SciELO - Scientific Electronic Library Online

vol.84 issue4Acne in women: clinical patterns in different age-groupsPrevalence of hyperhidrosis in the adult population of Blumenau-SC, Brazil author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand




Related links

  • On index processCited by Google
  • Have no similar articlesSimilars in SciELO
  • On index processSimilars in Google


Anais Brasileiros de Dermatologia

Print version ISSN 0365-0596On-line version ISSN 1806-4841

An. Bras. Dermatol. vol.84 no.4 Rio de Janeiro July/Aug. 2009 



Polimorfismo Val247Leu do gene β2-glicoproteína 1 pode justificar a gênese de anticorpos antiβ2GP1 e síndrome do anticorpo antifosfolípide na hanseníase multibacilar*



Maria José Franco BrochadoI; Margarida Maria Passeri do NascimentoII; Paulo Louzada JuniorIII; José Fernando C. FigueiredoIV; Ana Maria RoselinoV

IBiomédica, mestre em ciências médicas e doutoranda em ciências médicas (bolsista Capes), Faculdade de Medicina de Ribeirão Preto (USP) – São Paulo (SP), Brasil
IIBiomédica, Laboratório de Sorologia, Hospital das Clínicas, Faculdade de Medicina de Ribeirão Preto (USP) – São Paulo (SP), Brasil
IIIProfessor doutor, Divisão de Imunologia, Departamento de Clínica Médica, Faculdade de Medicina de Ribeirão Preto (USP) – São Paulo (SP), Brasil IVProfessor doutor, Divisão de Moléstias Infecciosas, Departamento de Clínica Médica, Faculdade de Medicina de Ribeirão Preto (USP) – São Paulo (SP), Brasil
VProfessora-associada, Laboratório de Biologia Molecular, Divisão de Dermatologia, Departamento de Clínica Médica, Faculdade de Medicina de Ribeirão Preto (USP) – São Paulo (SP), Brasil

Endereço para correspondência




FUNDAMENTOS - Anticorpos antifosfolípides (AAF), como antiβ2GP1 (β2-glicoproteína 1), são descritos na hanseníase multibacilar (MB) sem, contudo, caracterizar a síndrome do anticorpo antifosfolípide (SAF), constituída por fenômenos tromboembólicos (FTE). A mutação Val247Leu no V domínio da β2GP1 – substituição da leucina por valina – expõe epítopos crípticos com consequente formação de anticorpos antiβ2GP1.
OBJETIVO: Avaliar a associação do polimorfismo Val247Leu do gene β2GP1 com títulos de anticorpos antiβ2GP1 na hanseníase.
MÉTODO: O polimorfismo Val247Leu foi detectado por PCR-RFLP, e os títulos de anticorpos antiβ2GP1, por Elisa.
RESULTADOS: O genótipo Val/Val estatisticamente predominou no grupo de hansênicos, em relação ao controle. Embora maiores títulos de anticorpos antiβ2GP1 IgM estivessem alocados no grupo MB com genótipos Val/Val e Val/Leu, não houve diferença estatística em relação ao genótipo Leu/Leu. Dos sete pacientes MB com FTE, quatro apresentaram heterozigose, e três Val/Val homozigose.
CONCLUSÃO: A prevalência do genótipo Val/Val no grupo de hansênicos pode justificar parcialmente a presença de anticorpos antiβ2GP1 na forma MB. A heterozigose ou homozigose Val/Val nos sete pacientes com hanseníase MB e FTE corroboram a implicação de expressão fenotípica anômala da β2GPl e formação de anticorpos antiβ2GPl, com consequente FTE e SAF.

Palavras-chave: Anticorpos antifosfolípides; Beta2-glicoproteína I; Hanseníase; Polimorfismo genético




A hanseníase, causada pelo bacilo Mycobacterium leprae, é endêmica nos países subdesenvolvidos e em desenvolvimento,1 sendo o Brasil o que apresenta maior prevalência da doença.2

As formas clínicas da hanseníase são atribuídas à resposta individual imunológica do hospedeiro frente ao bacilo M. leprae. Essas formas clínicas, conhecidas como polares, são classificadas em: hanseníase tuberculóide no pólo Th1 de imunorresistência do indivíduo, quando apresenta pequeno número de lesões ou acometimento neural isolado e resposta celular positiva à intradermorreação de Mitsuda (IRM), e não se encontram bacilos nas lesões cutâneas ou nervos; e hanseníase virchowiana (HV), quando apresenta numerosas lesões, resposta humoral exacerbada, IRM negativa e numerosos bacilos nas lesões e nervos, constituindo o polo imune não responsivo ao bacilo. Na forma interpolar, ou hanseníase dimorfa, estão os indivíduos reatores fracos à IRM, com lesões numerosas e comprometimento neural assimétrico. 3

A hanseníase, como infecção crônica, pode cursar com a presença de anticorpos antifosfolípides (AAF), principalmente na forma multibacilar (MB).4 Os AAF representam família de imunoglobulinas IgG ou IgM, e, menos frequentemente, IgA, que reagem contra proteínas plasmáticas ligadas a fosfolipídios ou somente contra fosfolipídios de carga negativa.5 Os AAF são constituídos por anticorpos anticardiolipina (ACA), inibidor lúpico (IL) e anticorpos antiβ2GP1 (β2- glicoproteína 1). Altos títulos de AAF estão associados à síndrome do anticorpo antifosfolípide (SAF), quer primária, quer secundária a doenças autoimunes, em particular, o lúpus eritematoso sistêmico (LES). A SAF caracteriza-se clinicamente por fenômenos tromboembólicos (FTE) e perdas fetais recorrentes.6 Na hanseníase, embora AAF estejam presentes, a SAF não é comumente descrita.7 Entretanto, em 1996, Bakos et al. indagaram se o fenômeno de Lúcio poderia representar manifestação de SAF.8

A β2GP1, também conhecida como apolipoproteína H, é glicoproteína de cadeia simples, produzida no fígado e na placenta, composta por sequência de 326 aminoácidos, com peso molecular de 50kDa.9 A β2GP1 liga-se a superfícies de cargas negativas, incluindo DNA, membranas celulares, células endoteliais, macrófagos e fosfolipídios ácidos. O V domínio da β2GP1 tem sido sugerido como o sítio de ligação para fosfolipídios.10 Essa glicoproteína exerce atividade anticoagulante e pró-coagulante.11

A mutação no códon 247 do exon 7 do gene que expressa a β2GP1 ocasiona a alteração do aminoácido leucina (Leu) para valina (Val) no V domínio da β2GP1,12 resultando em alteração da expressão da estrutura espacial da proteína e, ao serem expostos epítopos crípticos, pode haver formação de anticorpos antiβ2GP1 em pacientes com SAF.13 A interferência de AAF na interação fisiológica da β2GPI com fatores de coagulação constitui possível mecanismo patogênico para a ocorrência de trombose na SAF.11

Nos últimos anos, foram diagnosticados sete pacientes com hanseníase na forma MB com FTE, constituindo SAF.14

O objetivo deste estudo foi avaliar a distribuição do polimorfismo Val247Leu do gene β2GP1 e sua correlação com títulos de anticorpos antiβ2GP1 em pacientes hansênicos.



População de estudo

Após aprovação do Comitê de Ética em Pesquisa do Hospital das Clínicas da Faculdade de Medicina de Ribeirão Preto (HC-FMRP), Universidade de São Paulo (USP) (Processos n. 9.916/2005 3.605/2006), e consentimento obtido dos pacientes, foram selecionados 113 hansênicos: 85 classificados como forma MB [21 mulheres (idade média: 46 anos) e 64 homens (idade média: 51 anos), nas formas clínicas dimorfa (D), dimorfo-tuberculoide (DT), dimorfovirchowiana (DV) e virchowiana (V)], incluindo-se nesse grupo sete pacientes apresentando FTE e SAF; e 28 como paucibacilares (PB) [12 mulheres (idade média: 44 anos) e 16 homens (idade média: 49 anos), nas formas clínicas tuberculóide (T) e DT].15 Consideraram-se PB aqueles pacientes que não apresentavam bacilos à baciloscopia de linfa e à biópsia de pele ou de nervo, assim como aqueles da forma DT com número de lesões ≤ 5. O grupo-controle foi constituído por indivíduos doadores de sangue, do Banco de Sangue do Hemocentro – HC-FMRP-USP, da mesma região, pareados de acordo com idade, sexo e raça. Dos 113 pacientes e 113 controles foram coletadas amostras de sangue para extração de DNA, assim como 99 amostras de soro de pacientes hansênicos para quantificação de anticorpos antiβ2GP1.

Polimorfismos do gene β2GP1

A extração de DNA genômico, do sangue periférico, foi realizada pela técnica Salting-out.16 O polimorfismo Val247Leu foi detectado por PCR-RFLP (polymerase chain reaction – restriction fragment lenght polymorphism). Foram utilizados primers específicos (sense: 5'GTGTAGGTGTACTCATCTACTGT3' e antisense: 5'CTCTCCTTGGTACACCACAGTGG3'), que amplificam um fragmento de 147pb da região do exon 7 do gene β2GP1. As reações de PCR foram realizadas segundo Kamboh et al., 2004.17 Para a identificação do ponto mutacional, o produto amplificado de 147pb foi digerido com a enzima RsaI (New England Biolabs), a 37ºC, overnight.12 Os produtos digeridos foram submetidos à eletroforese vertical em gel de poliacrilamida 10% não desnaturante, por duas horas e 30 minutos, a 200V; e visualizados após coloração por nitrato de prata.18

Elisa para quantificação de anticorpos antiβ2GP1

As dosagens séricas de anticorpos antiβ2GP1 foram realizadas pelo teste imunoenzimático Elisa, utilizando- se kits comerciais [Quanta LiteTM β2GPI IgM, e Quanta LiteTM β2GPI IgG (Inova Diagnostics, USA)].19

Análise estatística

Para a distribuição da prevalência genotípica do polimorfismo Val247Leu entre os grupos utilizou-se o teste exato de Fisher ou X2. Para a comparação dos títulos de anticorpos antiβ2GP1 segundo os genótipos, nos grupos MB e PB, utilizou-se o teste de Kruskall- Wallis, seguido pela comparação múltipla de Dunn.



O polimorfismo genético Val247Leu foi avaliado em 85 pacientes MB, 28 PB, e 113 indivíduos sadios. A distribuição dos genótipos resultou significativa quando se compararam os grupos de pacientes com hanseníase e controles. A prevalência de homozigose – genótipos Val/Val e Leu/Leu – foi maior no grupo de hansênicos em relação à do grupo-controle. Embora houvesse maior predomínio de heterozigose (Val/Leu) no grupo MB, não foi significante quando comparado ao grupo PB (Tabela 1). Com relação aos sete pacientes MB com FTE, quatro apresentaram heterozigose, e três homozigose para o referido polimorfismo. Quando se relacionou o genótipo do polimorfismo Val247Leu com os títulos de anticorpos antiβ2GP1 IgG e IgM, não houve diferença estatística nas amostras estudadas (Gráficos 1 e 2), embora pacientes MB e PB, com genótipos Leu/Val e Val/Val, apresentassem títulos mais elevados de anticorpos antiβ2GP1 IgM quando comparados ao genótipo Leu/Leu. Destaca-se um paciente com fenômeno de Lúcio que apresentou homozigose Val/Val e alto título de anticorpos antiβ2GP1-IgM (255,4 MPL/mL).






A β2GP1 é o principal alvo antigênico para AAF presentes no plasma de pacientes com SAF.20 Essa glicoproteína é membro de uma superfamília de proteínas que controla o sistema complemento ou SCR (short consensus repeat). É caracterizada por cinco SCR, compostos por 60 aminoácidos, também conhecidos como sushi domains.21 Os quatro primeiros domínios (~60 aminoácidos cada) apresentam duas pontes de dissulfeto e estão estruturalmente relacionados, enquanto o V domínio (~84 aminoácidos) é mais variável e possui aminoácidos carregados positivamente (282-287), quatro aminoácidos hidrofóbicos altamente conservados e três pontes de dissulfeto.22 A troca do aminoácido Leu pela Val (códon 247), no V domínio da β2GP1, pode ocasionar modificação estrutural na proteína, ocasionando a produção de anticorpos antiβ2GP1, presentes na SAF,23 e os indivíduos que apresentam homozigose Val247Val possuem maior risco de desenvolver SAF.24, 25

Neste estudo avaliou-se o polimorfismo genético, localizado no códon 247 do exon 7 do gene da β2GP1 em amostra populacional brasileira composta por indivíduos hansênicos e saudáveis. Houve maior prevalência do genótipo Val/Val no grupo de hansênicos, em relação à do grupo controle. Todos os pacientes MB com FTE apresentaram heterozigose ou homozigose (Val/Val), corroborando estudos que atribuem FTE e SAF ao polimorfismo Val247Leu.13,24,25

Alguns estudos têm relacionado a presença desse polimorfismo com AAF em pacientes com SAF, porém os resultados são controversos. Paloma et al. (2007) e Camilleri et al. (2003) reportaram que a presença de anticorpos antiβ2GP1 não está correlacionada com o polimorfismo, enquanto Yasuda et al. (2005) e Prieto et al. (2003) reportaram correlação direta.24-27

Na hanseníase MB, há descrição da presença de AAF, porém a ocorrência da associação com SAF é rara. 13 Até o momento não há relato na literatura da descrição desse polimorfismo com AAF na hanseníase. Neste estudo não se encontrou correlação entre os genótipos do polimorfismo Val247Leu com títulos de AAF, embora pacientes MB e PB, com genótipos Leu/Val e Val/Val, apresentassem títulos mais elevados de anticorpos antiβ2GP1. Alguns dados chamaram a atenção dos autores: dois pacientes PB com títulos altos de anticorpos antiβ2GP1 apresentavam heterozigose e homozigose (Val/Val) do polimorfismo Val247Leu. A revisão dos prontuários desses pacientes confirmou tratar-se de forma tuberculóide, com ausência de bacilos à baciloscopia e biópsia de pele. Como existem controvérsias sobre reação cruzada da proteína β2GP1 com o fosfolipídio da membrana do bacilo M. leprae,4 esses resultados confirmam a especificidade dos anticorpos antiβ2GP1, pois esses pacientes apresentaram altos títulos de anticorpos antiβ2GP1, baixos títulos de anticorpos antiPGL1 (dados não mostrados), na ausência do bacilo.

De forma inédita, a demonstração de maior prevalência da homozigose Val/Val em população hansênica pode justificar parcialmente a presença de AAF na hanseníase MB. A presença de heterozigose ou de homozigose Val/Val nos sete pacientes com FTE e em um paciente com fenômeno de Lúcio corrobora a implicação de expressão fenotípica anômala da proteína β2GP1 e formação de anticorpos antiβ2GP1 com consequente FTE e SAF.



Diante desses resultados, sugere-se a profilaxia do FTE com anticoagulantes para aqueles pacientes com hanseníase MB, que apresentem altos títulos de AAF.



À profa. dra. Norma T. Foss, extensivos ao corpo clínico da Divisão de Dermatologia, responsável pelo Ambulatório de Hanseníase do HC-FMRP-USP.



1. Monot M, Honoré N, Garnier T, Araoz R, Coppée JY, Lacroix C, et al. On the origin of leprosy. Science. 2005;308:1040-2         [ Links ]

2. World Health Organization [homepage on the internet]. Prevalence of Leprosy, Geneva, Switzerland, 2007. [acesso em 01 Jul 2007] Disponível em:         [ Links ]

3. Goulart IM, Goulart LR. Leprosy: diagnostic and control challenges for a worldwide disease. Arch Dermatol Res. 2008;300:269-90         [ Links ]

4. de Larrañaga GF, Forastiero RR, Martinuzzo ME, Carreras LO, Tsariktsian G, Sturno MM, et al. High prevalence of antiphospholipid antibodies in leprosy: evaluation of antigen reactivity. Lupus. 2000;9:594-600         [ Links ]

5. Galli M, Luciani D, Bertolini G, Barbui T. Anti-beta 2-glycoprotein I, antiprothrombin antibodies, and risk of thrombosis in the antiphospholipid syndrome. Blood. 2003;102:2717-23         [ Links ]

6. Shoenfeld Y. Systemic antiphospholipid syndrome. Lupus. 2003;12:497-8         [ Links ]

7. Arvieux J, Renaudineau Y, Mane I, Perraut R, Krilis Sa, Youinou P. Distinguishing features of anti-beta2 glycoprotein I antibodies between patients with leprosy and the antiphospholipid syndrome. Thromb Haemost. 2002;87:599-605         [ Links ]

8. Bakos L, Correa CC, Bergman L, Bonamigo RR, Muller LF. Antiphospholipid antibodies thrombotic syndrome misdiagnosed as Lucio's phenomenon. Int J Lepr Other Mycobact Dis. 1996;64:320-3         [ Links ]

9. Schwarzenbacher R, Zeth K, Diederishs K, Gries A, Kostner GM, Prassl R. Crystal structure of human beta2- glycoprotein I: implication for phospholipids binding and the antiphospholipid syndrome. Embo J. 1999; 18:6228-39         [ Links ]

10. Medhi H, Naqvi A, Kamboh MI. A hydrophobic sequence at position 313-316 (Leu-Ala-Phe-Trp) in the fifth domain of apolipoprotein H (beta2-glycoprotein I) is crucial for cardiolipin binding. Eur J Biochem. 2000; 267:1770-6.         [ Links ]

11. Myakis S, Giannakopoulos B, Krilis SA. Beta 2 glycoprotein I-function in health and disease. Thromb Res. 2004;114:335-46         [ Links ]

12. Steinkasserer A, Dörner C, Würzner R, Sim RB. Human beta-2 glycoprotein I: molecular analysis of DNA and amino acid polymorphism. Hum Genet. 1993;91:401-2         [ Links ]

13. Atsumi T, Tsutsumi A, Amengual O, Khamashta MA, Hughes GR, Miyoshi Y, et al. Correlation between beta 2-glycoprotein I valine/leucine247 polymorphism and anti-beta 2-glycoprotein I antibodies in patients with primary antiphospholipid syndrome. Rheumatology (Oxford). 1999;38:721-3         [ Links ]

14. Roselino AM, Brochado MJF, Chociay MF, Sousa A, Louzada Jr. P, Zago MA. Thrombosis in patients with leprosy in treatment for reaction type 2 with thalidomide is not related to genetic factors of coagulation. In 21st World Congress of Dermatology, 2007; Buenos Aires, Argentina, Book of Abstracts; 2007. p.762         [ Links ]

15. Ridley DS, Jopling WH. Classification of leprosy according to immunity. A five-group system. Int J Lepr Other 16. 1966;34:255-73.         [ Links ]

16. Roselino AM. Biologia molecular aplicada às dermatoses tropicais. An Bras Dermatol. 2008;83:187-203         [ Links ]

17. Kamboh MI, Sanghera DK, Medhi H, Nestlerode CS, Chen Q, Khalifa O, et al. Single nucleotide polymorphisms in the coding region of the apolipoprotein H (beta2-glycoprotein I) gene and their correlation with the protein polymorphism, anti-beta 2 glycoprotein I antibodies and cardiolipin binding: description of novel haplotypes and their evolution. Ann Hum Genet. 2004;68:285-99         [ Links ]

18. Sanguinetti CJ, Dias Neto E, Simpson AJ. Rapid silver staining and recovery of PCR products separate on polyacrylamide gels. Biotechniques. 1994;17:914-21         [ Links ]

19. Iverson GM, Victoria EJ, Cockerill KA, Linnik MD. Advances in understanding what we measure when detecting anticardiolipin autoantibodies. Clin Chim Acta. 2004;343:37-44.         [ Links ]

20. de Laat B, Mertens K, de Groot PG. Mechanism of disease: antiphospholipid antibodies – from clinical association to pathologic mechanism. Nat Clin Pract Rheumatol. 2008;4:192-9         [ Links ]

21. Rand J. Molecular pathogenesis of the Antiphospholipid syndrome. Circ Res. 2002;90:29-37         [ Links ]

22. Mehdi H, Naqvi A, Kamboh MI. A hydrophobic sequence at position 313-316 (Leu-Ala-Phe-Trp) in the fifth domain of apolipoprotein H (beta 2-glycoprotein I) is crucial for cardiolipin binding. Eur J Biochem 2000;267:1770-6.         [ Links ]

23. Loizou S, Singh S, Wypkema E, Asherson RA. Anticardiolipin, anti-beta(2)-glycoprotein I and antiprothrombin antibodies in black South African patients with infectious disease. Ann Rheum Dis. 2003;62:1106-11         [ Links ]

24. Yasuda S, Atsumi T, Matsuura E, Kaihara K, Yamamoto D, Ichikawa K, et al. Significance of valine/leucine247 polymorphism of beta2-glycoprotein I in antiphospholipid syndrome: increased reactivity of anti-beta2-glycoprotein I autoantibodies to the valine247 beta2-glycoprotein I variant. Arthritis Rheum. 2005;52:212–8         [ Links ]

25. Prieto GA, Cabral AR, Zapata-Zuñiga M, Simón AJ, Villa AR, Alarcón-Segovia D, et al. Valine/valine genotype at position 247 of the beta2 glycoprotein I gene in Mexican patients with primary antiphospholipid syndrome: association with anti-beta2 glycoprotein I antibodies. Arthritis Rheum. 2003;48:471–4         [ Links ]

26. Palomo I, Pereira J, Alarcón M, Vásquez M, Pinochet C, Poblete F, et al. Val/Leu247 and Trp/Ser316 polymorphisms in beta 2 glycoprotein I and their association with thrombosis in unselected Chilean patients. Clin Rheumatol. 2007;26:302-7         [ Links ]

27. Camilleri RS, Mackie IJ, Humphries SE, Machin SJ, Cohen H. Lack of association of β2 glycoprotein I polymorphisms Val247Leu and Trp316Ser with antiphospholipid antibodies in patients with thrombosis and pregnancy complications. Br J Haematol. 2003;120:1066-72        [ Links ]



Endereço para correspondência
Ana Maria Roselino
Divisão de Dermatologia – FMRP-USP.
Av. Bandeirantes 3900
CEp: 14049-900 - Ribeirão Preto - SP
Tel./fax: +55.16.36336695

Recebido em 18.08.2008.
Aprovado pelo Conselho Consultivo e aceito para publicação em 08.12.08.



* Trabalho realizado no Hospital das Clínicas da Faculdade de Medicina de Ribeirão Preto (FMRP), Departamento de Clínica Médica, Divisão de Dermatologia, Universidade de São Paulo (USP) – São Paulo (SP), Brasil.
Conflito de interesse: Nenhum
Suporte financeiro: CNPq (proc. n. 400.930/05-6); APH (Associação Paulista contra a Hanseníase – proc. n. 092/2005)
Faepa-HC-FMRP-USP (Fundação de Auxílio ao Ensino, Pesquisa e Assistência)
Como citar este artigo: Brochado MJF, Nascimento MMP, Louzada Jr P, Figueiredo JFC, Roselino AM. Polimorfismo Val247Leu do gene ,2-glicoproteína 1 pode justificar a gênese de anticorpos anti,2GP1 e síndrome do anticorpo antifosfolípide na hanseníase multibacilar. An Bras Dermatol. 2009;84(4):355-9

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License