SciELO - Scientific Electronic Library Online

 
vol.24First record of Petrolisthes virgatus Paul'son, 1875 (Crustacea, Decapoda, Anomura, Porcellanidae) from the Persian Gulf and Gulf of Oman, Iran author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

Share


Nauplius

Print version ISSN 0104-6497On-line version ISSN 2358-2936

Nauplius vol.24  Cruz das Almas  2016  Epub Dec 12, 2016

http://dx.doi.org/10.1590/2358-2936e2016030 

Short Communication

New primers for amplification of cytochrome c oxidase subunit I barcode region designed for species of Decapoda (Crustacea)

Fernando L. Mantelatto1  * 

Fabrício L. Carvalho1  2 

Sabrina M. Simões1  3 

Mariana Negri1 

Edvanda A. Souza-Carvalho1 

Mariana Terossi1 

1Laboratório de Bioecologia e Sistemática de Crustáceos (LBSC), Departamento de Biologia, Faculdade de Filosofia, Ciências e Letras de Ribeirão Preto (FFCLRP), Universidade de São Paulo (USP). 14040-901 Ribeirão Preto, São Paulo, Brazil. FLM E-mail: flmantel@usp.br, MN E-mail: ma_negri90@hotmail.com, EAS-C E-mail: vanda@obrasill.com, MT E-mail: mterossi@usp.br

2Grupo de Pesquisa em Carcinologia e Biodiversidade Aquática (GPCBio), Centro de Formação em Ciências e Tecnologias Agroflorestais (CFCTA), Universidade Federal do Sul da Bahia (UFSB). 45662-200 Ilhéus, Bahia, Brazil. FLC E-mail: flcarvalho@ufsb.edu.br

3Laboratório de Biologia de Camarões Marinhos e de Água Doce (LABCAM), Faculdade de Ciências, Universidade Estadual Paulista (Unesp). 17033-360 Bauru, São Paulo, Brazil. SMS E-mail: sabrinamsimoes@gmail.com

Abstract

We designed 14 new primers for amplification of the COI barcode region of decapod crustacean species. We tested, with high level of success, the generation of ~ 640 ± 49 base-pair sequences in selected groups of decapods (hermit crabs, squat lobsters, marine and freshwater crabs and shrimps), encompassing representatives of 27 genera of 15 families, 11 of Pleocyemata (Anomura, Brachyura, and Caridea) and 4 of Dendrobranchiata. Based on the results we expect the applicability of these primers for several studies with different taxa within Decapoda.

Key words: COI; DNA Barcoding; molecular markers; molecular techniques

During the last three decades, molecular techniques have become a large, and in some cases, indispensable ally for advances in our knowledge of biodiversity. There is sufficient available literature providing evidence for the suitability and credibility of DNA-based investigations at different taxonomic levels. Among those taxa for which molecular analyses have proven their efficiency and allowed innumerous advances in different areas is a diverse and species-rich group: decapod crustaceans. The molecular methodological support has helped to advance knowledge about many aspects of this taxon, including systematics, biogeography, ecology, conservation, and taxonomy by the identification of larvae and eggs, cryptic species, and damaged specimens.

Since 2011, the Laboratory of Bioecology and Systematics of Crustaceans (LBSC) has been involved in two long-term projects aiming the characterization of the marine and estuarine decapod crustaceans biodiversity of the Brazilian coast, supported by the Brazilian agencies "Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)" through Biota-FAPESP Program and "Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)" through Ciências do Mar II. Both projects made use of combined analysis techniques to elucidate various aspects of the life cycle and evolution in decapod crustaceans, and molecular analyses were one of the main tools to support the assumptions of these studies. To this end, we attempted to generate DNA sequences of two mitochondrial markers, the barcode region of cytochrome c oxidase subunit I (COI) and a fragment of 16S rRNA, of all decapod species sampled along the coast of São Paulo in order to develop a genetic library to serve as base line to all researchers in this field (F. Mantelatto et al., unpubl. data). However, particularly for the COI region, we had considerable difficulties in obtaining successful amplifications using some previous standard universal pairs of primers: LCO1-1490/HCO1-2198 (Folmer et al., 1994) or COL6b/COH6 (Schubart and Huber, 2006), designed for crayfishes based on the primers of Folmer et al. (1994).

Thus, we designed 14 new primers for the COI barcode region (Tab. 1, Fig. 1), five of them with degenerate bases. Four nucleotides of the previously designed primer COL6b (5´-ACAAATCATAAAGATATYGG-3´) (Schubart and Huber, 2006) were replaced by variable bases to constitute the primer COL6b2. The primers COIAL2o, COIAH2o, and COIAH2m were designed using the software NetPrimer, available at the PREMIER Biosoft International website <http://www.premierbiosoft.com/netprimer>. The others were designed using the Primer-Blast software tool developed at NCBI, which generates target-specific primer pairs (available at <http://www.ncbi.nlm.nih.gov/tools/primer-blast/>) (see Ye et al., 2012 for further details).

Table 1 New primers of cytochrome c oxidase subunit I and the taxonomic groups with successful amplifications showed by pairs of primers. F: forward primer; R: reverse primer. PMT: Primer Melting Temperature; *used with COH6 (Schubart and Huber, 2006). Degenerate bases: Y = C or T, R = A or G, W = A or T. "Turk" is in reference to the past researcher Dr. Michael Türkay who contributed significantly to studies on crustaceans, in especial on freshwater crabs. 

Name Sequence (5'--> 3') Size (bp) PMT (°C) Used PMT (°C) Family Species
COI - Turk2 (F) GGAGCTTGAGCAGGTATAGTAGG 617 59.7 55.0-59.0 Pseudothelphusidae Allacanthos spp., Fredius spp., Ptychophallus spp., Potamocarcinus spp.
COI - Turk1 (R) TAAAATAGGGTCTCCACCCCCAG 61.2
COILCH 1 (F) TCGAGCAGAATTAGGTCAACCAG 584 60.4 58.0-60.0 Portunidae Charybdis hellerii (A. Milne- Edwards, 1867)
COIHCH 1 (R) GYTAAAGAACGGGGTCRCCTC 59.8
COILCH 2 (F) CCAGACACTTTATTTTTGGAGCTTG 651 59.1 52.0-57.0 Portunidae Charybdis hellerii
COIHCH 2 (R) ATGTTGGTAGAGGACGGGGT 60.2
COL6b2 (F)* ACWAAYCAYAAAGAYATYGG 680 54.3 48.0-50.0 Alpheidae Alpheus spp., Synalpheus spp.
Diogenidae Clibanarius antillensis Stimpson, 1859
Pandalidae Plesionika longicauda (Rathbun, 1901)
COIAL1o (F) GAGCTTGAGCCGGAATAGTAGG 606 59.5 48.0-50.0 Sergestidae Acetes americanus Ortmann, 1893, Peisos petrunkevitchi Burkenroad, 1945
COIAH1o (R) CTCCAGCAGGGTCAAAGAAAGA 57.7
COIAL1m (F) GAGCTTGAGCYGGRATAGTAGG 606 62.9 48.0-50.0 Hippolytidae Tozeuma carolinense Kingsley, 1878
Penaeidae Litopenaeus schmitti (Burkenroad, 1936)
COIAH1m (R) CTCCWGCRGGGTCAAAGAAAGA 61.3 Pinnotheridae Clypeasterophilus stebbingi (Rathbun, 1918)
Sergestidae Acetes americanus, Peisos petrunkevitchi
Sicyoniidae Sicyonia spp.
COIAL2o (F) ACGCAACGATGATTATTTTCTAC 712 56.4 38.0-50.0 Alpheidae Alpheus spp., Salmoneus carvachoi Anker, 2007, Synalpheus spp.
Diogenidae Clibanarius antillensis, Paguristes tortugae Schmitt, 1933, Pseudopaguristes calliopsis (Forest and de Saint Laurent, 1968)
Hippolytidae Hippolyte spp., Latreutes spp.
COIAH2m (R) GACCRAAAAATCARAATAAATGTTG 59.8 Munididae Munida spp.
Paguridae Pagurus exilis (Benedict, 1892)
Palaemonidae Leander paulensis Ortmann, 1897, Nematopalaemon schmitti (Holthuis, 1950)
Penaeidae Xiphopenaeus kroyeri (Heller, 1862)
Processidae Processa hemphilli Manning and Chace, 1971
Sergestidae Acetes americanus, Peisos petrunkevitchi
Sicyoniidae Sicyonia spp.
Solenoceridae Pleoticus muelleri (Spence Bate, 1888)
COIAL2o (F) cited above 712 57.7 44.0-46.0 Penaeidae Xiphopenaeus kroyeri
COIAH2o (R) GACCAAAAAATCAGAATAAATGTTG Sergestidae Acetes americanus, Peisos petrunkevitchi
Solenoceridae Pleoticus muelleri

Figure 1 First 750 base pairs of the mitochondrial gene cytochrome c oxidase subunit I showing the primers' alignment region. Blue and green arrows represent the forward and reverse primers, respectively. Numbers above arrows indicate the first nucleotide position where the primers align to the DNA. The dotted line represents 250 base pairs. 

All decapod specimens used for DNA sequencing were preserved in 70-80% ethanol. For each COI amplification, the polymerase chain reaction (PCR) was performed in reactions containing 0.5 µl of AmpliTaq DNA polymerase Thermo Fisher, 1 µl of each primer (20 mM), 2 µl of bovine serum albumin 1%, 3 µl of 10X Taq Buffer [(NH4)2SO4 or KCl], 3 µl of MgCl2 (25 mM), 4 µl of dNTP (5 mM), 4.5 µl of ultrapure water, 5 µl of betaine (5 M) and DNA volume according to extraction quality, with the following thermal cycle: initial denaturing for 2 min at 94°C; pairing for 35-40 cycles [45 s at 94°C, 45 s at 38°C-60°C (see Tab. 1 for details), and 1 min at 72°C]; final extension 10 min at 72°C.

The applicability of these primers was highly satisfactory for the amplification of fragments from 584 to 712 base pairs, given the diversity of species, genera and families used as models (see Tab. 1). These new primers also showed good performance for samples from different populations and geographic regions.

According to this scenario and considering many other projects and publications that are in progress by our team, we are convinced that the new primers presented herein were successful in amplifying the target species and have proven their utility for several studies with different taxa within Decapoda. In addition, these new primers may help in different ways: 1) they have been used and may be useful in future studies to obtain comprehensive phylogenies and/or biogeographical variability of specific target genera and species; 2) to avoid pseudogenes during amplifications, since the occurrence of pseudogenes strongly decreases when using taxon specific (optimized) primers (Schubart, 2009); 3) based on our experience from the data obtained during this research, and pending future tests, we can speculate that some of the present primers can be used for other related genera and species.

Our results evidenced that a successful amplification of the COI region from decapod crustaceans is not always achieved using the universal primers. Therefore, we are happy to share our new findings with the carcinological community. The new primers may contribute to improve the quality and efficiency of molecular markers, aiming to advance the knowledge of evolution of decapod crustaceans and leading to the solution of several systematic issues.

Acknowledgements

This paper is part of the multidisciplinary research project Temático BIOTA-FAPESP, which aims to produce a fine-scale assessment of the marine decapod biodiversity of the State of São Paulo. Financial support for this project was provided by research grants from FAPESP (Temático Biota 2010/50188-8). Additional support came from CAPES(Ciências do Mar II Proc. 2005/2014 - 23038.004308/2014-14). We also acknowledge our individual grants: FLM and MN are under support of Conselho Nacional de Desenvolvimento Científico e Tecnológico - CNPq (PQ 304968/2014-5; 440417/2015-5 and PD 152377/2016-6, respectively); FLC was supported by PhD fellowship from CNPq (140199/2011-0) and "Sandwich" PhD fellowship from CAPES (7711-13-1); MN is grateful to FAPESP (DD 2012/06300-3 and BEPE 2014/14245-8); MT to FAPESP (PD 2011/11901-3); SMS to FAPESP (PD 2014/01632-3); EAS-C to CAPES. We also thank some members of the LBSC for their help during primers tests and anonymous reviewers for their positive comments. Following the example and enthusiasm of our esteemed colleague, Dr. Michael Türkay, in studying various aspects of the taxonomy of decapod crustaceans, the authors are honored to dedicate this contribution on molecular taxonomy for this commemorative edition to him and for this reason we named two of the new primers in honor to him.

References

Folmer, O.; Black, M.; Hoeh, W.; Lutz, R. and Vrijenhoek, R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3(5): 294-299. [ Links ]

Schubart, C.D. 2009. Mitochondrial DNA and Decapod Phylogenies: The Importance of Pseudogenes and Primer Optimization. In: J.W. Martin; K.A. Crandall and D.L. Felder (Eds), Decapod Crustacean Phylogenetics. CRC Press Taylor & Francis Group. Crustacean Issues, 18: 47-65. [ Links ]

Schubart, C.D. and Huber, M.G.J. 2006. Genetic comparisons of German populations of the stone crayfish, Austropotamobius torrentium (Crustacea: Astacidae). Bulletin Français de la Pêche et de la Pisciculture, 380-381: 1019-1028. [ Links ]

Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S. and Madden, T. 2012. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics, 13: 134. [ Links ]

1This article is part of the tribute offered by the Brazilian Crustacean Society in memoriam of Michael Türkay for his outstanding contribution to Carcinology.

2Guest Editor: Célio Magalhães

Received: September 26, 2016; Accepted: November 12, 2016

Corresponding author: Fernando L. Mantelatto E-mail: flmantel@usp.br

Creative Commons License This is an open-access article distributed under the terms of the Creative Commons Attribution License