Molecular types of Cryptococcus species isolated from patients with cryptococcal meningitis in a Brazilian tertiary care hospital

ABSTRACT

There are limited data on the molecular epidemiology of cryptococcosis in Brazil. Here, we report on the identification of the molecular pattern of the Cryptococcus species that caused meningitis in patients admitted in a Brazilian reference tertiary care hospital, and review the published studies addressing the molecular epidemiology of Cryptococcus in Brazil. Our study has shown the predominance of molecular type VNII in HIV-infected patients with cryptococcal meningoencephalitis. Molecular types VNII and VGII were occasionally detected in HIV-infected and non-infected patients with meningoencephalitis. In contrast, previous studies have shown that several regions exhibited a high prevalence of the VNI molecular type and sporadic cases of the VNII and VGII molecular types in patients with cryptococcosis in Brazil. Additional studies including VNII isolates will contribute to understanding the epidemiology and phylogenetic relationship of these genotype compared to the other ones. So far, no clear correlation has been established between genotypes, antifungal susceptibility for Cryptococcus and clinical outcome in cryptococcosis.

Keywords:
Cryptococcus; Genotypes; Molecular types; Epidemiology; Brazil

Cryptococcosis is a systemic mycosis primarily caused by Cryptococcus neoformans species complex. The C. neoformans complex includes the molecular types VNI, VNII, VNB, VNIII, and VNIV, and the C. gattii species complex, which includes the molecular types VGI, VGII, VGIII, and VGIV.^1,2 Members of the C. neoformans species complex are responsible for most cases of cryptococcosis associated with AIDS. Using genotyping techniques four major molecular types can be identified VNI, VNII, VNB, VNIV, in addition to the AD hybrid. VNI and VNII have a worldwide distribution.³ In terms of serotypes, three varieties are recognized: C. neoformans var. grubii, serotype A, C. neoformans var. neoformans, serotype D, C. neoformans var. gattii, serotypes B and C, and the hybrid serotype AD.^4-6

Meningitis is the most serious infectious due to Cryptococcus sp. The human immunodeficiency virus (HIV)/AIDS pandemic increased the population of immunosupressed and susceptible individuals and brought an increase in C. neoformans infection rates, but the increasing number of people living with any other immunodeficiency, including transplant and cancer patients, represents a growing population at risk for cryptococcosis.^7,8

The recent availability of DNA fingerprinting techniques extended our knowledge about C. neoformans epidemiology over the past years. Naturally, the randomized amplified polymorphic DNA, PCR-fingerprinting, restriction fragment length polymorphism, karyotyping, allele sequencing, and multilocus enzyme electrophoresis helped us to answer several questions. PCR fingerprinting technique has been used as the major typing technique in the ongoing global molecular epidemiologic survey of C. neoformans, dividing >400 clinical and environmental isolates into eight major molecular types: VNI (var. grubii, serotype A), VNII (var. grubii, serotype A), VNIII (serotype AD), VNIV (var. neoformans, serotype D), VGI, VGII, VGIII, and VGIV (var. gattii, serotypes B and C). No correlation between serotype and molecular type has been found for C. neoformans var. gattii. The molecular types were recently confirmed by RFLP analysis of the orotidine monophosphate pyrophosphorylase (URA5) gene and the phospholipase (PLB1) gene.^9-13

Currently, there are limited data on the molecular epidemiology of cryptococcosis in Brazil. Here, we report on the identification of the molecular pattern of the Cryptococcus species that caused meningitis in patients admitted in a reference Brazilian tertiary care hospital, and review the published studies addressing the molecular epidemiology of Cryptococcus in Brazil.

Cryptococcus sp. was isolated from the cerebrospinal fluid of patients with meningoencephalitis admitted at Hospital de Clinicas de Porto Alegre, 700-bed tertiary Brazilian reference hospital, from January 2014 to December 2015. Initially, C. neoformans and C. gattii were distinguished by a phenotypic method - CGB agar (cavanine glycine bromothymol blue agar). Detailed demographics, risk factors, treatment regimens and clinical outcome of the patients with meningeal cryptococcosis were evaluated from medical records. The study was approved by the local ethics committee. Cryptococcus complex reference strains were very kindly provided by Laboratory of Mycology (Pathogenic Fungi Collection), at Oswaldo Cruz Foundation (FIOCRUZ) - INI/FIOCRUZ in Brazil. The strains included were the following: WN = M 148 (VNI, serotype A), WM 626 (VNII, serotype A), WM 628 (VNIII, serotype AD), WM 629 (VNIV, serotype D), WM 179 (VGI, serotype B), WM 178 (VGII, serotype B), WM 161 (VGIII, serotype B) and WM 779 (VGIV, serotype C). The extraction of genomic DNA and RFLP analysis was performed according protocol using 2 primers: URA5 (5′ATGTCCTCCCAAGCCCTCGACTCCG3′) and SJ01 (5′ TTAAGACCTCTGAACACCGTACTC3′). RFLP patterns were assigned visually by comparing them to the patterns obtained from the standard-type strains (VNI-VNIV and VGI-VGIV).^14,15

Fifteen patients with cryptococcal meningoencephalitis were evaluated in the study (Table 1). The gene URA-5 RFLP showed that nine patients had VNII, serotype A, two patients VNI serotype A, and two had VGII, serotype B isolate from their CSF samples. Two patients presented a positive CSF cryptococcal polysaccharide antigen, and Cryptococcus could not be isolated from the CSF samples. As expected, the VNII, serotype A strains were isolated from patients with underlying immunossupressive disease. HIV positive was the most common condition, followed by kidney and liver transplant. Meningoencephalitis by C. gattii was diagnosed in two patients. One of them was immunocompetent and the other presented an immunosuppressive condition (HIV). Clinical isolates were highly susceptible to amphotericin B and fluconazole by microdilution method (data not shown). In Brazil, studies of the in vitro susceptibility of Cryptococcus spp. have shown that most isolates are susceptible to polyene antifungals, 5-flucytosine, and azoles.¹⁶

Table 1
Cryptococcus species complex and genotype identification in the CSF samples from patients with cryptococcal meningitis.

	Age/Sex	Species complex	Molecular type	Underlying disease	Treatment	Outcome
1	54/M	C. neoformans	VNII, Serotype A	Kidney transplant	Liposomal AmB + FCZ	Death
2	6/M	C. neoformans	VNII, Serotype A	Liver transplant	AmB + 5-FC	Alive
3	45/M	Not available	Not available	HIV+	AmB + FCZ	Death
4	27/M	C. neoformans	VNII, Serotype B	HIV+	AmB + FCZ	Alive
5	65/M	C. gattii	VGII, Serotype B	Immunocompetent	AmB + FCZ (VCZ)	Death
6	33/F	C. neoformans	VNII, Serotype A	Kidney transplant	AmB + FCZ	Alive
7	42/M	C. neoformans	VNII, Serotype A	HIV+	AmB + FCZ	Alive
8	55/M	C. neoformans	VNII, Serotype A	HIV+	AmB + FCZ	Death
9	62/M	C. neoformans	VNII, Serotype A	Kidney transplant	AmB + FCZ	Alive
10	25/F	C. neoformans	VNII, Serotype A	HIV+	AmB + FCZ	Alive
11	38/M	C. neoformans	VNI, Serotype A	HIV+	Lipid complex AmB + FCZ	Alive
12	44/F	C. neoformans	VNII, Serotype A	HIV+	AmB + FCZ	Alive
13	37/F	C. neoformans	VNI, Serotype A	HIV+	AmB + FCZ	Death
14	41/M	C. gattii	VGII, Serotype B	HIV+	AmB + FCZ	Death
15	43/F	Not available	Not available	HIV+	AmB + FCZ	Death

• M, male; F, female; AmB, amphotericin B deoxycholate; FLZ, fluconazole; VCZ, voriconazole.

Although we analyzed a small number of isolates, our study has shown the predominance of VNII Cryptococcus genotype in patients with meningoencephalitis. Previous studies have shown that the VNI molecular pattern is the most common pattern worldwide, whereas VNII was observed in 1%-16% of cases reported in South America, Africa, and Oceania.^17,2C. gattii VGII was also observed in South America, North America, and Oceania. Table 2 describes the studies evaluating the Cryptococcus genotypes circulating in Brazil.^18-33 Several regions exhibited a high prevalence of the VNI molecular type and sporadic cases of the VNII and VGII molecular types in Brazil. The predominance of the VNI molecular type has been described in the States of São Paulo, Minas Gerais, Mato Grosso, Amazonas, PIauí, Rio Grande do Sul and Rio de Janeiro in Brazil.

Table 2
Studies addressing the prevalence of Cryptococcus molecular types in cryptococcosis in Brazil.

Reference	Location - state	Predominant molecular type	Other molecular types
Wirth et al. (present case)	Rio Grande do Sul	VNII	VNI, VGII
Nunes et al.18	Mato Grosso do Sul	VNI	VNI, VGII
Andrade-Silva et al.19	Minas Gerais	VNI
Aguiar et al.20	Minas Gerais	VNI	VNI, VGI
Ferreira-Paim et al.21	Minas Gerais	VNI
Figueiredo et al.22	São Paulo	VNII	VGII
Favalessa et al.23	Mato Grosso	VNI	VGII
Freire et al.24	Amazonas	VNI	VNII, VGII
Matos et al.25	Bahia	VNI	VGII
da Silva et al.26	Amazonas	VNI	VGII
Martins et al.27	Piauí	VNI	VGII
Mora et al.28	Minas Gerais	VNI	VGII
Souza et al.29	Goias	VNI	VGII
Triles et al.30	RS, SP, MS, MG, BA PI, PE, RR, AM	VNI, VGII	VNII, VNIII, VNIV, VGI, VGIII
Matsumoto et al.31	São Paulo	VNI	VNII
Igreja et al.32	Rio de Janeiro	VNI, VNII	VGI, VGII
Casali et al.33	Rio Grande do Sul	VNI	VGIII

• RS, Rio Grande do Sul; SP, São Paulo; MS, Mato Grosso do Sul; MG, Minas Gerais; BA, Bahia; PI, Piauí; PE, Pernambuco; RR, Roraima; AM, Amazonas.

Studies of molecular types of Cryptococcus contribute to the evaluation of the epidemiology, clinical manifestations, interventions and therapeutic approach for cryptococcosis. The presence of molecular type VNII was reported in all five continents, but little is known about its pathobiology, ecology, and antifungal susceptibility. Therefore, tools that are able to identify it are important to better understand how it is distributed in the environment, how it interacts with the host, and finally if it needs a different and more specific treatment to improve the patient outcome. Additional studies of VNII isolates will contribute to understanding the epidemiology and phylogenetic relationship of this genotype compared to the other ones, revealing if it represents a separate species in the C. neoformans species complex.

Acknowledgments

The study was supported in part by CNPq (Brazilian National Council of Research).

References

• ¹
  Kwon-Chung KJ, Bennett JE, Wickes BL, et al. The case for adopting the "species complex" nomenclature for the etiologic agents of cryptococcosis. mSphere. 2017;2:e00357-416.
• ²
  Meyer W, Castañeda A, Jackson S, Huynh M, Castañeda E. IberoAmerican Cryptococcal Study Group Molecular typing of IberoAmerican Cryptococcus neoformans isolates. Emerg Infect Dis. 2003;9:189-95.
• ³
  Van Wyk M, Govender NP, Mitchell TG, Litvintseva AP. Multilocus sequence typing of serially collected isolates of Cryptococcus from HIV-infected patients in South Africa. J Clin Microbiol. 2014;52:1921-31.
• ⁴
  Kwon-Chung KJ. A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans Mycologia. 1975;67:1197-200.
• ⁵
  Kwon-Chung KJ. A new genus, Filobasidiella, the sexual state of Cryptococcus neoformans B and C serotypes. Mycologia. 1976;68:942-6.
• ⁶
  Franzot SP, Salkin IF. Casadevall A Cryptococcus neoformans var. grubii: separate varietal status for Cryptococcus neoformans serotype A isolates. J Clin Microbiol. 1999;37:838-40.
• ⁷
  Maziarz EK, Perfect JR. Cryptococcosis. Infect Dis Clin North Am. 2016;30:179-206.
• ⁸
  Franzot SP, Hamdan JS, Currie BP, Casadevall A. Molecular epidemiology of Cryptococcus neoformans in Brazil and the United States: evidence for both local genetic differences and a global clonal population structure. J Clin Microbiol. 1997;35:2243-51.
• ⁹
  Currie BP, Freundlich LF, Casadevall A. Restriction fragment length polymorphism analysis of Cryptococcus neoformans isolates from environmental (pigeon excreta) and clinical sources in New York City. J Clin Microbiol. 1994;32:1188-92.
• ¹⁰
  Perfect JR, Ketabchi N, Cox GM, Ingram CW, Beiser CL. Karyotyping of Cryptococcus neoformans as an epidemiological tool. J Clin Microbiol. 1993;31:3305-9.
• ¹¹
  Varma A, Swinne D, Staib F, Bennet JE, Kwon-Chung KJ. Diversity of DNA fingerprints in Cryptococcus neoformans J Clin Microbiol. 1995;:1807-14.
• ¹²
  Chen SC, Brownlee AG, Sorrel TC, et al. Identification by random amplification of polymorphic DNA of a common molecular type of Cryptococcus neoformans var neoformans in patients with AIDS or other immunosuppressive conditions. J Infect Dis. 1996;:754-8.
• ¹³
  Ellis D, Marriott D, Hajjeh RA, Warnock D, Meyer W, Barton R. Epidemiology: surveillance of fungal infections. Med Mycol. 2000;:173-82.
• ¹⁴
  Meyer W, Kidd S, Castañeda A, et al. Global molecular epidemiology offers hints towards ongoing speciation within Cryptococcus neoformans In: Abstracts of the 5th international conference on Cryptococcus and Cryptococcosis. Adelaide: South Australian Postgraduate Medical Education Association; 2002.
• ¹⁵
  Boekhout T, Theelen B, Diaz M, et al. Hybrid genotypes in the pathogenic yeast Cryptococcus neoformans Microbiology. 2001;147:891-907.
• ¹⁶
  Herkert PF, Lucca de Oliveira Salvador G, et al. Molecular characterization and antifungal susceptibility testing of Cryptococcus neoformans sensu stricto from southern Brazil. J Med Microbiol. 2018;67:560-9, http://dx.doi.org/10.1099/jmm.0.000698 https://www.ncbi.nlm.nih.gov/pubmed/29461182
  » http://dx.doi.org/10.1099/jmm.0.000698» https://www.ncbi.nlm.nih.gov/pubmed/29461182
• ¹⁷
  Cogliati M. Global molecular epidemiology of Cryptococcus neoformans and Cryptococcus gattii: an atlas of the molecular types. Scientifica. 2013;2013:1-23.
• ¹⁸
  Nunes JO, Tsujisaki RAS, Nunes MO, et al. Cryptococcal meningitis epidemiology: 17 years of experience in a State of the Brazilian Pantanal. Rev Soc Bras Med Trop. 2018;51:485-92.
• ¹⁹
  Andrade-Silva LE, Ferreira-Paim K, Ferreira TB, et al. Genotypic analysis of clinical and environmental Cryptococcus neoformans isolates from Brazil reveals the presence of VNB isolates and a correlation with biological factors. PLoS One. 2018;13:e0193237.
• ²⁰
  Aguiar PADF, Pedroso RDS, Borges AS, Moreira TA, Araújo LB, Röder DVDB. The epidemiology of cryptococcosis and the characterization of Cryptococcus neoformans isolated in a Brazilian University Hospital. Rev Inst Med Trop Sao Paulo. 2017;59:e13.
• ²¹
  Ferreira-Paim K, Andrade-Silva L, Fonseca FM, et al. MLST-based population genetic analysis in a global context reveals clonality amongst Cryptococcus neoformans var. grubii VNI isolates from HIV patients in Southeastern Brazil. PLoS Negl Trop Dis. 2017;11:e0005223.
• ²²
  Figueiredo TP, Lucas RC, Cazzaniga RA, et al. Antifungal susceptibility testing and genotyping characterization of Cryptococcus neoformans and gattii isolates from HIV-infected patients of Ribeirão Preto, São Paulo, Brazil. Rev Inst Med Trop Sao Paulo. 2016;58:69.
• ²³
  Favalessa OC, de Paula DAJ, Dutra V, et al. Molecular typing and in vitro antifungal susceptibility of Cryptococcus spp from patients in Midwest Brazil. J Infect Dev Ctries. 2014;8:1037-43.
• ²⁴
  Freire AK, dos Santos Bentes A, de Lima Sampaio I, et al. Molecular characterisation of the causative agents of Cryptococcosis in patients of a tertiary healthcare facility in the state of Amazonas-Brazil. Mycoses. 2012;55:e145-50.
• ²⁵
  Matos CS, de Souza Andrade A, Oliveira NS, Barros TF. Microbiological characteristics of clinical isolates of Cryptococcus spp. in Bahia Brazil: molecular types and antifungal susceptibilities. Eur J Clin Microbiol Infect Dis. 2012;31:1647-52.
• ²⁶
  Da Silva BK, Freire AK, Bentes Ados S, et al. Characterization of clinical isolates of the Cryptococcus neoformans-Cryptococcus gattii species complex from the Amazonas State in Brazil. Rev Iberoam Micol. 2012;29:40-3.
• ²⁷
  Martins LMS, Wanke B, Lazéra MS, et al. Genotypes of Cryptococcus neoformans and Cryptococcus gattii as agents of endemic cryptococcosis in Teresina Piauí (northeastern Brazil). Mem Inst Oswaldo Cruz. 2011;106:725-30.
• ²⁸
  Mora DJ, Pedrosa AL, Rodrigues V, et al. Genotype and mating type distribution within clinical Cryptococcus neoformans and Cryptococcus gattii isolates from patients with cryptococcal meningitis in Uberaba, Minas Gerais, Brazil. Med Mycol. 2010;48:561-9.
• ²⁹
  Souza LK, Souza Junior AH, Costa CR, et al. Molecular typing and antifungal susceptibility of clinical and environmental Cryptococcus neoformans species complex isolates in Goiania, Brazil. Mycoses. 2010;53:62-7.
• ³⁰
  Trilles L, Lazéra MS, Wanke B, et al. Regional pattern of the molecular types of Cryptococcus neoformans and Cryptococcus gattii in Brazil. Mem Inst Oswaldo Cruz. 2008;103:455-62.
• ³¹
  Matsumoto MT, Fusco-Almeida AM, Baeza LC, Melhem MSC, Mendes-Giannini MJS. Genotyping, serotyping and determination of mating-type of Cryptococcus neoformans clinical isolates from São Paulo, state Brazil. Rev Inst Med Trop Sao Paulo. 2007;49:41-7.
• ³²
  Igreja RP, Lazéra M, dos S, et al. Molecular epidemiology of Cryptococcus neoformans isolates from AIDS patients of the Brazilian city, Rio de Janeiro. Med Mycol. 2004;42:229-38.
• ³³
  Casali AK, Goulart L, Silva LKR, et al. Molecular typing of clinical and environmental Cryptococcus neoformans isolates in the Brazilian state Rio Grande do Sul. FEMS Yeast Res. 2003;3:405-15.

Publication Dates

• Publication in this collection
  Nov-Dec 2018

History

• Received
  12 Oct 2018
• Accepted
  10 Nov 2018
• Published
  30 Nov 2018