SciELO - Scientific Electronic Library Online

 
vol.86 issue4Pain evaluation in the cryosurgery of actinic keratosesAn estimate of the cost of treating non-melanoma skin cancer in the state of São Paulo, Brazil author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Article

Indicators

Related links

  • Have no similar articlesSimilars in SciELO

Bookmark


Anais Brasileiros de Dermatologia

Print version ISSN 0365-0596

An. Bras. Dermatol. vol.86 no.4 Rio de Janeiro July/Aug. 2011

http://dx.doi.org/10.1590/S0365-05962011000400004 

INVESTIGATION

 

Comparison between microsatellites and Ml MntH gene as targets to identify Mycobacterium leprae by PCR in leprosy*

 

 

Andrezza Furquim da CruzI; Renata Bazan FuriniII; Ana Maria Ferreira RoselinoIII

IBiomedic, Master's degree in Bioengineering, PhD in Medical Sciences (CAPES Fellow), Ribeirão Preto Faculty of Medicine, University of São Paulo (FMRP-USP), São Paulo (SP), Brazil
IIMD, Specialist in Dermatology, Master's Degree in Clinical Medicine, Attending Physician, Hospital das Clinicas, Ribeirão Preto Faculty of Medicine, University of São Paulo (HC-FMRP-USP), São Paulo (SP), Brazil
IIIMD, PhD, Specialist in Dermatology and Hansenology, Associate Professor and Head of Dermatology Division, Ribeirão Preto Faculty of Medicine, University of São Paulo (FMRP-USP), São Paulo (SP), Brazil

Mailing address

 

 


ABSTRACT

BACKGROUND: The Polymerase Chain Reaction (PCR) technique has been frequently used in the molecular diagnosis of leprosy.
OBJECTIVES: To compare the results of PCR with four pairs of Mycobacterium leprae specific primers as well as to compare these results to multibacillary (MB) and paucibacillary (PB) leprosy according to the WHO operational classification.
METHOD: 28 DNA samples, collected from the frozen skin biopsies and biopsy imprints on filter paper of 23 patients (14 MB and PB 9), were examined for PCR using primers which amplify 131, 151 and 168bp of specific microsatellite regions and a 336 fragment of the Ml MntH (ML2098) gene.
RESULTS: M.leprae bacillus could be detected in 22 (78.6%) of the 28 samples. 9 (45%) of the 20 biopsy samples and 6 (75%) of the 8 imprints were positive to TTC. 7 (35.5%) skin biopsy specimens and 5 (62.5%) imprints were positive to AGT, and 11 (55%) biopsies and 4 (50%) were positive to AGT. 11 (55%) skin biopsies and 4 (50%) imprints were positive to AT. 8(38%) skin biopsies and 5 (62.5%) imprints were positive to the Ml MntH gene. In the MB group, the microsatellites detected the bacillus in 78.5% of the samples, and the Ml MntH gene in 57.1% of the samples, independent of the clinical material. In the PB group 55.5% of samples were positive to the microsatellite primers, while 22.2% were positive to the Ml MntH gene.
CONCLUSIONS: These results show that both the specific regions of microsatellites, as well as the Ml MntH gene fragment can be useful tools for detecting the M. leprae DNA by PCR in frozen skin biopsy samples and filter paper biopsy imprints.

Keywords: Leprosy; Mycobacterium leprae; Microsatellite nepeats, polymerase chain Reaction


 

 

INTRODUCTION

Mycobacterium leprae is a facultative intracellular acid-fast bacillus (AFB) which causes leprosy, a disease that primarily affects the peripheral nerves and skin. Although leprosy is controlled effectively by multidrug therapy (MDT), new cases have been detected in areas of the world where it is still endemic. 1Because the bacillus does not grow in artificial media, identification in clinical samples has been problematic. 2 PCR, a sensitive and specific technique for the identification of M. leprae, has proven to be extremely important for diagnosing leprosy, mainly of the paucibacillary (PB) type, and for identifying highrisk contacts. 3.4 Target sequences for amplification of DNA from M. leprae, such as genes encoding proteins of 65, 36 and 18kDa, and repetitive sequences, have been widely used for the etiological diagnosis of leprosy, and have often proved to be more sensitive and specific than the routinely-used bacilloscopic examination. 3

In our study, four pairs of specific primers for the identification of M. leprae, with three specific primers for accessing microsatellite regions of the bacillus, and one specific to an internal sequence of the ions transporter Ml MntH gene were used in samples taken from patients with leprosy. 4 In this way we set out to determine the results of the PCR with four pairs of primers for identifying the bacillus in samples of skin biopsies and biopsy imprints, and also to compare these results to multibacillary (MB) and paucibacillary (PB) leprosy according to the WHO operational classification.

 

MATERIALS AND METHODS

Samples

We used 28 samples collected from 23 leprosy patients attending the dermatology outpatients clinic of the Hospital das Clinicas, Ribeirão Preto Faculty of Medicine, University of São Paulo (HC-FMRP-USP) from 2002 to 2009. 20 samples of skin biopsies were taken with a 4mm punch and frozen at -80ºC. 8 imprint samples of the dermal portion of the biopsy were collected on filter paper at the same time as the skin biopsies and stored at 4ºC. 14 of the 23 patients belonged to the multibacillary (MB) group, with positive bacilloscopes in lymph samples from the ears, knees and elbows, and in the skin biopsy (11 samples from skin biopsies and 6 imprints), while 9 in the PB group (9 biopsies and 2 imprints 2), had negative sputum smears. With the exception of two biopsy imprint samples, which were collected at the start of MDT for leprosy, the other samples were obtained from treatment naive patients. The study was approved by the HC-FMRP-USP Ethics Committee (Case No. 2609/2006). Samples collected prior to 2006 belong to the Samples Bank of the Multiuse Molecular Biology Laboratory, Department of Clinical Medicine, FMRP-USP, approved by the CEP (registration number 3605/2006).

Extraction of DNA from skin biopsies and biopsy imprints

For DNA extraction, the skin sample was digested with 1.0 mL of 1X digestion buffer [0.1 M Tris pH 8.0, 0.1 M EDTA, 1% SDS, 20 mg / ml proteinase K in PK buffer] at 55ºC, stirred overnight. The following day the PK was inactivated at 95ºC for 10 minutes and a 1:1 mixture of phenol-chloroform was added to the lysate (inverting the tube gently) to a final volume of 1.0 mL. Centrifuged at 14,000 rpm for 2 minutes at room temperature, the supernatant was then transferred to a new tube. 500µL of chloroform was next added, gently inverting the tube, and the sample was centrifuged at 14,000 rpm for 2 minutes at room temperature. The supernatant was transferred carefully to a new tube to prevent aspiration of the white phase separation (proteins) and 1.0 mL of ice cold absolute ethanol was added, the tube gently inverted and brought to -20ºC for 1 hour. The material was then centrifuged at 14,000 rpm for 30 minutes at 4 º C and the supernatant discarded by inversion over filter paper. The sediment was washed in 500µL of ice cold 70% ethanol and the sample again centrifuged at 14,000 rpm for 10 minutes at 4ºC. The supernatant was discarded and the DNA dried by vacuum centrifugation for approximately 15 minutes. The DNA was then redissolved in 50µL of sterile deionized water (H2Odd).

The imprint samples were cut aseptically from the filter paper, soaked in 50ml of H2Odd, incubated at 95º C in a dry bath and stirred for 15 minutes. The supernatant obtained was used directly in the PCR.

PCR

The sequences of the primers used in this study are listed in Table 1. The reagent solutions for the PCR included: 0.25mM of dNTP, 1U of Taq DNA polymerase (InvitrogenTM), 2.0mM of MgCl 2, 1X PCR buffer, 40µM of each primer (Invitrogen TM) and 0.5 g of DNA sample, producing a final volume of 25µL.

For the identification of M. leprae

To identify the M. leprae bacillus in the clinical samples collected from patients we used three pairs of specific primers, encoding regions of the microsatellites TTC, AGT and AT (Young et al., 2004) 4, and a pair of primers that amplify an internal sequence of the manganese transporter Ml MntH of the bacillus. 4 The cycle used for the microsatellite was "Hot Start" PCR. After initial DNA denaturation at 95ºC for 10 minutes the reaction proceeded with 43 cycles consisting of: denaturation at 95ºC for 10 seconds, annealing at 58ºC for 30 seconds, extension at 72ºC for 30 seconds, followed by final extension at 72ºC for 2 minutes.

For amplification of the Ml MntH gene a pair of primers specific to the gene sequence of 336bp of the Ml MntH gene of the M. leprae bacillus was designed for us. Note that this pair of primers does not amplify gene sequences of tissue or human blood since they are specific (GenBank AL583924.1; gi 13093618 consulted). With the aid of the Oligo Explorer, Oligo Analyser 1.1.0 (Copyright (C) 20002002, Teemu Kuulasmaa) and Gene Runner 3.05 (Hastings Software, Inc. Copyright (C),1994), the 1 MntH1 forward primers (5'-3') CGGCTTCACGTCCAGTTTCTTC and reverse MntH2 primers (5'-3') TAAGTGCCCTCGATGTAAGCGG were designed from the complete sequence of the Ml MntH gene (1281 bp), obtained from the Genbank (NC_002677). The annealing temperature used was 60ºC (94ºC for 5 minutes, 30 cycles of 94ºC for 30 seconds, 60º C for 45 seconds, 72ºC for 1 minute, followed by 7 minutes at 94ºC).

We used a Mycobacterium tuberculosis culture sample to control the specificity of the reaction. For the negative control, DNA was excluded from the reaction.

Statistical analysis

The comparison between the groups of the results of the PCRs for the four pairs of primers was carried out by Kappa test. This comparative analysis was done online using the Kappa Calculator [Columbia University, USA], available at: http://people.dbmi.columbia.edu/homepages/chuangj/kappa/cal culator.htm).

 

RESULTS

The results of the PCR performed with DNA extracted from biopsy samples and biopsy imprint with primers for microsatellites and the Ml MntH gene are shown in Figures 1, 2 and 3.

 

 

 

 

 

 

The M. leprae bacillus could be detected in 22 (78.6%) of the 28 samples tested, and 21 (75%) could be detected by all or any of the three microsatellites, and 13 (46.42%) by the primers that amplify the Ml MntH gene of the M. leprae bacillus biological material or belonging group. Of the 20 skin biopsy samples, 9 (45%) were positive for the microsatellite TTC (8 belonging to the MB group and 1 to the PB group), 7 (35%) for the AGT microsatellite (5 samples from the MB group and 2 from the PB group) and 11 (55%) for the AT microsatellite (6 samples from the MB group and 5 from the PB group). Regarding the samples of biopsy imprints, of the 8 samples processed 6 (75%) were positive for the TTC microsatellite, 5 (62.5%) for AGT and 4 (50%) for AT. All the positive samples belonged to the MB group (see Table 2).

Regarding the primers to amplify the gene fragment Ml MntH, of the 20 biopsy samples 10 (50%) were PCR-positive for the gene, with 3 belonging to the PB group. 5 (62.5%) of the 8 imprints of biopsy samples were positive for the gene Ml MntH. No biopsy imprint sample of group PB was positive in the research of the gene MntH (Table 3).

The comparative analysis of the PCRs with primers amplifying microsatellite and the gene Ml MntH was concordant in 14 (50%) samples assayed (K=0.428, P <0.001; CI95% = 0.277 < K < 0.529).

As for the MB group, the performance of the AGT and MntH primers was similar in both in the skin biopsy specimens and in those of the biopsy imprint. The best detection for the MB group in the biopsies and biopsy imprints was obtained with the use of primers that amplify the microsatellite TTC (72.7% and 100%, respectively). PCR with primers that amplify the gene Ml MntH was positive in 45.4% of biopsy specimens and in 5 (83.3%) of the 6 imprint samples tested. The test was reasonably consistent for all primer pairs tested in the skin biopsies (36.4%) (K = 0.290; P = 0.019; CI 95% = 0.049 < K < 0.531), and in 66.7% of the imprint samples (K = 0.411; P = 0.014; CI95% = 0.084 < K < 0.737).

In the PB group, the best performance results were obtained from the primers that amplify the AT microsatellite (44%). The PCR with the pair of primers that amplify the gene Ml MntH was positive in 2 (22%) samples, matching the sensitivity of the primer AGT. The comparison of PCR results with the primers that amplify microsatellite regions and primers that amplify the gene Ml MntH was fairly consistent (22%), according to the classification of Landis and Koch (1997) (K=0.16; P= 0.238, CI95% = -0.106 < K < 0.437).

 

DISCUSSION

No specific and sensitive test is available to date for diagnosing asymptomatic leprosy or to predict the progression of leprosy among exposed individuals. 5 There is an urgent need therefore to find molecular tools not only to differentiate between the mycobacteria but also to identify the M. leprae bacillus in view of the high detection rates of new cases. 1

The purpose of this study was to evaluate the PCR method to detect the M. leprae bacillus in clinical samples of skin biopsy and biopsy imprints. The results of PCR, using specific primers for the microsatellites TTC and AT in samples from the MB group showed a better performance when compared to the Ml MntH gene. The latter,in turn, displayed a similar performance to the AGT primers in this group. Despite there being no significant difference in the statistical correlation between the PCRs of the MB group, 9 of the 11 samples from skin biopsies were positive for 1 or 3 microsatellites, while the pair of primers that amplify the gene Ml MntH was able to detect the presence of bacilli in 5 of the 11 samples tested, one of which was not identified by the primer TTC. Contrary to what occurred in the biopsy specimens, the pair of primers of the Ml MntH gene was able to amplify 5 of 6 biopsy imprint samples, which were positive for the pair of primers TTC, showing better performance than the pair of primers AT, which amplified only 4 of the samples tested.

The diagnosis of leprosy is currently based on clinical examination findings and the detection of AFB (bacilloscopy) in smears obtained from leprosy lesions and other sites selected for collection such as ear lobes, elbows and knees. These results are expressed in bacterial index, which is nowadays considered to be the most accurate, fast and usual quantitative assessment method, for reading of leprosy smears (Ministry of Health/SPS, Brazil). In order to apply the PCR technique for diagnosing leprosy in clinical terms, a careful comparison needs to be made between the results of this test with those obtained by both bacilloscopy of the lymph as well as of the skin biopsy. 6

The diagnostic primers tested in this study were previously used for epidemiological mapping of the M. leprae bacillus in inter alia India, Indonesia and the Philippines. 4,7,8 However, these primers have not been routinely used given the difficulty of obtaining samples of genomic DNA from clinical material. 1

On the other hand the use of repetitive sequences as targets of DNA in the PCR enhances the sensitivity of the test, since these sequences are found in several sites of genomic DNA. 2

In summary, the PCR with primers for microsatellites diagnosed bacilli in 18 of 23 (78.3%) patients, whereas the PCR with primers for the gene Ml MntH was able to diagnose 10 out of 23 (43%) patients. Among the patients in the MB group, the microsatellites detected the bacillus in 11 out of 14 samples (78.5%), and the gene Ml MntH detected the bacillus in 8 out of 14 (57.1% of the samples, independent of the clinical material. The positivity of the PCR for the microsatellites in the biopsy specimens collected from the MB group is similar to that reported for targets such as the gene pra or 16S rRNA, which showed positive values of around 70-80%. However, it was higher than (microsatellites) or equal to ( Ml MntH gene) some studies using RLEP repetitive sequences as a target for diagnosis, which showed 5474% of positivity in the tests. 2, 6,.9-14

In the PB group 5 out of 9 samples (55.5%) were positive for microsatellites while 2 out of 9 (22.2%) were positive for the Ml MntH gene. These biopsy samples had higher positivity compared to the literature. 9, 15, 16

With regard to the biopsy imprint samples from the MB group, the PCR with primers for microsatellites was able to identify the bacillus in 66.7-100% of the specimens, but was not positive for 2 samples from the PB group. These data were higher than those reported for PCR results in lymph samples. 2, 9, 10, 15, 17

 

CONCLUSIONS

This study shows that the primers for microsatellite sequences are more effective for the amplification of DNA samples from skin biopsy than the primers for the gene Ml MntH in the MB group. However, the results were similar with respect to the PB group. These findings suggest that both associated targets could become useful tools for identifying, in clinical samples such as biopsies and frozen biopsy imprints, the bacillus which causes leprosy.

 

REFERENCES

1. Groathouse NA, Brown SE, Knudson DL, Brennan PJ, Slayden RA. Isothermal amplification and molecular typing of the obligate intracellular pathogen Mycobacterium leprae isolated from tissues of unknown origins. J Clin Microbiol. 2006;44:1502-8.         [ Links ]

2. Kang TJ, Kim SK, Lee SB, Chae GT, Kim JP. Comparison of two different PCR amplification products (the 18-kDa protein gene vs. RLEP repetitive sequence) in the diagnosis of Mycobacterium leprae. Clin Exp Dermatol. 2003;28:420-4.         [ Links ]

3. Goulart IM, Cardoso AM, Santos MS, Gonçalves MA, Pereira JE, Goulart LR. Detection of Mycobacterium leprae DNA in skin lesions of leprosy patients by PCR may be affected by amplicon size. Arch Dermatol Res. 2007;299:267-271.         [ Links ]

4. Young SK, Taylor GM, Jain S, Suneetha LM, Suneetha S, Lockwood DN, et al. Microsatellite mapping of Mycobacterium leprae populations in infected humans. J Clin Microbiol. 2004;42:4931-6.         [ Links ]

5. Stefani MM, Guerra JG, Sousa AL, Costa MB, Oliveira ML, Martelli CT, et al. Potential plasma markers of Type 1 and Type 2 leprosy reactions: a preliminary report. BMC Infect Dis. 2009;9:75.         [ Links ]

6. Yoon KH, Cho SN, Lee MK, Abalos RM, Cellona RV, Fajardo TT Jr, et al. Evaluation of polymerase chain reaction amplification of Mycobacterium leprae-specific repetitive sequence in biopsy specimens from leprosy patients. J Clin Microbiol. 1993;31:895-9.         [ Links ]

7. Matsuoka M, Zhang L, Budiawan T, Saeki K, Izumi S. Genotyping of Mycobacterium leprae on the basis of the polymorphism of TTC repeats for analysis of leprosy transmission. J Clin Microbiol. 2004;42:741-5.         [ Links ]

8. Kimura M, Sakamuri RM, Groathouse NA, Rivoire BL, Gingrich D, Krueger-Koplin S, et al. Rapid variable-number tandem-repeat genotyping for Mycobacterium leprae clinical specimens. J Clin Microbiol. 2009;47:1757-66.         [ Links ]

9. de Wit MY, Faber WR, Krieg SR, Douglas JT, Lucas SB, Montreewasuwat N, et al. Application of a polymerase chain reaction for the detection of Mycobacterium leprae in skin tissues. J Clin Microbiol. 1991;29:906-10.         [ Links ]

10. Torres P, Camarena JJ, Gomez JR, Nogueira JM, Gimeno V, Navarro JC, et al. Comparison of PCR mediated amplification of DNA and the classical methods for detection of Mycobacterium leprae in different types of clinical samples in leprosy patients and contacts. Lepr Rev. 2003;74:18-30.         [ Links ]

11. Kurabachew M, Wondimu A, Ryon JJ. Reverse transcription-PCR detection of Mycobacterium leprae in clinical specimens. J Clin Microbiol. 1998;36:1352-6.         [ Links ]

12. Phetsuksiri B, Rudeeaneksin J, Supapkul P, Wachapong S, Mahotarn K, Brennan PJ. A simplified reverse transcriptase PCR for rapid detection of Mycobacterium leprae in skin specimens. FEMS Immunol Med Microbiol. 2006;48:319-28.         [ Links ]

13. Santos AR, Balassiano V, Oliveira ML, Pereira MA, Santos PB, Degrave WM, et al. Detection of Mycobacterium leprae DNA by polymerase chain reaction in the blood of individuals, eight years after completion of anti-leprosy therapy. Mem Inst Oswaldo Cruz. 2001;96:1129-33.         [ Links ]

14. Patrocinio LG, Goulart IM, Goulart LR, Patrocinio JA, Ferreira FR, Fleury RN. Detection of Mycobacterium leprae in nasal mucosa biopsies by the polymerase chain reaction. FEMS Immunol Med Microbiol. 2005;44:311-6.         [ Links ]

15. Wichitwechkarn J, Karnjan S, Shuntawuttisettee S, Sornprasit C, Kampirapap K, Peerapakorn S. Detection of Mycobacterium leprae infection by PCR. J Clin Microbiol. 1995;33:45-9.         [ Links ]

16. Bang PD, Suzuki K, Phoung le T, Chu TM, Ishii N, Khang TH. Evaluation of polymerase chain reaction-based detection of Mycobacterium leprae for the diagnosis of leprosy. J Dermatol. 2009;36:269-76.         [ Links ]

17. Chae GT, Lee SB, Kang TJ, Shin HK, Kim JP, Ko YH, et al. Typing of clinical isolates of Mycobacterium leprae and their distribution in Korea. Lepr Rev. 2002;73:41-6.         [ Links ]

 

 

Mailing address:
Ana Maria Roselino
Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo (FMRP-USP)
Av. Bandeirantes, 3900
14049-900 Ribeirão Preto (SP) - Brazil
E-mail: amfrosel@fmrp.usp.br

Received on 10.04.2010.
Approved by the Advisory Board and accepted for publication on 24.09.10.
Conflict of interest: None
Financial funding Coordinating Bureau for the Improvement of Higher Education Personnel (CAPES); Foundation for the Support of Education, Research and Care (FAEPA) - Hospital das Clinicas, Ribeirão Preto Faculty of Medicine, University of São Paulo (HC-FMRP-USP), São Paulo (SP), Brazil

 

 

* Research conducted at Multiuser Molecular Biology Laboratory, Dermatology Division, Department of Internal Medicine, Ribeirão Preto Faculty of Medicine, University of São Paulo (FMRP-USP), São Paulo (SP), Brazil.