SciELO - Scientific Electronic Library Online

 
vol.82 issue3Frequency of dermatophytosis in mycological examinations at a general hospital in Porto Alegre, BrazilAntihistaminic-induced gynecomastia in chronic urticaria treatment author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Article

Indicators

Related links

Share


Anais Brasileiros de Dermatologia

On-line version ISSN 1806-4841

An. Bras. Dermatol. vol.82 no.3 Rio de Janeiro May/June 2007

http://dx.doi.org/10.1590/S0365-05962007000300006 

INVESTIGAÇÃO CLÍNICA, EPIDEMIOLÓGICA, LABORATORIAL E TERAPÊUTICA

 

Pesquisa de Mycobacterium leprae em biópsias de mucosa oral por meio da reação em cadeia da polimerase*

 

Molecular detection of Mycobacterium leprae by polymerase chain reaction in oral mucosa biopsy specimens

 

 

Geraldo Gomes dos SantosI; Gilberto MarcucciII; Jayro Guimarães JúniorIII; Leontina da Conceição MargaridoIV; Luiz Heraldo Camara LopesV

ICirurgião-dentista, professor doutor do Departamento de Estomatologia da Faculdade de Odontologia da Universidade de São Paulo - São Paulo (SP), Brasil
IICirurgião-dentista, professor doutor, titular do Departamento de Estomatologia da Faculdade de Odontologia da Universidade de São Paulo - São Paulo (SP), Brasil
IIICirurgião-dentista, professor doutor do Departamento de Estomatologia da Faculdade de Odontologia da Universidade de São Paulo - São Paulo (SP), Brasil
IVMédica, professora doutora do Departamento de Dermatologia da Faculdade de Medicina da Universidade de São Paulo - São Paulo (SP), Brasil
VMédico, diretor do Laboratório de Patologia Molecular e Cirúrgica do Hospital Sírio-Libanês - São Paulo (SP), Brasil

Endereço para correspondência

 

 


RESUMO

FUNDAMENTOS - A hanseníase é endêmica na América do Sul, sendo responsável por 3% do total dos casos mundiais e, particularmente, no Brasil, por 85% dos casos sul-americanos. Seu agente pode ser encontrado na mucosa oral sem qualquer alteração evidente, e apenas testes laboratoriais muito sensíveis podem detectar sua presença.
OBJETIVOS - Determinar se o genoma do Mycobacterium leprae pode ser encontrado pelo teste da PCR em biópsias com punch da mucosa oral de pacientes com hanseníase.
MATERIAL E MÉTODOS - Realizou-se biópsia da mucosa oral normal de sete pacientes com hanseníase multibacilar. Cinco estavam em tratamento durante o estudo, e apenas um, ainda sem tratamento, teve o diagnóstico confirmado pela hematoxilina-eosina e coloração de Fite-Faraco para M. leprae. As peças foram incluídas em parafina e submetidas à PCR para pesquisa de M. leprae.
RESULTADOS - Seis dos sete casos foram positivos para M. leprae, e um para Mycobacterium sp., demonstrando-se alta sensibilidade e especificidade do método.
CONCLUSÃO - A PCR é método rápido, fácil e confiável para a investigação de rotina da infecção por micobactéria, mesmo quando a doença ainda é assintomática. O diagnóstico pode ser obtido a partir de simples biópsia ambulatorial.

Palavras-chave: Diagnóstico bucal; Hanseníase; Mycobacterium leprae; Reação em cadeia da polimerase


ABSTRACT

BACKGROUND - Hansen's disease is endemic in South America, which accounts for 3% of total world cases, and particularly in Brazil, which accounts for 85% of all South American cases. The bacteria can be found in the oral mucosa with no evident signs of infection, and only very sensitive laboratory assays can detect its presence.
OBJECTIVES - The aim of this study was to ascertain if the M. leprae genome can be detected by PCR in small punch biopsy specimens from the oral mucosa of patients with Hansen's disease.
METHODS - The normal oral mucosas of seven multibacillary Hansen's disease patients were biopsied. Five of them were under treatment at the time of the study. Diagnosis of Hansen's disease could be determined by conventional hematoxylineosin and Fite-Faraco staining for M. leprae in only one patient. This patient had not received treatment prior to the time of the biopsy. The paraffin embedded specimens were submitted to PCR for M. leprae.
RESULTS - Six out of seven cases showed positivity for M. leprae, and the remaining case showed positivity for Mycobacterium sp., demonstrating the high sensitivity and specificity of this method.
CONCLUSIONS - PCR is a fast, easy and reliable method for routine investigation of mycobacterial infection, even during nonsymptomatic periods. Diagnosis can be achieved through a simple oral biopsy at an outpatient clinic.

Keywords: Candida; Diagnosis, oral; Leprosy; Mycobacterium leprae; Polymerase chain reaction


 

 

INTRODUÇÃO

A hanseníase (MH) é doença universal, estimando- se a existência de 10 a 15 milhões de doentes em todo o mundo. É endêmica em determinadas regiões, ocorrendo na América do Sul (3% do total mundial) e particularmente no Brasil (85% dos casos sul-americanos) nas regiões Norte, Sudeste, Centro-Oeste e, com menor prevalência, no Nordeste. É o Brasil o segundo país no mundo em número absoluto de doentes, tendo cerca de 803.680 registrados.1

As manifestações clínicas da doença na cavidade bucal são descritas principalmente na forma virchowiana, com extenso infiltrado celular de macrófagos representado por células com abundante citoplasma espumoso. O Mycobacterium leprae (ML) pode estar presente na mucosa bucal sem apresentar qualquer alteração morfológica, e somente métodos laboratoriais mais sensíveis detectam sua presença.

Dentre os exames de alta sensibilidade, a reação em cadeia da polimerase (PCR), método da Biologia Molecular, destaca-se pela possibilidade de amplificar ou multiplicar fragmentos ou vestígios de DNA de células, incluídas as bacterianas, permitindo assim sua fácil detecção. Esse método vem sendo aplicado hoje freqüentemente em pesquisas de doenças infecciosas de variada etiologia.2,3 Vários trabalhos que utilizaram a PCR em material colhido da pele,4-12 da mucosa nasal13,14 e do escarro15 de pacientes com MH foram publicados. Os resultados obtidos indicam que o método é seguro e eficaz, tanto no diagnóstico quanto na avaliação do tratamento.

Tendo em vista os trabalhos citados, o objetivo deste estudo foi determinar se o genoma do ML pode ser encontrado por meio do teste da PCR em pequenas peças da mucosa oral de pacientes com o diagnóstico de MH.

 

MATERIAL E MÉTODOS

Foi examinada a mucosa bucal de sete pacientes multibacilares, sendo cinco homens e duas mulheres, com idades entre 21 e 65 anos, com duração da doença variando de dois meses a 20 anos. Após anestesia local, foram realizadas biópsias incisionais em mucosa normal (de palato duro e mole), colhendo-se dois espécimes de cada um por meio de punch de 4mm. Todos os espécimes foram submetidos à PCR, cortes histopatológicos e coloração de Fite-Faraco para verificar a presença de micobactérias.

Desses sete pacientes, cinco estavam sendo submetidos à poliquimioterapia em períodos alternados de 12 a 24 meses, e dois não recebiam medicação durante o estudo, sendo um virgem de tratamento. Os pacientes assinaram consentimento aprovado pelo Comitê de Ética em Pesquisa da Faculdade de Odontologia da Universidade de São Paulo (parecer n. 274/95).

Identificação do genoma de Mycobacterium leprae pela PCR

Extração do DNA

Foram analisadas amostras de tecido suspeito de infecção com M. leprae, fixadas e emblocadas. O DNA foi extraído pela seguinte metodologia: após o tratamento da amostra com xileno e etanol, o material foi ressuspenso em proteinase K (50mM TRIS 8.3 com 200μg/ml de proteinase K) a 37ºC, incubado durante a noite e posteriormente submetido a congelamento em nitrogênio líquido por cinco minutos, seguido de aquecimento da amostra a 98ºC por cinco minutos.

Hance et al.16 demonstraram que há regiões gene-específicas conservadas entre uma variedade de espécies patogênicas; por isso a amplificação do DNA do Mycobacterium pode ser realizada com primers comuns. Em amplificação de fragmentos específicos do gênero micobactéria por PCR, um dos alvos mais utilizados é uma região altamente conservada que codifica uma proteína heat shock de 65 kDa.17 Visando otimizar a sensibilidade e a especificidade do fragmento a ser amplificado, executou-se a PCR em duas etapas (nested PCR, reamplificação), conforme descrito por Cook et al.,6 com modificações. A PCR teve como base a amplificação de um fragmento final de 133 pares de base. Em suma, as seqüências dos primers upstream na primeira etapa foram 5'AAGGAGATCGAGCTGGAGGA3' e 5'AGGCGTTGGTTCGCGAGGG3', e a do primer downstream foi 5'TGATGACGCCCTCGTTGCC3', que produziram dois fragmentos de 310 e 231 pares de base, respectivamente. A segunda etapa foi feita com duas seqüências diferentes, 5'GTCTCAAACGCGGCATCG3' e 5'GTCACCGATGGACTGGTC3', e produziu um fragmento final de 133 pares de base.

Digestão com endonucleases

Dez microlitros do material obtido da segunda amplificação foram digeridos por três enzimas distintas, HhaI (BRL), BstU1 (ou Acc, ou Tha) (New England Biolabs, Beverly, EUA) e Mbo 1 (Mannheim Boeringer, Uptsala, Suécia), por quatro horas, a 37ºC. Os produtos da digestão foram misturados com ficoll e analisados em gel de 8% de poliacrilamida e corados com prata. Tamanhos diferentes das bandas eram esperados. Pelo exame algoritmo dos fragmentos,6 foi possível determinar a maior parte das espécies diferentes de Mycobacterium.

O padrão de restrição de ML foi desenvolvido após verificação do genoma bacteriano no banco genômico do National Cancer Institute (NCI). O sítio de restrição para as enzimas utilizadas foi localizado nas seqüências amplificadas e nos fragmentos finais. Seguindo os cortes, os sítios foram estimados e confirmados com os controles positivos obtidos das amostras cultivadas.

Controles

Como controle positivo da amplificação, foi utilizado material proveniente de duas culturas de micobactérias: uma de M. tuberculosis e uma de M. avium-intracellulare . Ambos os produtos de amplificação tiveram o mesmo tamanho e apresentaram padrões de corte distintos e de acordo com a espécie em questão, conforme o esperado.

 

RESULTADOS

Os sete casos biopsiados em mucosa normal foram submetidos aos exames histopatológicos por hematoxilina-eosina e Fite-Faraco. Todos foram negativos, exceto um (5/1.137), que apresentou quadro histológico de córion com edema, infiltrado inflamatório histiocitário perivascular e filete nervoso espessado, vacuolização de células de Schwann, numerosos bacilos granulosos (2+) em filete nervoso e macrófagos, diagnosticando-se MH multibacilar, virchowiano. Esse paciente era virgem de tratamento.

A análise dos sete casos (1/495, 2/1.133, 3/1.139, 4/1.136, 5/1.137, 6/1.138, 7/1.134) mostrou ausência de corte do material amplificado com a enzima HhaI, e banda única de 120 pares de base com a enzima Tha. Em um dos casos (2/1.133) a enzima HhaI produziu duas bandas, de 40 e 90 pares de base; a enzima HhaI tem o padrão de produzir duas bandas, de 65 e 75 pares de base, para o genoma de M. tuberculosis . Nesse mesmo caso, a enzima Tha produziu fragmento único de 120 pares de base, similar ao padrão dos demais casos, e a enzima Mbo 1 produziu dois fragmentos, de 50 e 70 pares de base. O agente em questão não pôde ser identificado, devendo ser micobactéria atípica; só o seqüenciamento do material amplificado poderia responder a essa questão.

A enzima Mbo 1 produziu corte no material amplificado em todos os casos, gerando duas bandas, uma de 50 e outra de 80 pares de base. Esse achado comprovou ser típico de M. leprae a partir da verificação, no banco genômico do NCI, da seqüência amplificada e da presença de sítio de restrição para Mbo 1 localizado exatamente na região esperada para a produção das bandas descritas.

Dos sete casos processados, seis foram positivos para M. leprae : 1/495, 3/1.139 (não apresentado), 4/1.136, 5/1.137, 6/1.138 (conjuntamente) e 7/1.134 (Figura 1). Um caso (2/1.133) foi positivo para Myicobacterium sp ., conforme a figura 2. Para o caso 6/1.138, a figura 3 mostra análise de restrição com diagnóstico de ML.

 

 

 


 

 

DISCUSSÃO

Desde a publicação do trabalho de Williams et al.,12 outros pesquisadores estudaram a detecção molecular de ML utilizando biópsias de pele.3,4,7,8,10,11,14, 15,18,19 Não foram encontradas na literatura referências sobre aplicação da PCR em mucosa bucal de MH. No presente estudo foi examinado um grupo de sete pacientes - cinco estavam sendo submetidos à poliquimioterapia, e dois não recebiam medicação, sendo um virgem de tratamento. Devido à facilidade e rapidez da PCR, sugere-se que esse procedimento seja incorporado ao programa de rotina de acompanhamento dos pacientes com MH nos ambulatórios de dermatologia e medicina oral.

Nos sete espécimes submetidos ao exame histológico de rotina e à coloração específica de Fite- Faraco foram obtidos resultados negativos em seis casos; o caso positivo (5/1137) apresentou lesão multibacilar em cortes com parafina, mas nenhuma manifestação clínica no momento da realização da biópsia. Surpreendentemente, obteve-se positividade em seis dos sete casos (85,7%) para detecção molecular do ML. Na única exceção, não foi possível definir a espécie envolvida. Isso demonstra a grande sensibilidade do método, que pode, contudo, variar de acordo com o estado de conservação da amostra clínica e o método de extração do DNA. Embora não tenham sido testados espécimes coletados com swab, pode-se presumir que tal método seria igualmente factível. O fato de que um Mycobacterium não classificável tenha sido encontrado em um dos casos pode ser atribuído à contaminação da amostra com espécies saprófitas de Mycobacterium presentes na água de torneira.

 

CONCLUSÃO

O genoma do Mycobacterium leprae foi identificado pela reação em cadeia da polimerase em pequenas peças da mucosa oral de pacientes com o diagnóstico de hanseníase biopsiados pela técnica de punch . A PCR provou ser método rápido, fácil e confiável para a investigação de rotina da infecção por micobactéria, mesmo quando a doença ainda é assintomática. O diagnóstico pode ser obtido a partir de uma simples biópsia ambulatorial.

 

AGRADECIMENTOS

Ao prof. dr. Sérgio S. Silva, da disciplina de Semiologia da Faculdade de Odontologia/USP; à profa. dra Miriam N. Sotto, do Departamento. de Dermatologia da Faculdade de Medicina/USP; às doutoras Kátia Ramos M. Leite e Cristina Aparecida T. S. Mitteldorf, a Elaine Darini e Cláudia M. Carvalho, do Laboratório de Patologia Cirúrgica do Hospital Sírio-Libanês, em São Paulo, pela realização dos exames de PCR; e aos profissionais do Ambulatório de Hanseniologia, do Departamento de Dermatologia do Hospital das Clínicas/USP, e do Centro de Saúde II Tranqüilidade, de Guarulhos, responsáveis pelo atendimento dos pacientes.

 

REFERÊNCIAS

1. State of São Paulo - State Health Department. Leprosy: policies and instructions. São Paulo: Epidemiologic Survey Center; 1992.p.64.        [ Links ]

2. Sampaio S, Kalil J. A diagnostic revolution of infectious diseases. Revista Questão de Saúde. 1996;1:2-5.        [ Links ]

3. Yamashita JT, Maeda SM, Jabur R, Rotta O. Hansen's diesase: new diagnostic methods and resources. An Bras Dermatol. 1996;7:343-9.        [ Links ]

4. Ayliffe PR. Modern sensitive techniques for the detection of Mycobacterium leprae. Int J Lepr Other Mycobact Dis. 1992;60:451-64.        [ Links ]

5. Choi JH, Koh K, Na DS. Detection of Mycobacterium leprae DNA in formalin-fixed, paraffin-embedded samples from multibacillary and paucibacillary leprosy patients by polymerase chain reaction. Int J Dermatol. 1993;32:710-3.        [ Links ]

6. Cook SM, Bartos RE, Pierson CL, Frank TS. Detection and characterization of atypical mycobacteria by polymerase chain reaction. Diagn Mol Pathology. 1994;3:53-8.        [ Links ]

7. Hackel C, Houard S, Portaels F, van Elsen A, Herzog A, Bollen A. Specific identification of Mycobacterium leprae by the polymerase chain reaction. Mol Cell Probes.1990;4:205-10.        [ Links ]

8. Jamil S, Keer JT, Lucas SB, Dockrell HM, Chiang TJ, Hussain R, et al. Use of polymerase chain reaction to assess efficacy of leprosy chemotherapy. Lancet. 1993;342:264-8.        [ Links ]

9. Jamil S, Wilson SM, Hacket M, Hussain R, Stocker NG. A colorimetric PCR method for the detection of M. leprae in skin biopsies from leprosy patients. Int J Lepr Other Mycobact Dis. 1994;62:512-20.        [ Links ]

10. Santos AR, De Miranda AB, Sarno EN, Suffys PN, Degrave WM. Use of PCR mediated amplification of Mycobacterium leprae DNA in different types of clinical samples for the diagnosis of leprosy. J Med Microbiol. 1993;39:298-304.        [ Links ]

11. Wichitwechkarn J, Karnjan S, Shuntawittusettee S, Sornprasit C, Kampirapap K, Peerapakorn S. Detection of Mycobacterium leprae infection by PCR. J Clin Microbiol. 1995;33:45-9.        [ Links ]

12. Williams DL, Gillis TP, Booth RT, Looker D, Watson JD. The use of a specific DNA probe and polymerase chain reaction for the detection of Mycobacterium leprae. J Infect Dis. 1990;162:193-200.        [ Links ]

13. Pattyn SR, Ursi D, Ieven M, Grillone S, Raes V. Detection of Mycobacterium leprae by the polymerase chain reaction in nasal swabs of leprosy patients and their contacts. Int J Lepr. 1993;61:389-93.        [ Links ]

14. van Beers SM, Izumi S, Madjid B, Maeda Y, Day R, Klatser PR. An epidemiological study of leprosy infection by serology and polymerase chain reaction. Int J Lepr Other Mycobacter Dis. 1994;62:1-9.        [ Links ]

15. Rafi A, Donoghue HD, Stanford JL. Application of poly merase chain reaction for the detection of Mycobacterium leprae DNA in specimen from treated leprosy patients. Int J Lepr Other Mycobacter Dis. 1995;63:42-7.        [ Links ]

16. Hance AJ, Grandchamp B, Lévy-Frébault V, Lecossier D, Rauzier J, Bocart D, et al. Detection and identification of Mycobacterium by amplification of Mycobacterium DNA. Mol Microbiol. 1989;3:843-9.        [ Links ]

17. Shinnick TM, Vodkin MH, Williams JC. The Mycobacterium tuberculosis 65-kilodalton antigen is a heat shock protein which corresponds to common antigen and to the Escherichia coli GroeEL protein. Infect Immun. 1988;56:446-51.        [ Links ]

18. Perosio PM, Frank TS. Detection and species identifica tion of mycobacteria in paraffin sections of lung biopsies by the polymerase chain reactions. Am J Clin Pathol. 1993;100:643-7.        [ Links ]

19. Ghossein RA, Ross DG, Salomon RN, Rabson AR. Rapid detection and species identification of mycobacteria in paraffin-embedded tissues by polymerase chain reaction. Diagn Mol Pathol. 1992;1:185-91.        [ Links ]

 

 

Endereço para correspondência:
Geraldo Gomes dos Santos
Av. Prof. Lineu Prestes, 2227
Departamento de Estomatologia / Faculdade de
Odontologia da Universidade de São Paulo
05508 900 - São Paulo - (SP)
Tal./ Fax: (11) 3091-7883 / 6979-1588
E-mail: snina@usp.br

Recebido em 20.07.2006
Aprovado pelo Conselho Consultivo e aceito para publicação em 13.05.2007

 

 

* Trabalho realizado no Laboratório de Ensino e Pesquisa em Análises Clínicas – Universidade Estadual de Maringá – Maringá (PR), Brasil.
Conflito de interesse declarado: Nenhum.