al. (2021). Our results also revealed that, among the strains studied in this research, A. jandaei was, in fact, the most prevalent (91,7%) (Table 2). This result contrasts with other studies already carried out with tambaqui, where most A. hydrophila isolates were predominant (PESSOA et al., 2020; VALLADÃO et al., 2018; SEBASTIÃO et al., 2015).

Figure 1
Phylogenetic tree of Aeromonas species based on Maximum Likelihood method for 16S rRNA nucleotide sequences. Numbers indicate the bootstrap values for 1000 replicates. Isolates sequenced in this study are marked in bold. Salmonella, Tolumonas and Pseudomonas were used as an outgroup.

In tambaquis under stress conditions, 34 strains were isolated recently, and were characterized as A. hydrophila (41.2%), A. dhakensis (20.6%), A. caviae (17.6%), A. veronii (11.8%) and A. jandaei (8.8%) (PESSOA et al., 2020), but a predominance of A. hydrophila is still noticed in this most recent study, despite the presence of the jandaei species, which is still little reported for tambaqui. In our study, only one isolate was from A. hydrophila, and another from A. taiwanensi, this last one as far as we know, not yet reported in isolations for fish in Brazil. Few studies report the isolation of A. taiwanensis, only, a recently reported strain of the genus was reported while studying the presence of infectious marine microbes in a lacustrine wetland in India, making this the first isolation report from the country (NANDA & SHARMA, 2020). Some A. taiwanensis isolate have already been described in hospitalized patients, feces and wastewater in Taiwan and Israel, described by BEAZ-HIDALGO et al. (2012), where they observed broad antibiotic resistance. Already for virulence genes, as in our study none of the strains were positive for the cytotoxic (act) and cytotonic enterotoxin genes (ast), but all A. taiwanensis strains carried the genes that encode aerolysin (aerA), in our study, the isolate of the specie did not amplify the gene aerA (Table 2).

Results obtained in the detection of virulence genes were significant, where eight (33.3%) isolates showed positive amplification for act (seven A. jandaei and one A. hydrophila) and one (4.1%) positive for ast (A. hydrophila). The aerA gene did not show amplification for any isolate (Table 2).

The presence of virulence factors in some strains identified in A. jandaei allows bacteria to invade, colonize and destroy cells, overcoming fish immune response mechanisms (ASSANE et al., 2021). According to KIM et al. (2019), act, the most frequently found gene, as well as aerA, is also a porin, and can cause degeneration of crypts and villi in the small intestine of fish, playing an important role in infections by Aeromonas by inducing the beginning of the signaling process of apoptosis in eukaryotic cells, that is, its presence in an isolate means a high pathogenic potential.

Comparatively, in a study by EL-BAHAR et al. (2019), A. hydrophila isolated from nile tilapia showed detection of the genes aerA and act, but the gene ast was absent. The present study, however, differs in two aspects: aerA was absent and ast presented amplification in the isolates identified as A. hydrophila. Thus, it is possible to observe that the expression of such genes in A. hydrophila can be triggered by some circumstance, above all, as discussed by KIM et al. (2019) indicated the pathogenicity of the genus as being complex and multifactorial, involving activities of different genes acting alone or in combination with others. That is, certain genes act as coadjuvants for other virulence factors in Aeromonas an indispensable virulence factor in the mechanism of infection, which explains this differentiation of low frequencies found in the present research. In Brazil, ASSANE et al. (2021) detected neither the act or ast gene in their A. jandaei isolates, but aerA was present in all of them, being isolated from tilapia, verifying this complexity and differences for the presence of virulence genes.

The research of MAZUMDER et al. (2021) confirmed the result of the present study of positive enterotoxin in A. hydrophila and A. jandei, they further stated that; although, the aerA gene is closely related to the hemolytic, cytotoxic and enterotoxic activities of the enterotoxin gene, as reported in most Aeromonas strains, the contradiction in results may be due to variations in the prevalence of aerA in relation to different geographic locations. In Brazil, A. hydrophila and A. jandaei isolated from pirarucu, aerA was present in all isolates, since the gene act was not detected in any of the strains isolated (PROIETTI-JUNIOR et al., 2021).

It can be seen; therefore, that there is a variation in relation to the fish species of the isolate, bacterial species within the genus associated with geolocation, and as the pathogenicity of Aeromonas strains can be directly associated with the virulence gene content, the results presented in our research revealed this potential, enabling the Aeromonas found as possible zoonotic agents for fish farms in the region.

CONCLUSION:

Observing the results, it is possible to infer that the bacteria identified as Aeromonas jandaei is the most prevalent in farmed tambaquis from North Brazil, and based on the amplification of the virulence genes investigated, present a lower degree of pathogenic potential in relation to Aeromonas hydrophila, despite having isolated only one sample, which showed amplification of the genes ast and act, encoding cytotonic and cytotoxic enterotoxins, respectively. Aeromonas taiwanensis, for the first time isolated from fish in Brazil, did not amplify any of the genes evaluated. Future research should involve in vivo challenges to confirm the greater pathogenicity of the isolates that presented the virulence genes, in addition to broader studies, involving more virulence genes.

ACKNOWLEDGEMENTS

The Fundação de Amparo à Pesquisa do Estado do Amazonas (FAPEAM) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) by fellowship, the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Brasil - Finance code 001 and Embrapa Amazônia Ocidental for infrastructure.

REFERENCES

• ABOYADAK, I. M., et al. Molecular detection of Aeromonas hydrophila as the main cause of outbreak in tilapia farms in Egypt. Journal of Aquaculture & Marine Biology, v.2, n.6, p.2-5, 2015. Available from: <Available from: http://doi.org/10.15406/jamb.2015.02.00045 > Accessed: Feb. 04, 2022.
  » http://doi.org/10.15406/jamb.2015.02.00045
• ABU‐ELALA, N., et al. Comparative analysis of virulence genes, antibiotic resistance and gyrB‐based phylogeny of motile Aeromonas species isolates from Nile tilapia and domestic fowl. Letters in applied microbiology, v.61, n.5, p.429-436, 2015. Available from: <Available from: https://doi.org/10.1111/lam.12484 >. Accessed: Feb. 07, 2022.
  » https://doi.org/10.1111/lam.12484
• ASSANE, I., et al. Phenotypic and genotypic characterization of Aeromonas jandaei involved in mass mortalities of cultured Nile tilapia, Oreochromis niloticus (L.) in Brazil. Aquaculture, v.541, p.736848, 2021. Available from: <Available from: https://doi.org/10.1016/j.aquaculture.2021.736848 >. Accessed: Jan. 07, 2022.
  » https://doi.org/10.1016/j.aquaculture.2021.736848
• AZZAM-SAYUTI, M., et al. Comparative Pathogenicity of Aeromonas spp. in cultured red hybrid tilapia (Oreochromis niloticus × O. mossambicus). Biology, v.10, n.11, p.1192, 2021. Available from: <Available from: https://doi.org/10.3390/biology10111192 >. Accessed: Jan. 07, 2022.
  » https://doi.org/10.3390/biology10111192
• BEAZ-HIDALGO, R. et al., Chironomid egg masses harbour the clinical species Aeromonas taiwanensis and Aeromonas sanarellii FEMS Microbiology Letters. v.337, n.1, p.48-54, 2012. Available from: <Available from: https://doi.org/10.1111/1574-6968.12003 >. Accessed: Apr. 26, 2022.
  » https://doi.org/10.1111/1574-6968.12003
• EL-BAHAR, H., et al. Virulence genes contributing to Aeromonas hydrophila pathogenicity in Oreochromis niloticus International Microbiology, v.22, n.4, p.479-490, 2019. Available from: <Available from: https://doi.org/10.1007/s10123-019-00075-3 >. Accessed: Jan. 10, 2022.
  » https://doi.org/10.1007/s10123-019-00075-3
• EL-GOHARY, F., et al. Investigation of the prevalence, virulence genes, and antibiogram of motile Aeromonas isolated from Nile tilapia fish farms in Egypt and assessment of their water quality. Animals, v.10, n.8, p.1432, 2020. Available from: <Available from: https://doi.org/10.3390/ani10081432 >. Accessed: Jan. 10, 2022.
  » https://doi.org/10.3390/ani10081432
• HILSDORF, A.W.S. et al. The farming and husbandry of Colossoma macropomum: From Amazonian waters to sustainable production. Reviews inAquaculture , v.14, n.2 p.993-1027, 2022. Available from: <https://doi.org/10.1111/raq.12638>. Accessed: Apr. 26, 2022.
• HU, M., et al. Identity and virulence properties of Aeromonas isolates from diseased fish, healthy controls and water environment in China. Letters in applied microbiology , v.55, p.224-233, 2012. Available from: <https://doi.org/10.1111/j.1472-765X.2012.03281.x>. Accessed: Jan. 11, 2022.
  » https://doi.org/10.1111/j.1472-765X.2012.03281.x
• IBGE, Instituto Brasileiro de Geografia e Estatística. Produção da Pecuária Municipal. 2020. Available from: <Available from: https://sidra.ibge.gov.br/Tabela/3940 >. Accessed: Dec. 21, 2021.
  » https://sidra.ibge.gov.br/Tabela/3940
• IGBINOSA, I. H.; OKOH, A. I. Detection and distribution of putative virulence associated genes in Aeromonas species from freshwater and wastewater treatment plant. Journal of Basic Microbiology, v.53, n.11, p.895-901, 2013. Available from: <Available from: https://doi.org/10.1002/jobm.201200351 >. Accessed: Jan. 18, 2022.
  » https://doi.org/10.1002/jobm.201200351
• KIM, F. P. J., et al. Detecção de Aeromonas spp. e do gene de virulência aerolisina em tilápias do Nilo (Oreochromis niloticus) com a técnica de mPCR. Pesquisa Veterinária Brasileira, v.38, p.1731-1735, 2018. Available from: <Available from: https://doi.org/10.1590/1678-5150-PVB-5609 >. Accessed: Jan. 19, 2022.
  » https://doi.org/10.1590/1678-5150-PVB-5609
• KIM, F. J. P., et al. Elevada frequência de Aeromonas spp. e genes de virulência em cultivos de tilápia-do-nilo (Oreochromis niloticus) em tanques-rede, na região semiárida de Pernambuco, Brasil. Arquivo Brasileiro de Medicina Veterinária e Zootecnia, v.71, n.5, p.1609-1615, 2019. Avaliable from: < Avaliable from: http://dx.doi.org/10.1590/1678-4162-10747 >. Accessed: Jun. 20, 2022.
  » http://dx.doi.org/10.1590/1678-4162-10747
• KINGOMBE, C. I. B., et al. Multiplex PCR method for detection of three Aeromonas enterotoxin genes. Applied and Environmental Microbiology, v.76, n.2, p.425-433, 2010. Available from: <Available from: https://doi.org/10.1128/AEM.01357-09 >. Accessed: Jan. 19, 2022.
  » https://doi.org/10.1128/AEM.01357-09
• LEÃO, S. O. A. et al. Ocorrência de Aeromonas multirresistentes em tambaquis cultivados em tanques escavados, Scientia Amazonia, v.2, n.4, CA17-CA24, 2020. Available from: <Available from: https://scientia-amazonia.org/wp-content/uploads/2020/11/v9-n4-CA17-CA24-2020.pdf >. Accessed: Jan. 19, 2022.
  » https://scientia-amazonia.org/wp-content/uploads/2020/11/v9-n4-CA17-CA24-2020.pdf
• LI, J., et al. Detection of three virulence genes alt, ahp and aerA in Aeromonas hydrophila and their relationship with actual virulence to zebrafish. Journal of Applied Microbiology. v.110, p.823-830, 2011. Available at <Available at https://doi.org/10.1111/j.1365-2672.2011.04944.x >. Accessed: Jan. 24, 2022.
  » https://doi.org/10.1111/j.1365-2672.2011.04944.x
• MARINHO-NETO, F. A., et al. Morphological, microbiological and ultrastructural aspects of sepsis by Aeromonas hydrophila in Piaractus mesopotamicus PLoS one, v.14, n.9, p.e0222626, 2019. Available at <Available at https://doi.org/10.1371/journal.pone.0222626 >. Accessed: Jan. 25, 2022.
  » https://doi.org/10.1371/journal.pone.0222626
• MAZUMDER, A., et al. Isolation and characterization of two virulent Aeromonads associated with haemorrhagic septicaemia and tail-rot disease in farmed climbing perch Anabas testudineus Scientific reports, v.11, n.1, p.1-10, 2021. Available from: <Available from: https://doi.org/10.1038/s41598-021-84997-x >. Accessed: Jan. 26, 2022.
  » https://doi.org/10.1038/s41598-021-84997-x
• NANDA, T.; SHARMA, D. First report of isolation of Aeromonas taiwanensis from India. New Microbes and New Infections, v.36, p.100721, 2020. Available from: <Available from: https://doi.org/10.1016/j.nmni.2020.100721 >. Accessed: Jan. 24, 2022.
  » https://doi.org/10.1016/j.nmni.2020.100721
• PESSOA, R. B. G., et al. Molecular characterization and evaluation of virulence traits of Aeromonas spp. isolated from the tambaqui fish (Colossoma macropomum), Microbial Pathogenesis, v.147, p.104273, 2020. Available from: <Available from: https://doi.org/10.1016/j.micpath.2020.104273 >. Accessed: Jan. 24, 2022.
  » https://doi.org/10.1016/j.micpath.2020.104273
• PROIETTI-JUNIOR, A. A., et al. Experimental co-infection by Aeromonas hydrophila and Aeromonas jandaei in pirarucu Arapaima gigas (Pisces: Arapaimidae. AquacultureResearch, v.52, n.4, p.1688-1696, 2021. Available from: <Available from: https://doi.org/10.1111/are.15021 >. Accessed: Feb. 01, 2022.
  » https://doi.org/10.1111/are.15021
• SAMAYANPAULRAJ, V., et al. Identification and characterization of virulent Aeromonas hydrophila Ah17 from infected Channa striata in river Cauvery and in vitro evaluation of shrimp chitosan. Food science & nutrition, v.8, n.2, p.1272-1283, 2020. Available fom: <Available fom: https://doi.org/10.1002/fsn3.1416 >. Accessed: Feb. 07, 2022.
  » https://doi.org/10.1002/fsn3.1416
• SEBASTIÃO, F., et al. Identification of bacterial fish pathogens in Brazil by direct colony PCR and 16S rRNA gene sequencing. Advances in Microbiology, v.5, n.06, p.409, 2015. Available from: <Available from: https://doi.org/10.4236/aim.2015.56042 >. Accessed: Jan. 03, 2022.
  » https://doi.org/10.4236/aim.2015.56042
• TRIFINOPOULOS, J., et al. W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis. Nucleic acids research, v.44, n.W1, p.W232-W235, 2016. Available from: <Available from: https://doi.org/10.1093/nar/gkw256 >. Accessed: Jan. 04, 2022.
  » https://doi.org/10.1093/nar/gkw256
• VALLADÃO, G. M. R., et al. South American fish for continental aquaculture. Reviews inAquaculture , v.10, n.2, p.351-369, 2018. Available from: <Available from: https://doi.org/10.1111/raq.12164 >. Accessed: Dec. 12, 2022.
  » https://doi.org/10.1111/raq.12164

• CR-2022-0151.R1

BIOETHICS AND BIOSSECURITY COMMITTEE APPROVAL

• BIOETHICS AND BIOSSECURITY COMMITTEE APPROVAL

  The Ethics Committee for the Use of Animals (CEUA) of Embrapa Western Amazon approved the activities relevant to this work under protocol No. 04/2018, issued on 10/1/2018. Access to the genetic heritage was authorized by the Genetic Heritage Management Council (CGen) with No. AF34DA8.

Edited by

Editors: Rudi Weiblen(0000-0002-1737-9817)

Juliana Felipetto Cargnelutti(0000-0002-3160-3643)

Publication Dates

• Publication in this collection
  25 July 2022
• Date of issue
  2023

History

• Received
  17 Mar 2022
• Accepted
  13 May 2022
• Reviewed
  24 June 2022