Prevalence of human herpes virus type 1 in epithelial skin cancer

Abstracts

FUNDAMENTOS - O DNA viral pode atuar como oncogene, favorecendo o desenvolvimento de neoplasias, como as linfoides e da pele. Entre esses vírus, encontram-se alguns herpes-vírus humanos. OBJETIVO - Identificar a presença de DNA do herpes-vírus humano tipo 1 em neoplasias epiteliais pré-malignas,malignas e pele normal de indivíduos controle, avaliando seu papel na carcinogênese. MÉTODOS - Identificação, por reação em cadeia da polimerase, do DNA viral do tumor e pele sã de 41 pacientes e comparação com grupo controle, sem neoplasia. Análise estatística: Testes de Fisher e de McNemar. RESULTADOS - O vírus foi identificado em 20 indivíduos sem e em 21 com neoplasia. Destes últimos, 11 o expessaram apenas nas células tumorais. A diferença, entretanto, não foi estatisticamente significante. CONCLUSÕES - Parece não haver relação direta entre o encontro do DNA viral na pele sã e na pele tumoral. Sua presença pode facilitar o desenvolvimento da neoplasia ou apenas coincidir de se localizar onde esta já ocorreu.

Herpes-vírus humano 1; Neoplasias cutâneas; Reação em cadeia de polimerase; Vírus oncogênicos

CLINICAL, EPIDEMIOLOGICAL, LABORATORY AND THERAPEUTIC INVESTIGATION

Prevalence of human herpes virus type 1 in epithelial skin cancer

Sylvia Ypiranga^I; Aparecida Machado de Moraes^II

^IDermatologist. Master in general clinical medicine – Universidade Estadual de Campinas (Unicamp) – Campinas (SP), Brazil

IIDermatologist. Post-doctorate degree in Dermatology – Universidade Estadual de Campinas (Unicamp) – Campinas (SP), Brazil

Mailing Address

ABSTRACT

BACKGROUND - Viral DNA may act as an oncogene, especially in skin and lymphoid organs. This group includes some human herpes virus.

OBJECTIVE - To identify human herpes virus type 1 DNA in pre-malignant and malignant skin samples of epithelial tumors comparing to normal skin to determine its role in carcinogenesis.

METHODS - Forty-one patients with epithelial tumors were submitted to biopsies from tumor and normal skin. The control group comprised 41 biopsies from patients with other dermatoses than cancer. After DNA extraction, polymerase chain reaction was performed to identify 199-bp band. The results were statistically evaluated by Fisher and McNemar tests.

RESULTS – The virus was identified in 20 subjects without cancer and in 21 with skin cancer. From these, 11 expressed it only in tumor cells. This difference was not significant.

CONCLUSION - There seem to be no direct relation between viral findings in normal skin and skin cancer cells. It may act as a promoter or just coexist at the same site where a neoplastic transformation has already occurred.

Keywords: Herpesvirus 1, human; Oncogenic viruses; Polymerase chain reaction; Skin neoplasm

INTRODUCTION

Many viruses may participate in carcinogenesis and have been considered as risk factors for the development of neoplasms of different organs, especially skin and lymphoid tumors. ^{1, 2, 3, 4}

In addition to directly participating in carcinogenesis, viruses are important models and support the understanding of control mechanisms of cell growth.

There are multiple factors involved in the development of neoplasms and within this context, viral DNA may act as oncogenes through some mechanisms: viruses may affect the mechanisms of genetic repair, leading to increase in rate of mutations; secondary inflammatory reactions may induce the formation of neoplasm; continuous replication may affect the physiological mechanisms of cell control and, finally, the virus may act directly on the carcinogenesis as inducer of mutations, disappearing after it without leaving any traces ^{2, 5, 6}.

The viral infection has to precede the neoplasm and then become latent for a period, so that a cell transformation into cancer can be confirmed ⁶.

Human papilloma virus (HPV) has been studied and its role in the origin of genital-urinary cancer and skin tumors present in verruciform epidermodysplasia are well established ^{5, 7, 8, 9, 10}.

It is believed that about 15% of the neoplasms are of viral origin ¹¹. In addition to HPV, other viruses are described as oncogenes, such as hepatitis C virus and some other human herpes virus (HHV) ¹².

The characteristics of HHV are alternate cycles of latency and lytic state. The relation between some of them and neoplasms has been well established, such as in the case of Epstein-Barr virus (EBV) and HHV type 8. ,¹⁴ Other HHV have already been related to some specific neoplasms with different levels of significance (Chart 1) ^{14, 15}. Even though there is no experimental confirmation of oncogene of HHV type 1 (HHV1) on the skin, some evidences have suggested its participation in skin neoplasms, acting as co-carcinogenic agent in inactivation of tumor suppressant genes, interfering in the cell cycle and in DNA repair mechanisms. ²

Some authors have described its clinical role in oral carcinoma, epidermoid cutaneous carcinoma, fungoid mycosis, head and neck carcinoma and cervical carcinoma ⁶.

The present study was developed to check the presence of HHV1 on the skin of patients with pre-malignant and malignant epithelial skin tumors and on the normal skin of control subjects and to observe their impact on cutaneous pathogenesis.

MATERIAL AND METHOD

It was a prospective non-randomized, descriptive comparative study.

In the study group (SG) – named malignant epithelial skin neoplasm group – 41 patients with skin tumors and pre-neoplastic lesions of epithelial origin, such as squamous cell carcinoma (SCC), basal cell carcinoma (BCC) and actinic keratosis (AK), were included. Samples of skin were collected from the affected skin and healthy areas.

The control group (CG) comprised 41 skin biopsies of patients with non-neoplasm dermatoses, who had undergone dermatological surgery for any reason but neoplasm.

All patients signed the informed consent term, previously approved by the Research Ethics Committee of the institution, before joining the study.

Fragments collected for biopsy were frozen and stored at -80º C until the final extraction of DNA, which was made according to the proteinase technique K/phenol/chloroform/ethanol, at Cancer Molecular Genetics Laboratory, Unicamp.

For the molecular study, we used two primers (Invitrogen Brasil®):

sense = 5' TGCTCCTACAACAAGTCTCTGGG 3'

antisense = 5' CGGTGCTCCAGGATAAACTGTG 3'

They amplified the glycoprotein D (gD) of the viral envelope of HHV.

With this sequence of olygonucleotides, polymerase chain reactions (PCR) were performed according to the conventional methodology, at Laboratory of Rheumatology, Unicamp.

PCR is considered positive for DNA of HHV1 if there is a band of 199 pair of bases (PB), in the presence of positive and negative controls.

The statistical analysis was based on the differences between presence or not of HHV1 on the DNA samples collected from the skin. Fisher's test was expanded to check the differences in the distribution of a categorized characteristic as a result of another categorized one. The comparison of positivity among the damaged and the normal tissue was defined by McNemar test for related samples.

The level of significance adopted for the statistical tests was 5%.

RESULTS

The SG comprised 21 men and 20 women, mean age over 51 years (64%).

There was predominant development of epithelial neoplasms among light skin people, especially with Fitzpatrick phototypes 1, 2 and 3, over the others (87%).

The CG was formed by patients from the same Dermatology Outpatient Unit, Hospital e Maternidade Celso Pierro – Pontifícia Universidade Católica de Campinas, and included patients of other dermatoses. It comprised 19 men and 22 women, aged 18 to 70 years, most with light-colored skin (64%).

HHV1 was identified in 21 patients of the SG, among the tumor and healthy skin subgroups, and in 20 patients of the CG.

To compare the control and study group, we considered the normal skin samples that were common to both groups. Thus, HHV1 was present in 10 samples of healthy skin of SG and in 20 of the CG, being p = 0.038 (Table 1).

In the SG, comparing the skin affected by the neoplasm and the apparently healthy skin sample, DNA of HHV1 was identified in 17 of the tumor biopsies samples and in 10 normal skin biopsies, but there was no statistically significant difference between the two subgroups (Table 2).

Despite being insignificant, there was greater identification of HHV1 (13%) between SCC and KA, both of spindle cell origin, in comparison to BCC (4%).

There was also a non-representative subgroup, included in the SG, of six subjects chemically immunesuppressed, all renal transplanted cases. They were part of the population seen as outpatient and referred to elective surgery. Because it was a small group, it was maintained as part of the SG. HHV1 DNA was detected in all samples of these patients' tumors, without specific correspondence with the lesion-free tissue.

DISCUSSION

HHV1 infection is one of the most prevalent in the population. It is a recurrent infection characterized by periods of latency. It may affect any part of the skin, but it is predominantly described in areas exposed to sunlight. In vitro, some assays show that this virus may determine genetic modifications and lead to cancer ^{18, 19}.

As to viral oncogenesis, in general, much is known about the participation of some viruses in carcinogenesis, which has been demonstrated in several neoplasms. Some of them may be represented by genital urinary tract carcinomas, lymphomas, and oral neoplasms. In skin tumors, the most intimately related with viral infection in the literature are Kaposi's sarcoma and those related with genetic diseases, such as xeroderma pigmentosum and EV ^{20, 21}.

There is no experimental confirmation of oncogenes of HHV1 on the skin, even though there is evidence of viral transformation by ultraviolet radiation ^{22, 23}.

At the same time, epithelial neoplasms such as SCC, BCC and AK also affect the areas most exposed to sunlight. It is known that ultraviolet radiation may affect the DNA and this error may be overseen by repair mechanisms, enabling the development of skin cancer. Moreover, there are some genes, such as the one that codifies p53 protein and the patched gene, important markers of induction of ultraviolet radiation neoplasm, that may suffer mutations ²⁴.

In face of the representative sample for comparison purposes, it was necessary to use a similar parameter between the studied and the control groups, which in our case, was normal skin samples. Therefore, we could demonstrate in the present study the significant presence of HHV1 on the normal skin of subjects that did not have skin neoplasms compared to the healthy skin of those with neoplasms.

Conversely, among the 21 patients in the studied group that expressed HHV1 in any of the collected samples, most were in the tumor tissue (17), and in 11 it was exclusively on the tumor site.

In view of that, we can not know whether viral cluster would facilitate the development of neoplasm or whether it would be a coincidence finding HHV1 precisely on the site where there was neoplastic transformation.

Thus, it does not seem to be a direct relation between HHV1 DNA found in healthy and tumor skin samples.

The distribution of histological patterns of tumors identified by the present study was made in a way that spindle cell line tumors (SCC and AK) more frequently expressed HHV1 when compared to BCC. Even though SCC is not the most prevalent type in Brazil, its predominance in the present study might be explained by the fact that the studied group was formed by patients with major lesions, undergoing surgery, who had provided enough material for the study without hindering the diagnosis and treatment. This group was basically formed by SCC.

There were two other facts that were not statistically confirmed but are considered to be of clinical relevance.

Patients who had HHV1 positive tumors had markedly aggressive behavior from the clinical perspective. Even though such procedure had not been provided by the methodology, upon reviewing the charts of these patients, we noticed that there was history of multiple tumors, with high rate of recurrence, resistance to treatment and need for hospitalization. These data were not statistically analyzed.

Claudy et al. identified HHV1 in cells of clinically aggressive, recurrent and difficult to manage SCC ²⁵. Future studies might confirm this statement and even correlate it to the presence of the virus on the skin.

In a small group of patients submitted to renal transplantation there was HHV1 DNA in tumor biopsies, but not on the tumor-free skin.

The fact that chemically induced immunesuppression may facilitate viral infection onset is a given. Six months after the transplantation, most subjects developed some virosis, especially HHV1, which agreed with changes to serological profile ²⁶.

This group of renal transplanted patients is known for having high rate of skin neoplasms, which is justified by the decrease in immunosurveillance mechanisms induced by chemical suppression ^{27, 28}.

In a recent study, Wilkins et al. described the multiple relations between malignant skin neoplasms and the disease caused by human immunodeficiency virus, reinforcing the correlation between virus, cancer and immunesuppression. The authors have stated that the presence of the virus is necessary, but not sufficient to cause the neoplasm. It probably means that the mechanism should also involve some genetic susceptibility or environmental exposure ²⁹.

CONCLUSION

HHV1 was identified as having high prevalence in the two studies groups.

Even though there was no direct correlation of cause between presence of HHV1 on apparently healthy skin and development of malignant epithelial neoplasm, we should consider the possible participation of the virus on a multifactorial context on skin oncogenesis.

REFERENCES

• 1. Biliris KA, Koumantakis E, Dokianakis DN, Sourvinos G, Spandidos DA. Human papillomavirus infection of non-melanoma skin cancers in immunocompetent hosts. Cancer Lett. 2000;161:83-8.
• 2. Butel JS. Viral carcinogenesis: revelation of molecular mechanisms and etiology of human disease. Carcinogenesis. 2000;21:405-26.
• 3. Chan PK, Chan MY, Li WW, Chan DP, Cheung JL, Cheng AF. Association of human herpesviruses with the development of cervical cancer: by standers or cofactors. J Clin Pathol. 2001;54:48-53.
• 4. Rady PL, Yen A, Rollefson JL, Orengo I, Bruce S, Hughes TK, et al. Herpesvirus like DNA sequences in non-Kaposi's sarcoma skin lesions of transplant patients. Lancet. 1995;345:1339-40.
• 5. Orth G. Epidermodysplasia verruciformis: a model for understanding the oncogenicity of human papillomaviruses. Ciba Found Symp. 1986;120:157-74.
• 6. Rapp F, Reed CL. The Viral Etiology of cancer. Cancer. 1977;40:419-29.
• 7. Yuspa SH. The pathogenesis of squamous cell cancer: lessons from studies of skin carcinogenesis. J Dermatol Sci. 1998;17:1-7.
• 8. Meyer T, Arndt R, Christophers E, Stockfleth E. Frequency and spectrum of HPV types detected in cutaneous squamous-cell carcinomas depend on the HPV detection system: a comparison of four PCR assays. Dermatology. 2000;201:204-11.
• 9. Majewski S, Jablonska S. Human papillomavirus-associated tumors of the skin and mucosa. J Am Acad Dermatol. 1997;36:659-85.
• 10. Majewski S, Jablonska S. Do epidermodysplasia verruciformis human papillomaviruses contribute to malignant and benign epidermal proliferation? Arch Dermatol. 2002;138:649-54.
• 11. Vousden KH, Farrel PJ. Viruses and human cancer. Br Med Bull. 1994;50:560-81.
• 12. Zafiropoulos A, Tsentelierou E, Billiri K, Spandidos DA. Human herpes viruses in non-melanoma skin cancers. Cancer Lett. 2003;198:77-81.
• 13. Niedobitek G, Meru N, Delecluse HJ. Epstein-Barr vírus infection and human malignancies. Int J Exp Path. 2001;82:149-70.
• 14. Nishimoto S, Inagi R, Yamanishi K, Hosokawa K, Kakibuchi M, Yoshikawa K. Prevalence of human herpesvirus 8 in skin lesions. Br J Dermatol. 1997;137:179-84.
• 15. Nagore E, Ledesma E, Collado C, Oliver V, Perez-Perez A, Aliaga A. Detection of Esptein-Barr vírus and human herpesvirus 7 and 8 genomes in primary cutaneous T- and B-cell lymphomas. Br J Dermatol. 2000;143:320-3.
• 16. Mitchell OS, Espy MJ, Smith TF. Laboratory diagnosis of central nervous system infection with herpes simplex virus by PCR performed with cerebrospinal fluid specimens. J Clin Microbiol. 1997;35:2873-77.
• 17. Fleiss JL. Statistical Methods for rates and proprotions. 2nd ed. Nova Iorque: John Wiley and sons Inc; 1981. p. 38-46.
• 18. Abrahams PJ, van der Kleij AA, Schouten R, van der Eb AJ. Absence of induction of enhanced reactivation of herpes simplex virus in cells from xeroderma pigmentosum patients without cancer. Cancer Res. 1998;48:6054-7.
• 19. Hollinshead AC, Chretien PB, Lee OB, Tarpley JL, Kerney SE, Silverman NA. In vivo and in vitro measurements of the relationship of human squamous carcinomas to herpes simplex virus associated antigens. Cancer Res. 1976;36:821-8.
• 20. Geraminejad P, Memar O, Arason I, Rady PL, Hengge U, Tyring SK. Kaposi's sarcoma and other manifestation of human herpesvirus 8. J Am Acad Dermatol. 2002; 47:641-5.
• 21. Dreno B, Clerier P, Fleischmann M, Bureau B, Litoux P. Presence of Epstein-Barr virus in cutaneous lesions of mycosis fungoides and Sezary syndrome. Acta Derm Venereol. 1994;74:355-7.
• 22. Stock C, Guillen-Grima F, de Mendoza JH, Marin- Fernandez B, Aguinaga-Ontoso I, Kramer A. Risk factors of herpes simplex type 1 (HSV-1) infection and lifestyle factors associated with HSV-1 manifestations. Eur J Epidemiol. 2001;17:885-90.
• 23. Darai G, Munk K. Neoplastic transformation of rat embryo cells with Herpes Simplex Virus. Int J Cancer. 1976;18:469-81.
• 24. Lacour JP. Carcinogenesis of basal cell carcinomas: genetics and molecular mechanisms. Br J Dermatol. 2002;146(Suppl 61):S17-9.
• 25. Claudy AL, Chignol MC, Chardonet Y. Detection of herpes simplex virus DNA in a cutaneous squamous cell carcinoma by in situ hybridization. Arch Dermatol Res. 1989; 281:333-5.
• 26. Matas AJ, Simmons RL, Najarian JS. Chronic Antigenic stimulation, herpesvirus infection and cancer in tranpalt recipients. Lancet. 1975;7:1277-9.
• 27. Jong-Tieben LM, Berkhout RJM, Schegget JT, Vermeer BJ, de Fijter JW, Bruijn JW, et al. The prevalence of human papillomavirus DNA in benign keratotic skin lesions of renal transplant recipients with and without history of skin cancer is wqually high: a clinical study to assess risk factors for keratotic skin lesions and skin cancer. Transplantation. 2000;69:44-9.
• 28. Hofbauer GFL, Dummer R, Hafner J, Burg G, Binswanger U, Kempf W. Skin cancer in organ transplant recipients: two cases of virus-induced neoplasms. Dermatology. 2001;202:359-61.
• 29. Wilkins K, Turner R, Dolev JC, LeBoit PE, Berger TG, Maurer TA. Cutaneous malignancy and human immuno deficiency virus disease. J Am Acad Dermatol. 2006;54:189-206.

*

Trabalho realizado na Universidade Estadual de Campinas (Unicamp) – Campinas (SP), Brasil.

Conflito de interesse: Nenhum: Suporte financeiro: Fundação de Auxilio à Pesquisa – FAEP – Unicamp, Termo 519.294.

Publication Dates

• Publication in this collection
  03 June 2009
• Date of issue
  Apr 2009

History

• Received
  29 June 2007
• Accepted
  06 Mar 2009