SciELO - Scientific Electronic Library Online

 
vol.86 issue4Pain evaluation in the cryosurgery of actinic keratosesAn estimate of the cost of treating non-melanoma skin cancer in the state of São Paulo, Brazil author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Article

Indicators

Related links

  • Have no similar articlesSimilars in SciELO

Share


Anais Brasileiros de Dermatologia

Print version ISSN 0365-0596

An. Bras. Dermatol. vol.86 no.4 Rio de Janeiro July/Aug. 2011

http://dx.doi.org/10.1590/S0365-05962011000400004 

INVESTIGAÇÃO

 

Comparação entre microssatélites e o gene Ml MntH como alvos para a identificação do Mycobacterium leprae por PCR na hanseníase*

 

 

Andrezza Furquim da CruzI; Renata Bazan FuriniII; Ana Maria Ferreira RoselinoIII

IBiomédica - Mestre em Bioengenharia - Doutora em Ciências Médicas (bolsista Capes), Faculdade de Medicina de Ribeirão Preto - Universidade de São Paulo (FMRP - USP) - São Paulo (SP), Brasil
IIMD - Especialista em Dermatologia - Mestrado em Clínica Médica - Médica- assistente do Hospital das Clínicas da Faculdade de Medicina de Ribeirão Preto - Universidade de São Paulo (HC-FMRP-USP) - São Paulo (SP), Brasil
IIIMD, PhD - Especialista em Dermatologia e em Hansenologia - Professora- associada, chefe da Divisão de Dermatologia da Faculdade de Medicina de Ribeirão Preto - Universidade de São Paulo (FMRP-USP) - São Paulo (SP), Brasil

Endereço para correspondência

 

 


RESUMO

FUNDAMENTOS: PCR tem sido frequentemente utilizada no diagnóstico molecular da hanseníase.
OBJETIVOS: comparar os resultados da PCR com 4 pares de primers específicos para Mycobacterium leprae, bem como os resultados da PCR à classificação operacional, segundo a OMS, de multibacilar (MB) e paucibacilar (PB) da hanseníase.
MÉTODO: Vinte e oito amostras de DNA, extraído de biópsias congeladas de pele e de imprint de biópsias em papel de filtro de 23 pacientes (14 MB e 9 PB), foram utilizadas na PCR com primers que amplificam 131pb, 151pb e 168pb de regiões de microssatélites, e um fragmento de 336pb do gene Ml MntH (ML2098) do bacilo.
RESULTADOS: O bacilo pôde ser detectado em 22 (78,6%) das 28 amostras. Nove (45%) das 20 amostras de biópsia e 6 (75%) das 8 amostras de imprints foram positivas para TTC. Sete (35,5%) amostras de biópsias e 5 (62,5%) imprints foram positivos para AGT, e 11 (55%) biópsias e 4 (50%) imprints foram positivos para AT. Oito (38%) amostras de biópsias e 5 (62,5%) imprints foram positivos para o gene Ml MntH. Dentre o grupo MB, os microssatélites detectaram o bacilo em 78,5% das amostras, e o gene Ml MntH, em 57,1% das amostras, independentemente do material clínico. No grupo PB, 55,5% das amostras foram positivas para os microssatélites, enquanto que 22,2% o foram para o gene Ml MntH.
CONCLUSÕES: Estes resultados mostram que, tanto as regiões específicas de microssatélites quanto o gene Ml MntH, podem representar ferramentas úteis na detecção do Ml MntH por PCR em amostras de biópsias e imprint de biópsias.

Palavras-chave: Hanseníase; Mycobacterium leprae; Reação em cadeia da polimerase; Repetições de microssatélites


 

 

INTRODUÇÃO

Mycobacterium leprae é um bacilo álcool-ácido resistente (BAAR) intracelular obrigatório, patógeno da hanseníase, doença que afeta principalmente os nervos periféricos e a pele. Embora a hanseníase seja controlada efetivamente pela multidrogaterapia (MDT), ainda se têm detectado casos novos em regiões do mundo onde permanece endêmica.1 Devido ao fato de o bacilo não ser cultivado em meios artificiais, a sua identificação nas amostras clínicas tem sido problemática.2 Assim, a PCR mostra-se uma técnica sensível e específica para a identificação de M. leprae, assumindo grande importância no diagnóstico da hanseníase, principalmente na forma paucibacilar (PB) e nos contactantes. 3,4 Sequências alvos para a amplificação do DNA de M. leprae, como os genes que codificam as proteínas de 65, 36 e 18kDa, e sequências repetitivas têm sido as mais utilizadas para o diagnóstico etiológico da hanseníase e, muitas vezes, têm se mostrado mais sensíveis e específicas do que o exame baciloscópico rotineiramente utilizado.3

Neste estudo, 4 pares de primers específicos para a identificação de M. leprae, sendo 3 específicos para regiões de microssatélites do bacilo, e um específico para uma sequência interna do gene transportador de íons Ml MntH, foram utilizados em amostras de pacientes com hanseníase.4 Deste modo, pretendemos determinar os resultados da PCR com os 4 pares de primers para a identificação do bacilo em amostras de biópsias de pele e imprint de biópsias, assim como comparar os resultados da PCR à classificação operacional, segundo a OMS, de multibacilar (MB) e paucibacilar (PB) da hanseníase.

 

MATERIAL E MÉTODOS

Amostras:

Foram utilizadas 28 amostras de 23 pacientes com hanseníase, seguidos no Ambulatório de Dermatologia do Hospital das Clínicas da Faculdade de Medicina de Ribeirão Preto - USP (HC-FMRP-USP), de 2002 a 2009. Dessas, 20 amostras de biópsia de pele foram realizadas com punch 4 mm e congeladas a -80ºC, e 8 amostras de imprint da porção dérmica da biópsia foram coletadas em papel de filtro no mesmo momento da realização das biópsias de pele, e estocadas a 4ºC. Dentre os 23 pacientes, 14 pertenciam ao grupo multibacilar (MB), com baciloscopias positivas em amostras de linfa de orelhas, joelhos e cotovelos, e na biópsia de pele (11 amostras de biópsias de pele e 6 imprints), e 9, ao grupo PB (9 biópsias e 2 imprints), com baciloscopias negativas. Exceto duas amostras de imprint de biópsia, que foram coletadas no início da MDT para a hanseníase, as demais amostras foram obtidas de pacientes virgens de tratamento. O estudo foi previamente aprovado pelo Comitê de Ética do HC-FMRP-USP, processo nº 2609/2006. As amostras coletadas anteriormente a 2006 pertencem ao Banco de Amostras do Laboratório Multiusuário de Biologia Molecular do Departamento de Clínica Médica, FMRP-USP, aprovado pelo CEP sob o registro nº 3605/2006.

Extração do DNA de biópsias de pele e de imprints de biópsias:

Para a extração do DNA, a amostra de pele foi digerida com 1,0 mL de buffer de digestão 1x [0,1M tris pH 8,0; 0,1M EDTA; 1% SDS; 20 mg/mL de proteinase K (PK)], a 55ºC, com agitação, overnight. No dia seguinte, a PK foi inativada a 95ºC por 10 minutos e uma mistura 1:1 de fenol-clorofórmio foi adicionada ao lisado com um volume final de 1,0mL, invertendose o tubo gentilmente. Centrifugou-se a 14.000 rpm por 2 minutos em temperatura ambiente e transferiuse o sobrenadante para um tubo novo. Foram adicionados então 500µL de clorofórmio, o tubo invertido gentilmente e a amostra centrifugada a 14.000 rpm por 2 minutos à temperatura ambiente. O sobrenadante foi transferido cuidadosamente para um tubo novo para evitar a aspiração da fase branca de separação (proteínas) e adicionado 1,0mL de etanol absoluto gelado; o tubo foi invertido gentilmente e levado a -20ºC por 1h. Após este período, o material foi centrifugado a 14.000 rpm por 30 minutos, 4ºC, e o sobrenadante descartado por inversão em papel de filtro. O sedimento foi lavado em 500µL de etanol 70% gelado e a amostra novamente centrifugada a 14.000 rpm por 10 minutos a 4ºC. O sobrenadante foi descartado e o DNA, secado por centrifugação a vácuo por aproximadamente 15 minutos. Após esse período o DNA foi redissolvido em 50µL de água deionizada esterilizada (H2Odd).

As amostras de imprint foram recortadas assepticamente do papel de filtro, embebidas em 50uL de H2Odd, e incubadas a 95ºC em banho seco por 15 minutos sob agitação. O sobrenadante obtido foi utilizado diretamente na PCR.

PCR:

As sequências dos primers utilizadas neste estudo estão relacionadas na tabela 1. A solução de reagentes para a PCR incluiu: 0,25mM de dNTP, 1U de Taq DNA polimerase (InvitrogenTM), 2,0mM de MgCl2, tampão de PCR 1x, 40µM de cada primer (InvitrogenTM), e 0,5 µg da amostra de DNA, perfazendo um volume final de 25µL.

Para a identificação do bacilo M. leprae:

Para identificar o bacilo M. leprae nas amostras clínicas dos pacientes, foram utilizados três pares de primers específicos, que codificam regiões dos microssatélites TTC, AGT e AT (Young et al., 2004)4, e um par de primers que amplifica uma sequência interna do gene transportador de manganês Ml MntH do bacilo.4 O ciclo utilizado para os microssatélites foi de "Hot-Start" PCR. Após a desnaturação inicial do DNA a 95ºC por 10 min, a reação prosseguiu com 43 ciclos constituídos por: desnaturação a 95ºC por 10s, anelamento a 58ºC por 30s, extensão a 72ºC por 30s, seguida por extensão final a 72ºC por 2 min.

Para a amplificação do gene Ml MntH, foi por nós desenhado um par de primers específicos para a sequência de 336pb do gene Ml MntH do bacilo M. leprae. Salienta-se que este par de primers não amplifica sequências gênicas do tecido ou do sangue humano, pois são específicos, segundo consulta ao GenBank AL583924.1; gi 13093618. Com auxílio dos programas Oligo Explorer, Oligo Analyser 1.1.0 (Copyright(C) 2000-2002, Teemu Kuulasmaa) e Gene Runner 3.05 (Hastings Software, Inc. Copyright(c), 1994), os primers forward MntH1 (5'-3') CGGCTTCACGTCCAGTTTCTTC e reverse MntH2 (5' 3') TAAGTGCCCTCGATGTAAGCGG foram desenhados a partir da sequência completa do gene Ml MntH (1281 pb), obtida no Genbank (NC_002677). A temperatura de anelamento utilizada foi de 60ºC (94ºC por 5 min, 30 ciclos de 94ºC por 30s, 60ºC por 45s, 72ºC por 1 min, seguidos por 7 min a 94ºC).

Para o controle da especificidade da reação, utilizou-se amostra de cultura de Mycobacterium tuberculosis. Para o controle negativo, o DNA foi excluído da reação.

Análise Estatística:

A comparação dos resultados das PCRs para os 4 pares de primers entre os grupos foi feita pelo teste Kappa. Esta análise comparativa foi feita on-line com auxílio do software Kappa Calculator, Universidade da Columbia, USA (Disponível em: http://people.dbmi.columbia.edu/homepages/chuangj/kappa/calculator.htm).

 

RESULTADOS

Os resultados da PCR realizada com DNA extraído das amostras de biópsia e de imprint de biópsias com os primers para microssatélites e gene Ml MntH estão mostrados nas figuras 1, 2 e 3.

 

 

 

 

 

 

O bacilo M. leprae pôde ser detectado em 22 (78,6%) das 28 amostras testadas, sendo que 21 (75%) puderam ser detectadas por todos ou algum dos 3 microssatélites, e 13 (46,42%) pelos primers que amplificam o gene Ml MntH do bacilo M. leprae, independentemente do material biológico ou grupo pertencente. Das 20 amostras de biópsia de pele, 9 (45%) foram positivas para o microssatélite TTC (8 pertencentes ao grupo MB e 1, ao grupo PB), 7 (35%) para o microssatélite AGT (5 amostras do grupo MB e 2, do grupo PB), e 11 (55%) para o microssatélite AT (6 amostras do grupo MB e 5, do grupo PB). No que diz respeito às amostras de imprint de biópsias, das 8 amostras processadas, 6 (75%) foram positivas para o microssatélite TTC, 5 (62,5%), para AGT e 4 (50%), para AT. Todas as amostras positivas pertenciam ao grupo MB (Tabela 2).

Em relação aos primers que amplificam o fragmento do gene Ml MntH, das 20 amostras de biópsias, 10 (50%) tiveram a PCR positiva para o gene, sendo que 3 pertenciam ao grupo PB. Cinco (62,5%) das 8 amostras de imprint de biópsias foram positivas para o gene Ml MntH. Nenhuma amostra de imprint de biópsia do grupo PB foi positiva na pesquisa do gene MntH (Tabela 3).

A análise comparativa das PCRs com os primers que amplificam os microssatélites e o gene Ml MntH foi concordante em 14 (50%) amostras testadas (K=0,428, P<0,001; IC95% = 0,277 < K < 0,529).

No que diz respeito ao grupo MB, o desempenho dos primers AGT e MntH foi semelhante tanto nas amostras de biópsia de pele quanto nas de imprint de biópsia. A melhor detecção para o grupo MB nas biópsias e imprint de biópsia foi com a utilização dos primers que amplificam o microssatélite TTC (72,7% e 100%, respectivamente). A PCR com os primers que amplificam o gene Ml MntH foi positiva em 45,4% das amostras de biópsia, e em 5 (83,3%) das 6 amostras de imprints testadas. O teste foi razoavelmente concordante para todos os pares de primers testados nas biópsias de pele (36,4%) (K=0,290; P = 0,019; IC95%= 0,049 < K < 0,531) e em 66,7% para as amostras de imprint (K=0,411; P = 0,014; IC95%= 0,084 < K < 0,737).

Já no grupo PB, o melhor desempenho resultou para os primers que amplificam o microssatélite AT (44%). A PCR com o par de primers que amplificam o gene Ml MntH foi positiva em 2 (22%) amostras, igualando-se à sensibilidade do primer AGT. A comparação dos resultados da PCR com os primers que amplificam as regiões de microssatélites e os primers que amplificam o gene Ml MntH foi razoavelmente concordante (22%), de acordo com a classificação de Landis e Koch (1997) (K=0,16; P=0,238; IC95%= -0,106 < K < 0,437).

 

DISCUSSÃO

Até o momento, nenhum teste específico e sensível está disponível para o diagnóstico da hanseníase assintomática ou para predizer a progressão para a hanseníase entre os indivíduos expostos.5 Assim, a necessidade de se encontrar ferramentas moleculares não só para a diferenciação entre as micobactérias, mas também para a identificação do bacilo M. leprae faz-se urgente em vista dos altos níveis de detecção de casos novos da doença.1

Neste sentido, o objetivo do presente estudo foi avaliar o método da PCR para detecção do bacilo M. leprae em amostras clínicas de biópsia de pele e imprints de biópsias. Os resultados da PCR, utilizando primers específicos para os microssatélites TTC e AT em amostras do grupo MB, apresentaram melhor desempenho, quando comparados ao gene Ml MntH, o qual, por sua vez, apresentou desempenho similar aos primers AGT neste grupo. Apesar de a concordância estatística entre as PCRs do grupo MB não ter tido diferença significativa, 9 das 11 amostras de biópsias de pele foram positivas para 1 ou 3 microssatélites, enquanto o par de primers que amplificam o gene Ml MntH foi capaz de detectar a presença do bacilo em 5 das 11 amostras testadas, sendo que uma delas não fora identificada pelo primer TTC. Diferentemente do que ocorrera nas amostras de biópsias, o par de primers do gene Ml MntH foi capaz de amplificar 5 das 6 amostras de imprint de biópsias, as quais foram positivas para o par de primers TTC, mostrando desempenho melhor do que o par de primers AT, que amplificou somente 4 das amostras testadas.

Atualmente, o diagnóstico da hanseníase é baseado em achados de exame clínico e na detecção do BAAR (baciloscopia) em raspados das lesões hansênicas e em outros sítios selecionados para a coleta, como lóbulos auriculares, cotovelos e joelhos. Esses resultados são expressos em índice baciloscópico, considerado hoje o método quantitativo de avaliação mais correto, rápido e usual na leitura da baciloscopia da hanseníase (MS/SPS, Brasil). Para se aplicar a técnica da PCR como diagnóstico para hanseníase em termos clínicos, deve-se comparar cuidadosamente os resultados deste teste com os resultados obtidos pela baciloscopia, tanto da linfa quanto da biópsia de pele.6

Os primers testados para diagnóstico neste trabalho foram anteriormente utilizados para mapeamento epidemiológico do bacilo M. leprae em populações da Índia, Indonésia, Filipinas, dentre outros.4,7,8 Porém, a utilização desses primers não tem sido aplicada rotineiramente devido à dificuldade de se obter amostras do DNA genômico a partir do material clínico.1

Em contrapartida, o uso de sequências repetitivas como alvos de DNA na PCR proporciona aumento da sensibilidade do teste, uma vez que essas sequências encontram-se em vários sítios do DNA genômico. 2

Em resumo, a PCR com primers para os microssatélites diagnosticou o bacilo em 18/23 (78,3%) pacientes, enquanto que a PCR com primers para o gene Ml MntH foi capaz de diagnosticar 10/23 (43%) pacientes. Dentre os pacientes do grupo MB, os microssatélites detectaram o bacilo em 78,5% (11/14) das amostras, e o gene Ml MntH em 57,1% (8/14) das amostras, independentemente do material clínico. A positividade da PCR para os microssatélites em amostras de biópsia do grupo MB é semelhante àquela relatada para alvos como o gene pra ou 16S rRNA, que mostrou valores positivos em torno de 70 a 80%, porém, foi superior (microssatélites) ou igual (gene Ml MntH) a alguns estudos que utilizam sequências repetitivas RLEP como alvo para diagnóstico, os quais mostraram 54 a 74% de positividade nos testes.2, 6,9-14

No grupo PB, 55,5% (5/9) das amostras foram positivas para os microssatélites enquanto que 22,2% (2/9) o foram para o gene Ml MntH. Estas amostras de biópsia tiveram positividade maior quando comparada à literatura. 9, 15, 16

No que diz respeito às amostras de imprint de biópsia do grupo MB, a PCR com primers para os microssatélites foi capaz de identificar o bacilo em 66,7 a 100% das amostras, porém não resultou positiva para duas amostras do grupo PB. Estes dados mostraram-se superiores aos relatos de resultados de PCR em amostras de linfa. 2, 9, 10, 15, 17

 

CONCLUSÕES

Este estudo mostra que os primers para sequências de microssatélites são mais efetivos para a amplificação das amostras de DNA de biópsia de pele do que os primers para o gene Ml MntH no grupo MB. Porém, os resultados foram similares no que diz respeito ao grupo PB. Estes achados sugerem que ambos os alvos associados podem tornar-se ferramentas úteis na identificação do bacilo causador da hanseníase em amostras clínicas, como biópsias congeladas e imprints de biópsias.

 

REFERÊNCIAS

1. Groathouse NA, Brown SE, Knudson DL, Brennan PJ, Slayden RA. Isothermal amplification and molecular typing of the obligate intracellular pathogen Mycobacterium leprae isolated from tissues of unknown origins. J Clin Microbiol. 2006;44:1502-8.         [ Links ]

2. Kang TJ, Kim SK, Lee SB, Chae GT, Kim JP. Comparison of two different PCR amplification products (the 18-kDa protein gene vs. RLEP repetitive sequence) in the diagnosis of Mycobacterium leprae. Clin Exp Dermatol. 2003;28:420-4.         [ Links ]

3. Goulart IM, Cardoso AM, Santos MS, Gonçalves MA, Pereira JE, Goulart LR. Detection of Mycobacterium leprae DNA in skin lesions of leprosy patients by PCR may be affected by amplicon size. Arch Dermatol Res. 2007;299:267-271.         [ Links ]

4. Young SK, Taylor GM, Jain S, Suneetha LM, Suneetha S, Lockwood DN, et al. Microsatellite mapping of Mycobacterium leprae populations in infected humans. J Clin Microbiol. 2004;42:4931-6.         [ Links ]

5. Stefani MM, Guerra JG, Sousa AL, Costa MB, Oliveira ML, Martelli CT, et al. Potential plasma markers of Type 1 and Type 2 leprosy reactions: a preliminary report. BMC Infect Dis. 2009;9:75.         [ Links ]

6. Yoon KH, Cho SN, Lee MK, Abalos RM, Cellona RV, Fajardo TT Jr, et al. Evaluation of polymerase chain reaction amplification of Mycobacterium leprae-specific repetitive sequence in biopsy specimens from leprosy patients. J Clin Microbiol. 1993;31:895-9.         [ Links ]

7. Matsuoka M, Zhang L, Budiawan T, Saeki K, Izumi S. Genotyping of Mycobacterium leprae on the basis of the polymorphism of TTC repeats for analysis of leprosy transmission. J Clin Microbiol. 2004;42:741-5.         [ Links ]

8. Kimura M, Sakamuri RM, Groathouse NA, Rivoire BL, Gingrich D, Krueger-Koplin S, et al. Rapid variable-number tandem-repeat genotyping for Mycobacterium leprae clinical specimens. J Clin Microbiol. 2009;47:1757-66.         [ Links ]

9. de Wit MY, Faber WR, Krieg SR, Douglas JT, Lucas SB, Montreewasuwat N, et al. Application of a polymerase chain reaction for the detection of Mycobacterium leprae in skin tissues. J Clin Microbiol. 1991;29:906-10.         [ Links ]

10. Torres P, Camarena JJ, Gomez JR, Nogueira JM, Gimeno V, Navarro JC, et al. Comparison of PCR mediated amplification of DNA and the classical methods for detection of Mycobacterium leprae in different types of clinical samples in leprosy patients and contacts. Lepr Rev. 2003;74:18-30.         [ Links ]

11. Kurabachew M, Wondimu A, Ryon JJ. Reverse transcription-PCR detection of Mycobacterium leprae in clinical specimens. J Clin Microbiol. 1998;36:1352-6.         [ Links ]

12. Phetsuksiri B, Rudeeaneksin J, Supapkul P, Wachapong S, Mahotarn K, Brennan PJ. A simplified reverse transcriptase PCR for rapid detection of Mycobacterium leprae in skin specimens. FEMS Immunol Med Microbiol. 2006;48:319-28.         [ Links ]

13. Santos AR, Balassiano V, Oliveira ML, Pereira MA, Santos PB, Degrave WM, et al. Detection of Mycobacterium leprae DNA by polymerase chain reaction in the blood of individuals, eight years after completion of anti-leprosy therapy. Mem Inst Oswaldo Cruz. 2001;96:1129-33.         [ Links ]

14. Patrocinio LG, Goulart IM, Goulart LR, Patrocinio JA, Ferreira FR, Fleury RN. Detection of Mycobacterium leprae in nasal mucosa biopsies by the polymerase chain reaction. FEMS Immunol Med Microbiol. 2005;44:311-6.         [ Links ]

15. Wichitwechkarn J, Karnjan S, Shuntawuttisettee S, Sornprasit C, Kampirapap K, Peerapakorn S. Detection of Mycobacterium leprae infection by PCR. J Clin Microbiol. 1995;33:45-9.         [ Links ]

16. Bang PD, Suzuki K, Phoung le T, Chu TM, Ishii N, Khang TH. Evaluation of polymerase chain reaction-based detection of Mycobacterium leprae for the diagnosis of leprosy. J Dermatol. 2009;36:269-76.         [ Links ]

17. Chae GT, Lee SB, Kang TJ, Shin HK, Kim JP, Ko YH, et al. Typing of clinical isolates of Mycobacterium leprae and their distribution in Korea. Lepr Rev. 2002;73:41-6.         [ Links ]

 

 

Endereço para correspondência:
Ana Maria Roselino
Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo (FMRP-USP)
Av. Bandeirantes, 3900
14049-900 Ribeirão Preto (SP) - Brasil
E-mail: amfrosel@fmrp.usp.br

Recebido em 10.04.2010.
Aprovado pelo Conselho Consultivo e aceito para publicação em 24.09.10.
Conflito de interesse: Nenhum
Suporte financeiro: Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES); Fundação de Apoio ao Ensino, Pesquisa e Assistência (FAEPA) - Hospital das Clínicas da Faculdade de Medicina de Ribeirão Preto - Universidade de São Paulo (HC-FMRP-USP)

 

 

* Trabalho realizado no Laboratório Multiusuário de Biologia Molecular, Divisão de Dermatologia, Departamento de Clínica Médica, Faculdade de Medicina de Ribeirão Preto - Universidade de São Paulo (FMRP - USP) - São Paulo (SP), Brasil.