Brazilian Journal of Infectious Diseases
Print version ISSN 1413-8670
Braz J Infect Dis vol.14 no.1 Salvador Jan./Feb. 2010
http://dx.doi.org/10.1590/S1413-86702010000100005
ORIGINAL ARTICLE
Prevalence of human papillomavirus (HPV) and HPV-16 genotyping by real-time PCR in patients with several cervical pathologies
Bedia DincI; Seyyal RotaI; Anil OnanII; Gulendam BozdayiI; Cagatay TaskiranII; Aydan BiriII; Haldun GünerII
IDepartment of Medical Microbiology
IIDepartment of Obstetrics and Gynecology of Gazi University, Faculty of Medicine, 06500, Ankara, Turkey
ABSTRACT
PURPOSE: this study was planned to evaluate the prevalence of HPV (excepting type 16) and HPV 16 by real-time PCR in colposcopy patients and to interprete the results with age, age of first sexual intercourse (FSI), parity and Pap smear results.
METHODS: one hundred and two colposcopy patients (50 and 52 of the patients were classified as colposcopy positive and negative, respectively) applying to Gynecology clinic were included. HPV (excepting type 16) and HPV 16 were detected by realtime PCR using the L1 region. Real-time nested amplifications of MY09/11 products were done by GP5+/GP6+ primers and Cyanine-5 labeled HPV and HPV 16 DNA specific probe after HPV DNA extraction by phenol chloroform isoamylalcohol.
RESULTS: HPV (excepting type 16) and HPV 16 were positive in 12% and 18% of the colposcopy positive patients respectively. HPV (excepting type 16) and HPV 16 were positive in 5.7% and 3.8% of the colposcopy negative patients, respectively.
CONCLUSION: there was a statistically significant difference between colposcopy positive and colposcopy negative patients comparing HPV 16 with total HPV positivity (p = 0.021 for type 16 and p = 0.010 for total HPV) but there was not a statistically significant difference between colposcopy positive and colposcopy negative patients when we compared HPV (excepting type 16) positivity (p = 0.314). In conclusion, HPV detection and typing may be helpful for cervical cancer screening and prevention.
Keywords: HPV type 16, real-time PCR, colposcopy.
INTRODUCTION
Cervical cancer is globally the second most common cancer in women with approximately 493,000 new cases annually.1 Also cervical cancer is an important public health problem in developing countries. There is a statistically significant relationship between cervical cancer and the number of sexual partners of a woman. These data direct us to sexually transmitted agents, especially viruses.2,3 As a result of the epidemiological studies on cervical cancer, there is no doubt about the importance of human papillomavirus (HPV), especially type 16 and 18, as an aetiological agent.2-5 As a consequence, the detection and treatment of HPV infection can be an important stage in diagnosis and treatment of cervical cancer. The Pap smear test, as the most widely used cancer screening test in the world, is cost effective and organised screening provided a decline in cervical cancer mortality. However, in developing countries, where screening programmes are uncommon, cervical cancer still remains as one of the most important causes of death among women. HPV can only be reliably detected by DNA based tests since morphological changes on cytology such as koilocytosis are not specific for oncogenic HPVs. These observations underscore the need to develop more effective diagnostic methods.6,7 PCR based methods amplifying nucleic acids of HPV are commonly used because of the limited sensitivity of Pap smear test leading to sample preparation and interpretation problems, insufficient serological tests and impossibility of in vitro cultures. Detection of HPV DNA, especially in latent infections, can be helpful in detecting cancer and precursor lesions.8 This study was designed to evaluate the effect of HPV, especially type 16 in colposcopy patients, both with and without cervical pathologies and to associate it with the clinical findings in our hospital.
MATERIAL AND METHODS
Patients: from December 2003 to October 2004, patients directed to colposcopy were included in the study. After acetic acid application observation of cervical acetowhite epithelium, punctuation, atypical vascularisation or mosaic pattern in colposcopic examination were classified as colposcopy positive patients, and patients with normal colposcopic findings were classified as colposcopy negative. All colposcopy patients were screened by Pap smear test and replied a questionnaire including questions, such as age, age of FSI, and parity.
Samples: cervical smear samples were collected in tubes containing 3-5 mL sterile phosphate buffered saline (PBS) in Gynecology Clinic of Gazi University Medical Faculty from colposcopy patients before application of acetic acid. After transporting to molecular diagnosis laboratory, all samples were vortexed and aliquoted in 1.5 mL eppendorf tubes and frozen at -86º C until DNA extraction.
DNA extraction: the cervical samples were digested in a buffer containing 20 mg/mL proteinase K (20 mM (NH4)2SO4, 75 mM Tris HCl [pH 8,8] 0,1% Tween 20) at 55º C for 3 hours; followed by 10 minutes at 95ºC. DNA isolation was performed by phenol-chloroform extraction and ethanol precipitation. DNA was then suspended in sterile distilled water and stored at -86º C until amplification.
DNA amplification: nested real-time PCR method was used for the analysis of HPV DNA and HPV 16 positivity. MY09/11 primer set (5'-CGTCCMARRGGAWACTGATC-3'), (5'-CMCAGGGWCATAAYAATGG-3', Tib Molbiol, Germany) was used for PCR amplifications following the extraction of the DNA. Real-time nested amplifications of MY09/11 products were done by GP5+/GP6+ primers and Cyanine-5 labeled HPV 16 DNA specific probe [Primer F 5' TTTGTTACTGTGGTAGATACTAC 3', Primer R 5' GAAAAATAAACTGTAAATCATATTC 3', Cy5.0 signal probe 5' Cy5-GTTTCTGAAGTAGATATGGCAGCACA-biotin 3' (Tib Molbiol, Germany)]. Real-time PCR product analysis was done by melting curve analysis on LightCycler Software version 3.5.3 (LC 2.0 Roche Diagnostics, Germany). Melting peaks of 78-82º C showed the detection of HPV DNA in the sample. Probe melting peaks of positive samples have been analyzed in the same run and HPV 16 positive samples yielded peaks around 68º C.
Ethical review of the proposal and the consent
The research proposal was approved by the ethical review board of the Faculty of Medicine, Gazi University. Informed consent was obtained from all women prior to the sample collection.
RESULTS
A total of 50 colposcopy positive women (18-63 years old; mean age ± SD: 39 ± 7) and 52 colposcopy negative women (17-65 years old; mean age ± SD: 40 ± 9) were included in the study. There was a statistically significant difference between colposcopy positive and colposcopy negative patients when we compared HPV 16 and total HPV positivity by Pearson chi-square test (p = 0.021 for type 16 and p = 0.010 for total HPV) but there was not a statistically significant difference between colposcopy positive and colposcopy negative patients when we compared HPV (excepting type 16) positivity by Fisher's exact test (p = 0.314) (Table 1).
According to age of women included in the study there was not a statistically significant difference between patients age < 34 and > 35 when we compared HPV 16 and HPV (excepting type 16) positivity by Fisher's exact test (p = 0.154) for type 16 and p = 0.240 for HPV (excepting type 16) but there was a statistically significant difference between patients age < 34 and > 35 when we compared total HPV positivity by Pearson chi-square test (p = 0.036) (Table 2).
There was no statistically significant difference between FSI in patients < 19-year old and FSI in patients > 20-year old when we compared HPV 16, HPV (excepting type 16) and total HPV positivity by Fisher's exact test (p = 0.505 for type 16, p = 0.159 for HPV (excepting type 16) and p = 0.650 for total HPV) (Table 2).
Parity seems statistically significant between 0-2 parity patients and > 3 parity patients when we compared HPV 16, HPV (excepting type 16) and total HPV positivity by Fisher's exact test (p = 0.037 for type 16 and p < 0.001 for hpv (excepting type 16) and p < 0.001 for total HPV) (Table 2).
According to examination of Pap smear results, there was not a statistically significant difference between the patients with normal Pap smear and pathological Pap smear when we compared HPV 16 and HPV (excepting type 16) positivity by Fisher's exact test (p = 0.169 for type 16 and p = 0.254 for HPV (excepting type 16) but the p value was 0.050 by Pearson chi-square test which is a borderline value when we compared total HPV positivity (Table 2).
DISCUSSION
Because HPV, especially type 16, is reported as an important risk factor for development of cervical dysplasia and cancer, and 99.7% of the cervical cancers can be proved related to HPV, one of the main goals of preventing cervical cancer is screening for HPV.9
Tuncer et al.10 detected in their study 12.5%, 19.4%, 46.3% and 83.3% of HPV type 16 positivity in CIN I, CIN II, CIN III and invasive carcinoma specimens, respectively, by PCR in Turkish patients. Also Onan et al.11 from Turkey found 4.2%, 14.8%, 45% HPV positivity in CIN I, CIN II, and CIN III specimens, respectively, and HPV positivity in patients with CIN III was significantly higher than in patients with CIN I and CIN II.
In 102 colposcopy patients (both colposcopy positive and negative), a 19.6% of positivity in favour of total HPV was detected in our study, 9.5% positivity and 30.0% positivity in colposcopy negative and positive groups, respectively. This result indicates that there is a statistically significant difference between two groups (p = 0.010).
In joint assessment of HPV (excepting type 16) and HPV 16 we found a 55% of positivity in patients younger than 34 and a 45% of positivity in patients older than 35. Our results correlate with the studies indicating a decrease in HPV infection as the age increases,12-15 although Ko et al.16 in their study found that women between ages 30-69 had lower HPV positivity rate (ranging from 14-34%) compared to women with younger than 30 and older than 70 (ranging from 47-52%).
Considering total HPV, we found 70% positive cases in the group who experienced their FSI at the age of 19 or before, and 30% positive cases in the group who experienced their FSI at the age of 20 or after. Although there is not a statistically significant difference between the two groups and HPV results, our findings confirmed the findings of previous studies12,17,18 that HPV infection is more common among women who experienced their FSI in the early ages. Consequently, Flores et al.19 indicate in their study that older age at FSI is significantly associated with a decreased risk of high grade CIN or cancer in HPV(+) women.
There are contradictory results in the studies evaluating HPV-cervical cancer and parity relationship, some of which suggest that there is no association with parity and HPVcervical cancer.20,21 Considering all HPV types, 40% positive cases in the group who gave two or less births and 60% positive cases in the group who gave three or more births were found in our study and HPV seems statistically significant between 0-2 parity patients and > 3 parity patients when we compared HPV 16, HPV (excepting type 16) and total HPV positivity. Shields et al.22 and Castellsague et al.23 suggest that HPV exposed women with high parity are at increased risk for cervical cancer. Our study suggests that parity seems a risk factor for HPV and consequently for cervical cancer. On the contrary, Sellors et al.17 in Canada detected a positivity of 17.1% in women who never gave birth, 12.7% in women who gave one birth, 8.7% in women who gave two births and 6.5% in women who gave three or more births.
We first performed colposcopy and cytology and than detected HPV DNA by real-time PCR. It is suggested that, as compared to Pap testing, HPV testing has greater sensitivity for the detection of CIN,24 and the addition of a HPV test to a Pap test to screen women in their mid 30's for cervical cancer reduces the incidence of grade 2 or 3 CIN or cancer.25 Cuzick26 emphasizes in a review that detection of HPV DNA by molecular tests is more sensitive but less specific and therefore the use of these methods together must be the gold standard in cervical screening programs.
Grce et al.27 detected HPV DNA in colposcopy positive patients in Zagreb. The results were 64.4% positive. As they detected the smears cytologically, they came to the conclusion that as the grade of SIL increased there was an increase in the prevalance of high risk HPVs (HPV DNA type 16 prevalance was 8.5% and 17.1% in LSIL and HSIL cases, respectively). The results were found to be statistically significant. Fife et al.28 found 35% HPV 16 positivity in women with pathological Pap smear results in their study by PCR. All ASCUS, LSIL, HSIL, CIN I, CIN II, CIN III cases in our study were considered as pathological Pap smear results. We found 45.5% HPV 16 positivity in women with pathological Pap smear results. While 45% positivity (total HPV) was found in the group with pathological Pap smear results, the ratio of HPV positivity (total HPV) was 55% in the group with normal Pap smear results. Our results are not correlated with literature results. The reason for this declination may be due to sample preparation or smear results interpretation.
HPV DNA, especially type 16, followed by type 18, 45, 31 and 33 is diagnosed in more than 99% of cervical cancer biopsies. Although the ratios change according to the diagnosis method, HPV type 16 is detected in 33-50% of cervical cancer tissues and this is the main reason to focus on type 16.29 Antonishyn et al.30 found in their study that the most commonly identified genotype in patients with cervical intraepithelial neoplasia grade 2 or worse was HPV-16 (46.7%), followed by HPV-31 (14.7%) and HPV-18 (3.9%) by real-time polymerase chain reaction. They found that HPV-31 is contributing significantly to the proportion of women with cervical intraepithelial neoplasia in their study population and shows a higher prevalence than HPV-18 in high-grade lesions.
We studied smear samples and found a 19.6% positivity in all colposcopy patients. This result shows the high sensitivity of real-time PCR. Real-time PCR, the most advanced and sensitive of the molecular methods, was used in our study. Since the experiment occurred in a closed environment, there was minimal contamination compared to conventional methods and the sensitivity is higher due to one more step in amplification.31,32
We detected both HPV and HPV 16 positivity by realtime PCR. In order to detect types other than 16, sequencing can be performed.
In conclusion, we aimed to detect the prevalence of HPV, especially type 16 in colposcopy patients as a specific group with cervical complaints and this is the first study reflecting the HPV results of colposcopy patients in our country. Since cervical cancer is an important public health problem among women and HPV, especially type 16 is significantly related with cervical cancer, detection of HPV will be helpful for designing effective cervical cancer prevention programs. We think that further studies including large numbers of colposcopy patients must be performed to evaluate the prevalance of HPV in this patient group.
REFERENCES
1. Monk BJ, Herzog TJ. The new era of cervical cancer prevention: HPV vaccination. Gynecol Oncol 2008; 109 (2 Suppl):S1-3. [ Links ]
2. Benedet JL. Progress in gynecologic cancer detection and treatment. International Journal of Gynecology and Obstetrics 2000; 70:135-47. [ Links ]
3. Spinillo A, Debiaggi M, Zara F et al. Human Immunodeficiency Virus Type 1- Related Nucleic Acids and Papillomavirus DNA in Cervicovaginal Secretions of Immunodeficiency Virus- Infected Women. Obstetrics and Gynecology 2001; 97:999-1004. [ Links ]
4. Matos E, Loria D, Amestoy GM et al. Prevalance of Human Papillomavirus Infection Among Women in Concordia, Argentina: A Population-Based Study. Sexually Transmitted Diseases 2003; 27:593-9. [ Links ]
5. Moberg M, Gustavsson I, Gyllensten U. Real-Time PCR-Based System for Simultaneous Quantification of Human Papillomavirus Types Associated with High Risk of Cervical Cancer. Journal of Clinical Microbiology 2003; 41:3221-8. [ Links ]
6. Franco EL, Duarte- Franco E, Ferenczy A. Cervical cancer: epidemiology, prevention and the role of human papillomavirus infection. CMAJ 2001; 164:1017-25. [ Links ]
7. Perrons C, Kleter B, Jelley R et al. Detection and Genotyping of Human Papillomavirus DNA by SPF10 and MY09/11 Primers in Cervical Cells Taken From Women Attending a Colposcopy Clinic. Journal of Medical Virology 2002; 67:246-52. [ Links ]
8. Severson J, Evans T, Lee P et al. Human Papillomavirus Infections: Epidemiology, Pathogenesis, and Therapy. Journal of Cutaneous Medicine and Surgery 2001; 5: 43-60. [ Links ]
9. Mayeaux EJ. Reducing the economic burden of HPV-related diseases. J Am Osteopath Assoc 2008; 108 (4 Suppl 2):52-7. [ Links ]
10. Tuncer S, Ustacelebi S. Detection of Human Papillomavirus Type 16 and 18 by polymerase chain reaction in cervical biopsy samples. Flora 1996; 1:40-4. [ Links ]
11. Onan MA, Taskiran C, Bozdayi G et al. Assessment of human papilloma viral load of archival cervical intraepithelial neoplasia by real-time polymerase chain reaction in a Turkish population. Eur J Gynaecol Oncol 2005; 26(6):632-5. [ Links ]
12. Ozturk S, Kaleli I, Kaleli B, Bir F. Investigation of human papillomavirus DNA in cervical specimens by hybrid capture assay. Mikrobiyol Bul 2004; 38(3):223-32. [ Links ]
13. Oliveira LH, Rosa ML, Pereira CR et al. Human papillomavirus status and cervical abnormalities in women from public and private health care in Rio de Janeiro State, Brazil. Rev Inst Med Trop São Paulo 2006; 48(5):279-85. [ Links ]
14. Dunne EF, Unger ER, Sternberg M et al. Prevalence of HPV infection among females in the United States. JAMA 2007; 297(8):813-9. [ Links ]
15. Ferreccio C, Corvalan A, Margozzini P et al. Baseline assessment of prevalence and geographical distribution of HPV types in Chile using self-collected vaginal samples. BMC Public Health 2008; 8:78. [ Links ]
16. Ko V, Nanji S, Tambouret RH, Wilbur DC. Testing for HPV as an objective measure for quality assurance in gynecologic cytology: positive rates in equivocal and abnormal specimens and comparison with the ASCUS to SIL ratio. Cancer 2007; 111(2):67-73. [ Links ]
17. Sellors JW, Mahony JB, Kaczorowski J et al. Prevalence and predictors of human papillomavirus infection in women in Ontario, Canada. CMAJ 2000; 163:503-8. [ Links ]
18. Kahn JA, Rosenthal SL, Succop PA et al. Mediators of the association between age of first sexual intercourse and subsequent human papillomavirus infection. Pediatrics 2002; 109(1):E5. [ Links ]
19. Flores YN, Bishai DM, Shah KV et al. Risk factors for cervical cancer among HPV positive women in Mexico. Salud Publica Mex. 2008; 50(1):49-58. [ Links ]
20. Castle PE, Wacholder S, Lorincz AT et al. A prospective study of high-grade cervical neoplasia risk among human papillomavirus-infected women. J Natl Cancer Inst. 2002; 94(18):1406-14. [ Links ]
21. Vaccarella S, Herrero R, Dai M et al. Reproductive factors, oral contraceptive use, and human papillomavirus infection: pooled analysis of the IARC HPV prevalence surveys. Cancer Epidemiol Biomarkers Prev. 2006; 15(11):2148-53. [ Links ]
22. Shields TS, Brinton LA, Burk RD et al. A case-control study of risk factors for invasive cervical cancer among U.S. women exposed to oncogenic types of human papillomavirus. Cancer Epidemiol Biomarkers Prev. 2004; 13(10):1574-82. [ Links ]
23. Castellsagué X, Díaz M, de Sanjosé S et al. Worldwide human papillomavirus etiology of cervical adenocarcinoma and its cofactors: implications for screening and prevention. J Natl Cancer Inst. 2006; 98(5):303-15. [ Links ]
24. Mayrand MH, Duarte-Franco E, Rodrigues I et al. Human papillomavirus DNA versus Papanicolaou screening tests for cervical cancer. N Engl J Med. 2007; 357(16):1579-88. [ Links ]
25. Naucler P, Ryd W, Törnberg S et al. Human papillomavirus and Papanicolaou tests to screen for cervical cancer. N Engl J Med. 2007; 357(16):1589-97. [ Links ]
26. Cuzick J. Role of HPV testing in clinical practice. Virus Research. 2002; 89:263-9. [ Links ]
27. Grce M, Husnjak K, Bozikov J et al. Evaluation of Genital Human Papillomavirus Infections by Polymerase Chain Reaction among Croatian Women. Anticancer Research. 2001; 21:579-84. [ Links ]
28. Fife KH, Cramer HM, Schroeder JM, Brown DR. Detection of Multiple Human Papillomavirus Types in the Lower Genital Tract Correlates With Cervical Dysplasia. Journal of Medical Virology. 2001; 64:550-9. [ Links ]
29. Yang YY, Koh LW, Tsai CH et al. Correlation of viral factors with cervical cancer in Taiwan. J Microbiol Immunol Infect. 2004; 37:282-7. [ Links ]
30. Antonishyn NA, Horsman GB, Kelln RA et al. The impact of the distribution of human papillomavirus types and associated high-risk lesions in a colposcopy population for monitoring vaccine efficacy. Arch Pathol Lab Med. 2008; 132(1):54-60. [ Links ]
31. Shah K V, Solomon L, Daniel R et al. Comparison of PCR and Hybrid Capture Methods for Detection of Human Papillomavirus in Injection Drug- Using Women at High Risk of Human Immunodeficiency Virus Infection. Journal of Clinical Microbiology. 1997; 35:517-9. [ Links ]
32. Bryant-Greenwood P. Molecular Diagnostics in Obstetrics and Gynecology. Clinical Obstetrics and Gynecology. 2002; 45:605-21. [ Links ]
Correspondence to:
Bedia Dinc, MD Gazi
University, Faculty of Medicine, Department of Medical Microbiology
Dekanlik Binasi, 2. Kat, Besevler
Ankara, Turkey, 06500
Tel: +90 312 202 46 28 Fax: +90 312 212 46 47
E-mail: bhdogan@yahoo.com
Submitted on: 07/20/2009
Approved on: 11/05/2009
We declare no conflict of interest.











uBio 