Severe enteritis in dogs associated with single and mixed infections

Enterites severas em cães associadas a infecções simples e mistas

ABSTRACT:

Infectious enteritis is highly prevalent among dogs worldwide and, in some cases, it can be fatal. This study describes the clinical and laboratorial findings of single and mixed infections associated with severe enteritis in 76 dogs from Southern Brazil. Intestinal segments and/or fecal samples were subjected to histopathology and molecular detection of DNA viruses, bacteria and protozoa. Severe intestinal lesions were observed in most cases. Single infections were detected in 52.6% of cases, double (36.8%) and triple (10.5%) infections were also identified. Carnivore protoparvovirus 2 (CPV-2) was the most frequent agent in single infections (36.8%). Coinfection by CPV-2 and Giardia spp. was the most common in dual infections (19.7%), followed by CPV-2 and Cryptosporidium spp. (10.5%). The most frequent triple infection was CPV-2, Giardia sp. and Cryptosporidium spp. (6.6%). Our results shown that single and mixed infections are associated with severe enteritis in dogs in southern Brazil, mainly involving CPV-2 and Giardia sp.

Key words:
gastroenteritis; dogs; bacteria; virus; protozoa; diagnosis.

RESUMO:

Enterites infecciosas são altamente prevalentes entre cães em todo o mundo e, em alguns casos, podem ser fatais. Este estudo descreve os achados clínicos e laboratoriais de infecções simples e mistas associadas a enterites graves em 76 cães do sul do Brasil. Segmentos intestinais e/ou fezes foram submetidos à análise patológica e detecção molecular de vírus de genoma DNA, bactérias e protozoários. Lesões intestinais severas foram observadas na maioria dos casos. Infecções únicas foram detectadas em 52,6% dos casos, e infecções duplas (36,8%) e triplas (10,5%) também foram identificadas. O Protoparvovírus carnívoro 2 (CPV-2) foi o agente mais frequente nas infecções simples (36,8% do total). Coinfecção por CPV-2 e Giardia sp. foi a mais comum em infecções duplas (19,7%), seguido por CPV-2 e Cryptosporidium spp. (10,5%). A tripla infecção mais frequente foi CPV-2, Giardia spp. e Cryptosporidium spp. (6,6%). Nossos resultados demostraram que infecções simples e mistas estão associadas a enterites graves em cães no sul do Brasil, envolvendo principalmente CPV-2 e Giardia sp.

Palavras-chave:
gastroenterite; cães; bactérias; vírus; protozoários; diagnóstico

INTRODUCTION:

Infectious and parasitic agents are commonly associated with gastrointestinal disease in dogs, ranging in severity from mild diarrhea to fatal enteritis. Gastrointestinal infections are distributed worldwide and affect mainly dogs younger than 1 year-old, yet adult infections and disease have also been reported (GIZZI et al., 2014). Protozoan and/or infectious enteritis remain as a major challenge to veterinarians, since many agents may cause similar clinical signs, maiking difficult a definitive diagnosis and the implementation of appropriate therapy (DUIJVESTIJN et al., 2016; GIZZI et al., 2014).

Gastrointestinal dog infections are important both for animal and public health, since some agents are zoonotic and/or produce severe disease, frequently resulting in death (ITOH et al., 2019; MARTINS et al., 2019). These fatal enteritis are frequently associated with Carnivore protoparvovirus 2 (CPV-2) infection due to its high virulence. However, other agents may also produce acute enteritis with similar clinical course, including protozoan and bacteria (DUIJVESTIJN et al., 2016; GIZZI et al., 2014). Secondary agents are frequently neglected during clinical inspection or laboratory investigation (ELLWANGER & CHIES, 2019), but sometimes could to aggravate the clinical course (DENHOLM et al., 2001; SILVA et al., 2017).

A number of studies aimed to detect/identify viral, bacterial or protozoa agents in intestinal segments or fecal samples of dogs with enteritis (DUIJVESTIJN et al., 2016; GIZZI et al., 2014). However, many studies focused on one or two specific agents, and failed to detect mixed infections caused by another microorganisms (ALVES et al., 2018; DE OLIVEIRA et al., 2018; OSMARI et al., 2021; SILVA et al., 2017). Furthermore, the clinic-epidemiological, molecular and pathological aspects have been only sporadically investigated and/or reported in fatal cases of enteritis in dogs. Thus, the aim of this study was to investigate the etiological agents, the clinical and pathological findings in dogs undergoing a severe course of enteritis caused by single or mixed infections.

MATERIALS AND METHODS:

Experimental design

Samples of 76 dogs presenting a history of severe enteritis, mostly evolving death, were included in the study. The animals were submitted to veterinary assistance due to history of diarrhea, emesis/vomit, anorexia and/or apathy. Dogs that died naturally were submitted to necropsy. The material collected at clinical inspection or necropsy was stored at -20 ºC until processing molecular analysis. Nucleic acids extracted from feces and/or intestinal fragments were submitted to molecular detection by PCR for viral, bacterial and protozoa agents. Additionally, histological examination was performed and the clinical, epidemiological and pathological findings were analyzed. The study comprised animals submitted to veterinary clinical and/or pathology services from Santa Maria and Porto Alegre, Rio Grande do Sul, Southern Brazil, between 2015 and 2020.

DNA extraction, PCR and nucleotide sequencing

Intestinal fragments and/or feces (100 to 200 mg) were macerated and mixed with 500 µl of TE 1X solution (10mM Tris-HCl, EDTA 0.1mM), shacked by 15 s and submitted to three cycles of thermic shock (37 ºC to -80 ºC) to perform the lysis of parasite cysts or oocysts presents in feces. DNA extraction of 500 μl of each sample was performed using phenol and chloroform protocol (BARKER et al., 1998) with modification in initial step of digestion (samples were incubated with 20mg/ml of proteinase K by 1 h at 56 ºC).

Molecular detection of protozoan, bacteria and DNA viruses was performed by PCR and nested-PCR, using primers and protocols described in table 1. The most common agents associated with intestinal infection in dogs were investigated: Giardia spp., Cryptosporidium spp., Sarcocystis spp., Neospora caninum, Toxoplasma gondii, Clostridium difficile, Clostridium perfringens A, Carnivore protoparvovirus 2 (CPV-2) and Canine Circovirus (CanineCV). RNA viruses were not included in the survey, as the samples were stored for a long time at -20 °C until processing, and they were not kept in a special buffer for RNA preservation.

Table 1
Agent, target gene, primer sequences and expected amplicon size of PCR and nested-PCR used to detect DNA virus, bacteria and protozoa agents in feces and intestinal fragments of dogs with severe enteritis.

Agent	Gene	Primers (5'-3')	Product (bp)	Reference
Giardia spp.	β-giardin (bg)	G7: AAGCCCGACGACCTCACCCGCAGTGC G759:GAGGCCGCCCTGGATCTTCGAGACGAC BG-Nst-F: GAACGAACGAGATCGAGGTCCG BG- Nst-R: CTCGACGAGCTTCGTGTT	753a 511b	(OSMARI et al., 2021)
Cryptosporidium spp.	SSU rRNA	F1: TTCTAGAGCTAATACATGCG R1: CCCATTTCCTTCGAAACAGGA F2: GGAAGGGTTGTATTTATTAGATAAAG R2: AAGGAGTAAGGAACAACCTCCA	1325a 819-825b	(ALVES et al., 2018)
Sarcocystis spp.	18s rDNA	F: CGCAAATTACCCAATCCTGA R: ATTTCTCATAAGGTGCAGGAG	700	(PORTELLA et al., 2016)
Toxoplasma gondii	B1	F:CGCTGCAGGGAGGAAGACGAAAGTTG R:CGCTGCAGACACAGTGCATCTGGATT	529	(PORTELLA et al., 2016)
Neospora caninum	Nc5	F:CCCAGTGCGTCCAATCCTGTAAC R:CTCGCCAGTCAACCTACGTCTTCT	338	(PORTELLA et al., 2016)
Clostridium perfringens	Toxin A	CPA 5L: AGTCTACGCTTGGGATGGAA CPA 5R: TTTCCTGGGTTGTCCATTTC	900	(BURET, A. et al., 1992)
Clostridium difficile	tcdA and tdB	NK2:CCCAATAGAAGATTCAATATTAAGCTT NK3: GGAAGAAAAGAACTTCTGGCTCACTCAGGT cdBFor: TAATAGAAAACAGTTAGAAA cdBRev: TCCAATCCAAACAAAATGTA	252c 301d	(ALVAREZ-PEREZ et al., 2009)
CanineCV	Rep	For_genomic:ATGGCTCAAGCTCAGGTTG Rev 533: CCGCACAGAACCTCCACTTC	533	(KOTSIAS et al., 2019)
CPV-2	VP2	555_for:CAGGAAGATATCCAGAAGGA 555_rev: GGTGCTAGTTGATATGTAATAAACA	583	(BUONAVOGLIA, et al., 2001)

• a: primary reaction; b: secondary reaction; c: toxin A; d: toxin B.

For this, 100 - 200 ng of total DNA, 1.25 mM of MgCl_2, 2.5 mM 10x Taq buffer, 1 U of Taq DNA polymerase (0.2 μl) (Thermo Fisher Scientific^®), 20 μM deoxyribonucleotides (dNTPs), 1 μM each primer and ultrapure water up to 25 μl were used in each reaction. PCR products were resolved in a 1.5 % agarose gel stained by Gel Red (Biotium Inc, Fremont, CA, USA) and visualized under ultraviolet light after electrophorese (60 V, 60 min). CPV-2 classification was based on the analysis of the amino acid residue at position 426 of the VP2 FPLV/CPV-2 gene, as follows: asparagine determines subtype 2a; aspartic acid determines 2b; and glutamic acid determines 2c (BUONAVOGLIA et al., 2001).

Clinical, epidemiological and pathological analysis

Clinical and epidemiological data of all cases were collected and analyzed, including age, clinical signs and the time of clinical evolution. Most dogs included in the present study were submitted to a full necropsy. Tissue fragments were fixed in 10% buffered formalin for 24 to 48 h. After tissue processing, paraffin-embedded samples were cut in 3-μm-thick sections and stained with hematoxylin and eosin for histological examination.

RESULTS:

Sixty-eight of the 76 cases presented gastroenteric signs and evolved to death. Eight dogs remained alive (8/76), of which we only had access to feces and clinical history. At least one agent was detected (52.6%), but double (36.8%) and triple infections (10.5%) where frequently reported. The single infection by CPV-2 was the most common associated with severe enteritis in analyzed cases (36.8% of total). Co-infection between Giardia spp. and CPV-2 (19.7%) was the most frequent double infection, followed by Cryptosporidium spp. and CPV-2 (10.5%). Among triple infections, Giardia spp., Cryptosporidium spp. and CPV-2 (6.6% of total cases) was the most frequent (Table 2).

Table 2
Infections and co-infections detected in dogs presenting severe enteritis in southern Brazil.

Type of infection	Number of cases	%
Single infection	40	52.6
CPV-2	28	36.8
Giardia sp.	9	11.8
Crysptosporidium sp.	2	2.6
Clostridium perfringens type A	1	1.3
Double infection	28	36.8
Giardia sp. and CPV-2	15	19.7
Cryptosporidium sp. and CPV-2	8	10.5
Giardia sp. and Cryptosporidium sp.	2	2.6
Giardia sp. and Clostridium perfringens type A	2	2.6
Clostridium perfringens type A and CPV-2	1	1.3
Triple infection	8	10.5
Giardia sp., Cryptosporidium sp. and CPV-2	5	6.6
Giardia sp., Sarcocystis sp. and CPV-2	1	1.3
Giardia sp., Clostridium difficile and CPV-2	1	1.3
Giardia sp., Clostridium perfringens type A and CPV-2	1	1.3
Total	76	100

CPV-2 was the main agent involved in single and mixed infections (60/76 cases, 78.94%). In most cases, histopathological lesions suggestive of CPV-2 were reported by the pathologist, including necrotizing enteritis with squamous metaplasia, necrosis and fusion of crypts, villous atrophy (Figure 1A), epithelial syncytia in crypts and Peyer’s patch necrosis. DNA sequencing and amino acid analysis of the VP2 protein was performed on 46 CPV-2 positive samples (46/60), indicating that 27 were classified as CPV-2c, 17 as CVP-2a and 2 as CPV-2b. Fourteen samples were not sequenced and classified due to poor DNA quality.

Figure 1
Pathological lesions observed in the intestine of dogs with severe enteritis caused by viruses, protozoa or bacteria. A) Necrosis and collapse of crypts, with villous atrophy and squamous metaplasia of intestinal cells in the small intestine of a dog infected with canine parvovirus type 2. Hematoxylin and eosin (HE). Bar: 150µm. B) Multifocal crypt abscesses in the small intestine of a dog infected with Giardia sp. Multiple dilated crypts are filled with cellular debris and degenerated neutrophils. HE, bar: 150 µm. C) Intestine of a dog infected with Clostridium perfringens A presenting massive necro-hemorrhagic enteritis. D) Myriad of basophilic bacilli lining a necrotic intestinal villus of a dog infected with Clostridium perfringens A. HE, bar: 150 µm.

Single infections by CPV-2, Giardia spp., Clostridium perfringens type A or Crysptosporidium spp. were identified in most analyzed dogs (52.6%), with predominance of CPV-2 (36.8%), followed by Giardia sp. (11.8%). The age of CPV-2 affected animals ranged from 1 month to 7 years-old. The clinical signs reported were mainly diarrhea, vomiting, prostration, anorexia and convulsion. In cases where only Giardia sp. was detected, two dogs developed intestinal lesions characteristic of protozoa infection, as cryptitis (Figure 1B), suggesting giardiasis as primary cause of death. However, five (5/9) dogs positive to Giardia sp. presented intestinal lesions highly associated with CPV-2 infection, but viral DNA was not detected by PCR.

Double infections included mostly Giardia sp. and CPV-2 (15/28) or Cryptosporidium sp. and CPV-2 (8/28). In two cases of co-infection by Cryptosporidium sp. and CPV-2, the dogs presented systemic manifestations of other infections, as canine herpesvirus and adenovirus. Young dogs (2 months-old) co-infected by Giardia sp. and Cryptosporidium sp. presented clinical and pathological signs suggestive of protozoa (1/2) or CPV-2 infection (1/2). Crypt abscess (or cryptitis) that is a classical lesion of intestinal protozoa infection, was observed in a dog. Co-infection by Giardia sp. and C. perfringens type A was observed in a single case and the animal presented intestinal lesions characteristic of protozoan infection.

In most cases of triple infection (6/8), the pathological lesions and clinical signs were also suggestive of CPV-2 infection. The only one case in which the animal presented triple infection by Giardia sp., Sarcocystis spp. and CPV-2, the clinical signs and pathological changes (necrotizing colitis with intralesional protozoa) were suggestive of enteritis by protozoa, even though CPV-2 had been detected by PCR.

Enterotoxemia by Clostridium perfringens type A was the probable cause of death of one dog (Fig 1C and D), in which DNA of toxin A was detected by PCR. Cryptosporidium spp. was also suggested as the cause of death of one animal in which it was the only agent detected. In a dog with mixed CPV-2 and Crysptosporidium sp. infection, CPV-2 was considered as the primary agent. DNA of Toxoplasma gondii, Neospora caninum and Canine CV were not detected in any analyzed samples.

DISCUSSION:

Acute gastroenteritis is a very common disease in dogs around the world, frequently evolving to dehydration, apathy, prostration and death, mainly in puppies (HUBBARD et al., 2007). Several pathogens have been associated with acute gastroenteritis of fatal course in dogs, but CPV-2 is the most frequent agent detected (DOWGIER et al., 2017; DUIJVESTIJN et al., 2016; GIZZI et al., 2014).

In the present study, CPV-2 was the main agent involved, either in single or mixed infections and affecting mainly young, but also adult animals. Among the CPV subtypes, CPV-2c has been more frequently associated with severe enteritis, affecting both adult and vaccinated dogs (DECARO & BUONAVOGLIA, 2012; DE OLIVEIRA et al., 2018). Although, CPV-2c was the most prevalent subtype (45%, 27/60) we did not observe differences in the histological lesions caused by any of the subtypes. CPV-2 is highly transmissible and associated with severe enteritis mainly in young dogs (DECARO et al., 2006), but CPV-2-associated disease has also been reported in adult and dogs with a complete vaccination protocol (MIRA et al., 2018). Interestingly, even in a few cases in which CPV-2 was not detected, histopathological changes suggested it as the probable cause of the disease and death. The lesions observed in cases of parvovirosis are well defined and characterized by necrotizing enteritis with squamous metaplasia, necrosis and fusion of crypts, villous atrophy, epithelial syncytia in crypts and Peyer’s patch necrosis (DE OLIVEIRA et al., 2018; GODDARD & LEISEWITZ, 2010; MOON et al., 2008; NOVOSEL et al., 2019), similar to those observed in most cases of enteritis associated with CPV-2 reported here (Figure 1A). Other viral agents commonly related to enteric disease in dogs promote different histopathology lesions. Coronavirus causes atrophy and fusion of intestinal villi and deepening of crypts, increase in cellularity of the lamina propria, and flattening of epithelial cells (KEENAN et al., 1976; PRATELLI et al., 2001); and distemper virus produce eosinophilic inclusion bodies in the epithelial cells of the lung, intestine, renal pelvis and urinary bladder, and gastroenteritis with degeneration of epithelia, lymphocyte necrosis and neutrophil infiltration of the lamina propria (OKITA et al., 1997).

The association between CPV-2 and Giardia spp., Cryptosporidium spp. or Clostridium sp. were the most frequent cases of double infections. A similar finding was observed in diarrheic dogs from southern Brazil (Curitiba, PR), in which co-infections were detected only in diarrheic dogs (GIZZI et al., 2014). These findings indicated that multiple agents should be investigated in cases of diarrhea or severe enteritis in dogs.

Association between CPV-2 and Giardia sp. was the most frequent co-infection detected in our study. A significant association of these enteropathogens was already reported in feces of domestic (KUZI et al., 2020) and sheltered dogs (DUIJVESTIJN et al., 2016). In most of the mixed infections examined here, the histopathological lesions were predominantly related to CPV-2 infection, as previously described. These findings suggested that CPV-2 was the main primary agent involved in most cases of gastroenteritis and death of the animals, since Giardia sp. is frequently detected in healthy, asymptomatic dogs (DUIJVESTIJN et al., 2016). However, in a single case, a crypt abscess/cryptitis was observed, that is a characteristic lesion induced by protozoa (COTTON et al., 2011). Then, the protozoa co-infection was the suggestive cause of the pathology and death of this dog.

The combination of CPV-2 and Crypstoporidium spp. was also frequently observed in our study. However, the animals had only intestinal lesions characteristic of CPV-2 infection, suggesting a circumstantial presence of the protozoa in the feces. No cases of mixed infection presented pathological changes suggestive of protozoa enteritis as cause of the death. Co-infection by CPV-2 and Cryptosporidium spp. has been frequently reported in diarrheic dogs and has been suggested that the protozoa may aggravate the CPV-2 infection (DENHOLM et al., 2001).

Two cases of multiple infections involving Giardia sp. and Cryptosporidium spp., and Giardia sp. and C. perfringens type A, resulted in lesions characteristic of protozoa infection, which was considerate the cause of death. Enteric protozoa, as Giardia sp., Cryptosporidium spp. and Cystoisospora spp., are frequently detected in asymptomatic dogs (TUPLER et al., 2012) or in dogs with transient diarrhea and vomiting (GIZZI et al., 2014). Hence, they were related as cause of some cases of fatal gastroenteritis in dogs (DUIJVESTIJN et al., 2016). In these cases of co-infections, cryptitis/crypt abscess and villous necrosis, which are histopathological lesions related to infection by protozoa (SCORZA & TANGTRONGSUP, 2010) were observed. Single infection by Giardia sp. was also associated with intestinal lesions and death in two cases of puppies with history of gastroenteropathy, hypovolemia and hypothermia, that presented mild to accentuated multifocal necrosupurative cryptitis (Figure 1B). Thus, it was suggested that Giardia sp. and/or Crypstoporidium sp. were the primary cause of the disease and death in these cases. These findings reinforce the importance of protozoa as agents of severe enteritis in dogs, and they should be included in the list of differential diagnosis of enteric agents.

C. perfringens type A is a Gram-positive rod naturally found in intestinal flora animals (MCCLANE et al., 2014; SILVA et al., 2017), and produces a wide variety of exotoxins and enzymes that could cause enteritis in dogs, associated with severe hemorrhagic diarrhea (SCHLEGEL et al., 2012). A similar finding was observed in an 8 years-old dog in this study, which presented hemorrhagic diarrhea, vomit with blood, and died after developed hypothermia. At necropsy, necrotizing enteritis, hemorrhagic, suppurative and diffuse, with aggregates of rod bacteria were observed, lesions compatible with enterotoxaemia/clostridiosis (Figure 1C, D). However, since C. perfringens type A is a natural habitant of the intestinal flora, DNA detection would not suffice to confirm the diagnosis (SCHLEGEL et al., 2012). Rather, this finding needs to be associated with bacteria quantitation, toxin detection and/or pathological lesions to reach the final diagnosis of clostridia enterotoxemia (MARKS & KATHER, 2003). Since no characteristic lesions of clostridiosis were observed in other four cases where DNA of C. perfringens type A was detected associated with other agents, it is unlikely that C. perfringens type A was the primary cause of the disease and death.

In few cases, the pathological findings and molecular diagnosis were divergent. In one of them, the intestinal lesions were compatible with Clostridium perfringens type A infection, but only DNA of Giardia spp. was detected. In another five cases, parvovirus was the diagnosis suggested by the pathologist, but only Giardia sp. was detected. Our hypothesis is that the long storage time at -20 ºC of the samples and the freezing and thawing process may have contributed to the DNA degradation that affected mainly the CPV-2 PCR sensibility, since we used a conventional PCR to CPV-2 and nested-PCR to Giardia spp. (high sensitivity test).

Canine enteric coronavirus and canine distemper virus, as well as other low-prevalence agents (such as bocavirus, astrovirus, and kobuvirus), have been detected in dogs with enteric diseases worldwide (BARROS et al., 2019; BODEWES et al., 2014; CHOI et al., 2014; DOWGIER et al., 2017; LI et al., 2011). Although, we have not observed characteristic/pathognomonic intestinal lesions associated with these agents, we cannot completely rule out their involvement in some cases. Our study was conducted using long-term storage samples at -20 °C, which may not be ideal for detecting RNA viruses or other agents that are prone to degradation over time. Future studies, using fresh and well-preserved samples, may provide more accurate results and allow the investigation of these agents.

CONCLUSION:

Taken together, our results showed that single and mixed infections are associated with severe enteritis in dogs from Southern Brazil. Although CPV-2 was the main pathogen involved in these cases, Giardia sp., Crypstoporidium sp. and C. perfringens type A were also detected and may contribute for the disease and, thus, should be included in differential diagnosis.

ACKNOWLEDGEMENTS

PSBO, EFF and FSFV are recipientes of Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) fellowships. APGM and MGS are recipientes of Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) fellowships, Brasil - Finance code 001.

REFERENCES

• ALVAREZ-PEREZ, S. et al. Prevalence of Clostridium difficile in diarrhoeic and non-diarrhoeic piglets. Veterinary Microbiology, v.137, n.3-4, p.302-305, 2009. Available from: <Available from: https://doi.org/10.1016/j.vetmic.2009.01.015 >. Accessed: Jun. 08, 2021. doi: 10.1016/j.vetmic.2009.01.015.
  » https://doi.org/10.1016/j.vetmic.2009.01.015.» https://doi.org/10.1016/j.vetmic.2009.01.015
• ALVES, M. E. M. et al. Molecular detection of Cryptosporidium spp. and the occurrence of intestinal parasites in fecal samples of naturally infected dogs and cats. Parasitology Research, v.117, n.9, p.3033-3038, 2018. Available from: <Available from: https://doi.org/10.1007/s00436-018-5986-4 >. Accessed: Mar. 09, 2021. doi: 10.1007/s00436-018-5986-4.
  » https://doi.org/10.1007/s00436-018-5986-4.» https://doi.org/10.1007/s00436-018-5986-4
• BARKER et al. Phenol-chloroform isoamyl alcohol (PCI) DNA extraction. 1998. Available from: <Available from: https://www.studocu.com/ko/document/hanyang-university/physiology-andlaboratory/phenol-chloroform-isoamyl-alcohol-pci-dna-extraction/29341389 >. Accessed: Jan. 21, 2021.
  » https://www.studocu.com/ko/document/hanyang-university/physiology-andlaboratory/phenol-chloroform-isoamyl-alcohol-pci-dna-extraction/29341389
• BARROS, B. C. V. et al. Proposed new strain of canine kobuvirus from fecal samples of brazilian domestic dogs. American Society for Microbiology, v.8, p.e01292-18, 2019. Available from: <Available from: https://journals.asm.org/doi/10.1128/MRA.01292-18 >. Accessed: Nov. 30, 2022. doi: 10.1128/MRA.01292-18.
  » https://doi.org/10.1128/MRA.01292-18.» https://journals.asm.org/doi/10.1128/MRA.01292-18
• BODEWES, R. et al. Novel canine bocavirus strain associated with severe enteritis in a dog litter, Veterinary Microbiology, v.174, n.1-2, p.1-8, 2014. Available from: <Available from: https://doi.org/10.1016/j.vetmic.2014.08.025 >. Accessed: May, 04, 2021. doi: 10.1016/j.vetmic.2014.08.025.
  » https://doi.org/10.1016/j.vetmic.2014.08.025.» https://doi.org/10.1016/j.vetmic.2014.08.025
• BUONAVOGLIA, C. et al. Evidence for evolution of canine parvovirus type 2 in Italy. Journal of General Virology, v.82, n.12, p.3021-3025, 2001. Available from: <Available from: https://doi.org/10.1099/0022-1317-82-12-3021 >. Accessed: Sep. 24, 2019. doi: 10.1099/0022-1317-82-12-3021.
  » https://doi.org/10.1099/0022-1317-82-12-3021.» https://doi.org/10.1099/0022-1317-82-12-3021
• BURET, A. et al. Pathophysiology of small intestinal malabsorption in gerbils infected with Giardia lamblia Gastroenterology, v.103, n.2, p.506-513, 1992. Available from: <Available from: http://linkinghub.elsevier.com/retrieve/pii/001650859290840U >. Accessed: Jun. 8, 2021. doi: 10.1016/0016-5085(92)90840-U.
  » https://doi.org/10.1016/0016-5085(92)90840-U.» http://linkinghub.elsevier.com/retrieve/pii/001650859290840U
• CHOI, S. et al. Phylogenetic analysis of astrovirus and kobuvirus in Korean dogs. Journal of Veterinary Medical Science, v.76, n.8, p.1141-1145, 2014. Available from: <Available from: https://www.jstage.jst.go.jp/article/jvms/76/8/76_13-0585/_article >. Accessed: Nov. 30, 2022. doi: 10.1292/JVMS.13-0585.
  » https://doi.org/10.1292/JVMS.13-0585.» https://www.jstage.jst.go.jp/article/jvms/76/8/76_13-0585/_article
• COTTON, J. A. et al. Host parasite interactions and pathophysiology in Giardia infections. International Journal for Parasitology. v.41, n.9, p.925-933, 2011. Available from: <Available from: https://doi.org/10.1016/j.ijpara.2011.05.002 >. Accessed: Mar. 12, 2021. doi: 10.1016/j.ijpara.2011.05.002.
  » https://doi.org/10.1016/j.ijpara.2011.05.002.» https://doi.org/10.1016/j.ijpara.2011.05.002
• DECARO, N. et al. First detection of canine parvovirus type 2c in pups with haemorrhagic enteritis in Spain. Journal of Veterinary Medicine, Series B, v.53, n.10, p.468-72, 2006. Available from: <Available from: http://www.mbio.ncsu.edu/BioEdit/ >. Accessed: May, 18, 2021. doi: 10.1111/j.1439-0450.2006.00974.x.
  » https://doi.org/10.1111/j.1439-0450.2006.00974.x.» http://www.mbio.ncsu.edu/BioEdit/
• DECARO, N.; BUONAVOGLIA, C. Canine parvovirus-A review of epidemiological and diagnostic aspects, with emphasis on type 2c, Veterinary Microbiology, v.155, 1, p.1-12, 2012, Available from: <Available from: https://www.sciencedirect.com/science/article/pii/S0378113511005013 >. Accessed: Feb. 11, 2021. doi: 10.1016/j.vetmic.2011.09.007.
  » https://doi.org/10.1016/j.vetmic.2011.09.007.» https://www.sciencedirect.com/science/article/pii/S0378113511005013
• DENHOLM, K. et al. Concurrent Cryptosporidium and parvovirus infections in a puppy. Australian Veterinary Journal, v.79, n.2, p.98-101, 2001. Available from: <Available from: http://doi.wiley.com/10.1111/j.1751-0813.2001.tb10708.x >. Accessed: Jun. 7, 2021. doi: 10.1111/j.1751-0813.2001.tb10708.x.
  » https://doi.org/10.1111/j.1751-0813.2001.tb10708.x.» http://doi.wiley.com/10.1111/j.1751-0813.2001.tb10708.x
• DE OLIVEIRA, P. S. B. et al. Epidemiological, clinical and pathological features of canine parvovirus 2c infection in dogs from southern Brazil. Pesquisa Veterinaria Brasileira, v.38, n.1, p.113-118, 2018. Available from: <Available from: https://doi.org/10.1590/1678-5150-PVB-5122 >. Accessed: Mar. 08, 2021. doi: 10.1590/1678-5150-pvb-5122.
  » https://doi.org/10.1590/1678-5150-pvb-5122.» https://doi.org/10.1590/1678-5150-PVB-5122
• DOWGIER, G. et al. A molecular survey for selected viral enteropathogens revealed a limited role of Canine circovirus in the development of canine acute gastroenteritis. Veterinary Microbiology, v.204, p.54-58, 2017. Available from: < Available from: https://pmc/articles/PMC7131434/ >. Accessed: Mar. 9, 2021. doi: 10.1016/j.vetmic.2017.04.007.
  » https://doi.org/10.1016/j.vetmic.2017.04.007.» https://pmc/articles/PMC7131434/
• DUIJVESTIJN, M. et al. Enteropathogen infections in canine puppies: (Co-)occurrence, clinical relevance and risk factors. Veterinary Microbiology, v.195, p.115-122, 2016. Available from: <Available from: https://doi.org/10.1016/j.vetmic.2016.09.006 >. Accessed: Apr. 14, 2020. doi: 10.1016/j.vetmic.2016.09.006.
  » https://doi.org/10.1016/j.vetmic.2016.09.006.» https://doi.org/10.1016/j.vetmic.2016.09.006
• ELLWANGER, J. H.; CHIES, J. A. B. The triad “dogs, conservation and zoonotic diseases” - An old and still neglected problem in Brazil. Perspectives in Ecology and Conservation, v.17, n.3, p.157-161, 2019. Available from: < Available from: https://pmc/articles/PMC7148981/ >. Accessed: May, 07, 2021. doi: 10.1016/j.pecon.2019.06.003.
  » https://doi.org/10.1016/j.pecon.2019.06.003.» https://pmc/articles/PMC7148981/
• GIZZI, A. B. D. R. et al. Presence of infectious agents and co-infections in diarrheic dogs determined with a real-time polymerase chain reaction-based panel. BMC Veterinary Research, v.10, p.23, 2014. Available from: < Available from: https://pmc/articles/PMC3896730/ >. Accessed: Feb. 22, 2021. doi: 10.1186/1746-6148-10-23.
  » https://doi.org/10.1186/1746-6148-10-23.» https://pmc/articles/PMC3896730/
• GODDARD, A.; LEISEWITZ, A. L. Canine parvovirus. The Veterinary clinics of North America. Small animal practice, v.40, n.6, p.1041-53, 2010. Available from: <Available from: https://linkinghub.elsevier.com/retrieve/pii/S019556161000094X >. Accessed: Jun. 24, 2021. doi: 10.1016/j.cvsm.2010.07.007.
  » https://doi.org/10.1016/j.cvsm.2010.07.007.» https://linkinghub.elsevier.com/retrieve/pii/S019556161000094X
• HUBBARD, K. et al. Risk of vomiting and diarrhoea in dogs. Veterinary Record, v.161, n.22, p.755-757, 2007. Available from: <Available from: http://doi.wiley.com/10.1136/vr.161.22.755 >. Accessed: Feb. 22, 2021. doi: 10.1136/vr.161.22.755.
  » https://doi.org/10.1136/vr.161.22.755.» http://doi.wiley.com/10.1136/vr.161.22.755
• ITOH, N. et al. Molecular prevalence of Cryptosporidium spp. In breeding kennel dogs. Korean Journal of Parasitology, v.57, n.2, p.197-200, 2019. Available from: < Available from: http://pmc/articles/PMC6526223/ >. Accessed: Feb. 18, 2021. doi: 10.3347/kjp.2019.57.2.197.
  » https://doi.org/10.3347/kjp.2019.57.2.197.» http://pmc/articles/PMC6526223/
• KEENAN, K. P. et al. Intestinal infection of neonatal dogs with canine coronavirus 1-71: studies by virologic, histologic, histochemical, and immunofluorescent techniques. American Journal of Veterinary Research, v.37, n.3, p.247-56, 1976. Available from: <Available from: https://pubmed.ncbi.nlm.nih.gov/1259219/ >. Accessed: Nov. 24, 2022. PMID: 1259219.
  » https://pubmed.ncbi.nlm.nih.gov/1259219/
• KOTSIAS, F. et al. Genomic characterization of canine circovirus associated with fatal disease in dogs in South America. PloS one, v.14, n.6, p.e0218735, 2019. Available from: < Available from: https://pmc/articles/PMC6592543/ >. Accessed: Mar. 01, 2021. doi: 10.1371/journal.pone.0218735.
  » https://doi.org/10.1371/journal.pone.0218735.» https://pmc/articles/PMC6592543/
• KUZI, S.; et al. Prevalence of Giardia duodenalis infection, co-morbidities and associated risk factors in dogs admitted to a veterinary teaching hospital in Israel. Comparative Immunology, Microbiology and Infectious Diseases, v.68, p.101401, 2020. Available from: <Available from: https://doi.org/10.1016/j.cimid.2019.101401 >. Accessed: May, 10, 2021. doi: 10.1016/j.cimid.2019.101401.
  » https://doi.org/10.1016/j.cimid.2019.101401.» https://doi.org/10.1016/j.cimid.2019.101401
• LI, L. et al. Viruses in diarrhoeic dogs include novel kobuviruses and sapoviruses. Journal of General Virology, v.92, n.11, p.2534-2541, 2011. Available from: <Available from: https://www.microbiologyresearch.org/content/journal/jgv/10.1099/vir.0.034611-0 >. Accessed: Nov. 30, 2022. doi: 10.1099/vir.0.034611-0.
  » https://doi.org/10.1099/vir.0.034611-0.» https://www.microbiologyresearch.org/content/journal/jgv/10.1099/vir.0.034611-0
• MARKS, S. L.; KATHER, E. J. Bacterial-associated diarrhea in the dog: A critical appraisal. Veterinary Clinics of North America - Small Animal Practice. v.33, n.5, p.1029-1060, 2003. Available from: <Available from: https://doi.org/10.1016/S0195-5616(03)00091-3 >. Accessed: May, 10, 2021. doi: 10.1016/S0195-5616(03)00091-3.
  » https://doi.org/10.1016/S0195-5616(03)00091-3.» https://doi.org/10.1016/S0195-5616(03)00091-3
• MARTINS, F. D. C. et al. Surveillance of Giardia and Cryptosporidium in sewage from an urban area in Brazil. Revista Brasileira de Parasitologia Veterinaria, v.28, n.2, p.291-297, 2019. Available from: <Available from: https://www.cbpv.org.br/rbpv >. Accessed: Mar. 30, 2020. doi: 10.1590/s1984-29612019037.
  » https://doi.org/10.1590/s1984-29612019037.» https://www.cbpv.org.br/rbpv
• MCCLANE, B. A. et al. Clostridium perfringens In: DOYLE, M. P.; BUCHANAN, R. L. Food microbiology. 2014. Cap.18, p.465-489. Available from: <Available from: https://onlinelibrary.wiley.com/doi/abs/10.1128/9781555818463.ch18 >. Accessed: May, 10, 2021. doi: 10.1128/9781555818463.ch18.
  » https://doi.org/10.1128/9781555818463.ch18.» https://onlinelibrary.wiley.com/doi/abs/10.1128/9781555818463.ch18
• MIRA, F. et al. Molecular typing of a novel canine parvovirus type 2a mutant circulating in Italy. Infection, genetics and evolution, v.61, p.67-73, 2018. Available from: <Available from: https://linkinghub.elsevier.com/retrieve/pii/S1567134818300972 >. Accessed: Sep. 24, 2019. doi: 10.1016/j.meegid.2018.03.010.
  » https://doi.org/10.1016/j.meegid.2018.03.010.» https://linkinghub.elsevier.com/retrieve/pii/S1567134818300972
• MOON, H. S. et al. Comparison of the pathogenicity in three different Korean canine parvovirus 2 (CPV-2) isolates. Veterinary Microbiology, v.131, n.1-2, p.47-56, 2008. Available from: <Available from: https://doi.org/10.1016/j.vetmic.2008.02.016 >. Accessed: Nov. 24, 2022. doi: 10.1016/j.vetmic.2008.02.016.
  » https://doi.org/10.1016/j.vetmic.2008.02.016.» https://doi.org/10.1016/j.vetmic.2008.02.016
• NOVOSEL, D. et al. Evidence of CPV2c introgression into Croatia and novel insights into phylogeny and cell tropism. Scientific Reports 2019 9:1, v.9, n.1, p.1-12, 2019. Available from: <Available from: https://www.nature.com/articles/s41598-019-53422-9 >. Accessed: Nov. 24, 2022. doi: 10.1038/s41598-019-53422-9.
  » https://doi.org/10.1038/s41598-019-53422-9.» https://www.nature.com/articles/s41598-019-53422-9
• OKITA, M. et al. Histopathological features of canine distemper recently observed in Japan. Journal of Comparative Pathology, v.116, n.4, p.403-408, 1997. Available from: <Available from: https://doi.org/10.1016/S0021-9975(97)80057-6 >. Accessed: Nov. 24, 2022. doi: 10.1016/s0021-9975(97)80057-6.
  » https://doi.org/10.1016/s0021-9975(97)80057-6.» https://doi.org/10.1016/S0021-9975(97)80057-6
• OSMARI, V. et al. Occurrence and molecular characterization of Giardia duodenalis from naturally infected dogs in the municipality of Santa Maria, Rio Grande do Sul, Brazil. Pesquisa Veterinária Brasileira, v.41, e06670, 2021. Available from: <Available from: https://doi.org/10.1590/1678-5150-PVB-6670 >. Accessed: Jun. 17, 2021. doi: 10.1590/1678-5150-PVB-6670.
  » https://doi.org/10.1590/1678-5150-PVB-6670.» https://doi.org/10.1590/1678-5150-PVB-6670
• PORTELLA, L. P. et al. Antibodies against Neospora caninum, Sarcocystis spp. and Toxoplasma gondii detected in buffaloes from Rio Grande do Sul, Brazil. Pesquisa Veterinaria Brasileira, v.46, n.9, p.1613-1617, 2016. Available from: <Available from: https://doi.org/10.1590/0103-8478cr20151365 >. Accessed: Jul. 29, 2022. doi: 10.1590/0103-8478cr20151365.
  » https://doi.org/10.1590/0103-8478cr20151365.» https://doi.org/10.1590/0103-8478cr20151365
• PRATELLI, A. et al. Severe enteric disease in an animal shelter associated with dual infections by canine adenovirus type 1 and canine coronavirus. Journal of Veterinary Medicine, Series B, v.48, n.5, p.385-392, 2001. Available from: < Available from: https:///pmc/articles/PMC7165820/ >. Accessed: Feb. 11, 2021. doi: 10.1046/j.1439-0450.2001.00466.x.
  » https://doi.org/10.1046/j.1439-0450.2001.00466.x.» https:///pmc/articles/PMC7165820/
• SCHLEGEL, B. J. et al. Clostridium perfringens type a fatal acute hemorrhagic gastroenteritis in a dog. Canadian Veterinary Journal, v.53, n.5, p.555-557, 2012. Available from: < Available from: https:///pmc/articles/PMC3327598/ >. Accessed: Feb. 23, 2021.
  » https:///pmc/articles/PMC3327598/
• SCORZA, V.; TANGTRONGSUP, S. Update on the diagnosis and management of Cryptosporidium spp infections in dogs and cats. Topics in Companion Animal Medicine.2010 Available from: <Available from: https://doi.org/10.1053/j.tcam.2010.07.007 >. Accessed: Mar. 12, 2021. doi: 10.1053/j.tcam.2010.07.007.
  » https://doi.org/10.1053/j.tcam.2010.07.007.» https://doi.org/10.1053/j.tcam.2010.07.007
• SILVA, R. O. S. et al. Clostridium perfringens and C. difficile in parvovirus-positive dogs. Anaerobe, v.48, p.66-69, 2017. Available from: <Available from: https://doi.org/10.1016/j.anaerobe.2017.07.001 >. Accessed: Feb. 21, 2021. doi: 10.1016/j.anaerobe.2017.07.001.
  » https://doi.org/10.1016/j.anaerobe.2017.07.001.» https://doi.org/10.1016/j.anaerobe.2017.07.001
• TUPLER, T. et al. Enteropathogens identified in dogs entering a Florida animal shelter with normal feces or diarrhea. Journal of the American Veterinary Medical Association, v.241, n.3, p.338-343, 2012. Available from: <Available from: https://pubmed.ncbi.nlm.nih.gov/22812470/ >. Accessed: May, 31, 2021. doi: 10.2460/javma.241.3.338.
  » https://doi.org/10.2460/javma.241.3.338.» https://pubmed.ncbi.nlm.nih.gov/22812470/

• CR-2022-0472.R3

BIOETHICS AND BIOSSECURITY COMMITTEE APPROVAL

• No approval of research ethics committees was required to accomplish the goals of this study because experimental research was conducted with samples received for diagnosis.

Edited by

Editor: Rudi Weiblen (0000-0002-1737-9817)

Publication Dates

• Publication in this collection
  17 July 2023
• Date of issue
  2024

History

• Received
  23 Aug 2022
• Accepted
  17 Apr 2023
• Reviewed
  22 June 2023