Phylogenetic relationships and the evolution of mimicry in the Chauliognathus yellow-black species complex (Coleoptera: Cantharidae) inferred from mitochondrial COI sequences

ANIMAL GENETICS

RESEARCH ARTICLE

Phylogenetic relationships and the evolution of mimicry in the Chauliognathus yellow-black species complex (Coleoptera: Cantharidae) inferred from mitochondrial COI sequences

Vilmar Machado^I; Aldo M. Araujo^II; José Serrano^III; José Galián^III

^IUniversidade do Vale do Rio dos Sinos - UNISINOS, Laboratório de Biologia Molecular, São Leopoldo, RS, Brazil

^IIUniversidade Federal do Rio Grande do Sul, Instituto de Biociências, Departamento de Genética, Porto Alegre, RS, Brazil

^IIIUniversidad de Murcia, 3ª Planta Facultad de Veterinaria, Departamento de Zoología y Antropología Física, Área de Biología Animal, Murcia, Spain.

^{Correspondence}

ABSTRACT

The phylogenetic relationships of twelve species of Chauliognathus were investigated by studying the mitochondrial cytochrome oxidase I gene. A 678 bp fragment of the COI gene was sequenced to test the hypothesis that the Müllerian mimicry species of the "yellow-black" complex make up a monophyletic clade, separated from species with other colour patterns. The data set was analysed by neighbour-joining, maximum parsimony and maximum likelihood procedures.

The results support a single origin of the yellow-black colour pattern during the evolution of the genus, with one main clade formed by Chauliognathus lineatus, C. tetrapunctatus, C. riograndensis, C. flavipes, C. octomaculatus, C. fallax, and another one formed by two species, C. expansus and C sp 1, plus an orange-black-coloured species. The nucleotide divergences found between C. sp 3 (black) and the other species studied fall within the level expected for species from different genera. The similarity of colour patterns of the yellow-black species has been considered an example of Müllerian mimicry by conservation of the ancestral state with some minor modifications.

Key words: Cantharidae, Chauliognathus, COI, Coleoptera, Müllerian mimicry, phylogeny, yellow-black complex.

Introduction

The genus Chauliognathus is distributed over the Americas and Australia, with more than 250 described species (Delkeskamp, 1939), but, despite its wide geographical distribution, only few studies have addressed its assortative mating features (references in McLain, 1982, 1985, and Bernstein and Bernstein, 1998), allozyme variability (Howard and Shields, 1990), colour polymorphism and mating systems (Machado and Araújo, 1995, 1998, 1999, 2001), and cytogenetics (Machado et al., 2001). Taxonomy at the species level has been poorly studied, since a systematic revision was carried out only in U.S. species (Fender, 1964), whereas the fauna of Mexico and the rest of the Neotropical region remains to be revised.

The present work is part of a long-term study of colour polymorphism in Chauliognathus, along with its morphology, cytogenetics, and molecular variability. Our study was focused on the species of the "yellow-black" complex. The similarity in colour pattern in these species, as well as that shown by morphometric analysis, together with ecological data suggest that they form a Müllerian-type mimicry ring. The existence of colour polymorphism and the factors which maintain this polymorphism in Müllerian mimetic organisms have recently generated much debate, renewing the interest in mimicry (Turner et al., 1984; Speed, 1993; MacDougall and Dawkins, 1998; Joron and Mallet, 1998; Mallet and Joron, 1999; Edmunds and Golding, 1999). In Chauliognathus, this polymorphism could have evolved as a response to visually oriented predators and, on theoretical grounds, it could be a case of classic Müllerian mimicry, made up by species of different intrageneric lineages (Machado et al., 2001). Alternatively, the morphological similarity shown by species of the "yellow-black" complex could be explained by common ancestry.

Molecular phylogenetic studies have been used for generating and testing evolutionary hypotheses in beetles, such as the reconstruction of the history of host plant use by Ophraella (Futuyma and McCafferty, 1990; Futuyma et al., 1993, 1994), the origin of defensive strategies in Cicindela (Vogler and Kelley, 1998), colonisation processes (Juan et al., 1995, 1996, 1998; Emerson et al., 1999, 2000; Rees, 2001), and chromosome evolution (Galián et al., 2002).

This study includes 12 species of Chauliognathus and is the first attempt to generate a phylogenetic hypothesis for the evolution of beetles belonging to the family Cantharidae. The aim of the work was to test the hypothesis that the species of the "yellow-black" species complex make up a monophyletic clade, separated from species with other colour patterns. Therefore, it could be inferred that this colour pattern is due to common ancestry. According to the classical Müllerian mimicry theory, the pattern should be the result of parallel or convergent evolution.

A 678 bp fragment of the mitochondrial cytochrome oxidase I (COI) gene was sequenced. This approach offers an independent phylogenetic framework, based on characters which are unrelated to colour polymorphism. This gene region has also been used for reconstructing phylogenies of low-ranked taxa, including some Coleopteran groups (Juan et al., 1995, 1996; Galián et al., 1999). Furthermore, this gene has been used to address the evolution of mimicry in butterflies of the genus Heliconius (Brower, 1996).

Material and Methods

Material

Twelve species of Chauliognathus were included in the study. Sampling localities are shown in Table 1. Eight of these species belong to the "yellow-black" complex (C. flavipes, C. fallax, C. octomaculatus, C. lineatus, C. tetrapunctatus, C. riograndensis, C. expansus, and C. sp 1). Their main colour patterns are illustrated in Figure 1. The other four species show other colour patterns, namely, grey and black (C. morios), orange (C. sp 2), different stripped combinations of brown and grey (C. sp 4), and black (C. sp 3). This material was identified by one of the authors (VM), based on characters of the external genitalia, following the criteria used by Fender (1964) for the North American species of the same genus. The new species will be described elsewhere; voucher genitalia preparations and remnants of investigated beetles are deposited in the Molecular Biology Laboratory of the Universidade do Vale do Rio dos Sinos, São Leopoldo, Brazil, and can be requested from VM. Sequence data were obtained from single individuals of each species, after an initial estimation of intraspecific sequence variation between 0.3 and 0.6 % in C. flavipes.

DNA amplification and sequencing

Total genomic DNA was isolated by grinding the head, thorax and legs of each specimen (one individual/species) in liquid nitrogen and resuspending the homogenate in buffer (20 mM Tris, 10 mM EDTA, 0.5% SDS) containing proteinase-K at a concentration of 50 mg/L. The mixture was incubated overnight at 56 °C, then the DNA was purified with phenol-chloroform and precipitated with ethanol (Sambrook et al., 1989). The mtDNA template for sequencing was produced by polymerase chain reaction (PCR) with the primers 5'CAACATTTATTTTGATTTTTTGG3' (at 715 bp upstream of the COI gene, corresponding to position 2183 of the mtDNA genome of Drosophila yakuba) and 5'TCAATTGCACTAATCTGCCATATT3' (corresponding to position 3014 of the mtDNA genome located in the tRNAleu). These primers produced a 831 bp fragment at the 3' end of the COI gene in all analysed species. Each PCR cycle was set to 94 °C for 30 s, 1 min at 50 °C, and 1 min at 72 °C. This cycle was repeated 34 times. PCR products were sequenced with the Big Dye Terminator Cycle Sequencing Ready Reaction Kit using Ampli Taq DNA Polymerase, FS, in an ABI PRISM Tm 377 DNA Sequencer.

Phylogenetic analysis

Phylogenetic reconstruction was performed by applying the maximum parsimony (MP), maximum likelihood (ML) and neighbour-joining (NJ; Saitou and Nei, 1987) methods, using the PAUP*4.0b package (Swofford, 1998).

Maximum parsimony and maximum likelihood analyses were conducted using the branch swapping heuristic algorithm tree bisection-reconnection with random addition of taxa.

Phenograms based on sequence distances were constructed using the neighbour-joining analysis, with the distances corrected by Kimura's two-parameter model (Kimura, 1980) with gamma distribution of rates.

For the parsimony analysis, bootstrap tests (Felsenstein, 1985) based on 500 replications were used to assess support of the various phyletic groups. Bootstrap frequencies were interpreted as heuristic levels of support rather than statistical significance levels. Trees were rooted with the sequence of the ground beetle species of the genus Scarites (Carabidae), described by Galián et al. (1999), plus an additional fragment (Galián, unpubl. res).

Results

A fragment of 830 bp was amplified with the chosen primers in all species. Neither insertions nor deletions were found in this region. Within this gene segment, 338 positions were variable (including the outgroup species), and 170 of them were parsimony-informative. The third codon position was the most variable, while the second codon position was the most constant in this region. Across all sequences there was an excess of A (33.4%) and T (36.7%) over G (15.0%) and C (14.9%) (Table 2). The proportion of A-T (70.7%) was high, falling between those found for Drosophila yakuba (78.6%, Clary and Wolstenholme, 1985) and for the genus Pimelia (64%, Juan et al., 1995).

Pairwise distances for the Kimura two-parameter model corrected for rate heterogeneity with the gamma distribution were calculated between sequences, using the pairwise-deletion option of the MEGA computed distances menu (Table 3). The divergence observed between Chauliognathus sp 3 (black) and the other species of the genus was high, between 24% and 32%. For the other Chauliognathus species, the levels of divergence were between 8% and 21%. The smallest divergence value was observed between C. octomaculatus and C. fallax (8%).

A heuristic search with uniform weighting generated two MP trees of step length 680, with CI 0.613 and RI 0.395. Then, the characters were re-weighted by maximum value of re-scaled consistency indices, producing a single tree (Figure 1). That tree was similar to the neighbour-joining tree (not shown). These trees support monophyly for the "yellow-black" complex, with slight differences. An interesting aspect of these trees is that Chauliognathus sp 2 (orange pattern) is included in the yellow-black clade. On the other hand, Chauliognathus sp3 (black pattern) is situated in all analyses in a separated group, basal to the remaining species.

Heuristic maximum likelihood searches using the Hasegawa-Kishino-Yano (1985) model (not shown) did not agree with the previous analysis, since they showed some differences, especially in the position of Chauliognathus. sp 4, that is clustered together within the "yellow-black" species.

In order to correct possible "evolutionary noise" caused by the more variable nucleotide positions, i.e. the first and third codon positions, a weighting of 2:5:1 to the first, second and third codon positions, respectively, was carried out. The branch and bound search produced two most parsimonious trees, similar to the heuristic search with a uniform weighting.

Bootstrap analysis yielded strong support for certain groups, for example, all analyses separated the yellow-black species into two clades, one with six species (bootstrap value 100) and the other with two species plus the orange species C. sp 2 (bootstrap value 84). These values were produced after re-weighting by maximum value of re-scaled consistency indices tree (Figure 1).

In all analyses, the species of the yellow-black complex make up two separated clades; one clade formed by six species of the "yellow-black" complex, Chauliognathus lineatus, C. tetrapunctatus, C. riograndensis, C. flavipes, C. octomaculatus, and C. fallax (bootstrap value 100) and the other clade formed by two species of the "yellow-black" complex, C. expansus and C sp 1, plus C. sp 2, an orange-black species (bootstrap value 56).

Discussion

The results show that the region of the COI gene sequenced in Chauliognathus (corresponding to the 3' end) has the adequate level of divergence for assessing phylogenetic relationships among species of the same genus, as found in other animal groups (Lunt et al., 1996). It has been postulated that the level of divergence for this gene ranges from 1% to 6% among populations within a species, and from 12.6% to 25% among species within a genus (Gallego and Galián, 2001; Simon et al., 1994). The level of divergence calculated between Chauliognathus species falls, for most of them, within the range of distinct species, with the exception of C. sp 3. The lowest genetic distance value was found between C. fallax and C. octomaculatus (8%). However, this value of divergence was slightly higher than the one expected between populations within a species. Similar levels of divergence have been found in the Polyphagan beetle genera Pimelia (Juan et al., 1995), Hegeter (Juan et al., 1996), and Ophraella (Funk et al., 1995), and in the Adephagan genus Scarites (Galián et al., 1999). The level of divergence found between Chauliognathus sp 3 (black) and each of the other species falls into that expected for species of different genera.

According to the trees obtained after re-weighting by maximum value of re-scaled consistency indices, giving equal values to all codon positions, the "yellow-black" species have a common ancestor and form two clades. This grouping is consistent across different analytical methods (MP, NJ). In all analyses, Chauliognathus sp 3 is placed in a separated lineage, basal to all of the other species. The great genetic distance between this species and all the others suggests that a more comprehensive study, taking into account the overall data (morphological and genetic), needs to be made in order to assess the taxonomic status of this species.

These results indicate that the colour pattern of the "yellow-black" complex is due to a common ancestry. The polymorphism in the elytral coloration in four out of the eight species of the complex (Diehl-Fleig and Araújo, 1991; Machado and Araújo, 1995; 1998; 1999) suggests that it (polymorphism) is also an ancestral feature of this genus. However, it is unclear whether the ancestor had a monomorphic yellow or black elytron, or a yellow elytron with black spots varying in size and location. Models for the evolution of colour patterns in heliconiine butterflies have hypothesised changes in regulatory genes (Gilbert, 2002; Jiggins and McMillan, 1997). This hypothesis may well be applied to the Chauliognathus "yellow-black" complex.

In any case, the colour pattern of the "yellow-black" complex is possibly a true case of Müllerian mimicry, as stated by Machado and Araújo (2001), with conservation of the ancestral state with some small modifications. This is in accordance with Brower et al. (1963), who stated that Müllerian relationships should not be excluded within closely related species, as the selective process that prevents divergence in colour pattern may be basically the same as those bringing about convergence in distantly related organisms. The study of the occurrence and maintenance of this variety of colour patterns in Chauliognathus offers a model to understand the mechanisms involved in the evolution of the polymorphism of Müllerian mimicry that is different from those applied to butterfly species. Furthermore, this species complex is a good study case for the species/population interface, through a phylogeographic approach. According to Templeton (1998), this approach is important for the study of the process involved in the origin of new species.

The nucleotide sequences of the 12 Chauliognathus taxa determined here were deposited in the GenBank Database under Accession Nos. from AY095214 to AY095225.

Acknowledgments

We thank Ricardo C. Fernandes and Lenise P. Palma for their help in collecting specimens and Elena Martínez-Navarro and Diego Gallego, for useful discussion and technical assistance; Pilar De la Rúa, Carlos Juan and Jesús Gómez-Zurita for helping with the phylogenetic analyses. Many thanks are also due to D. Swofford for permission to use test versions of PAUP*. V. Machado and J. Galián acknowledge the financial support for mutual visits received from Unisinos (Brazil) and from the University of Murcia (Spain), through the "Programa de Cooperación Universitaria" (AL.E 2000 and E.AL 2000) between the Spanish "Agencia Española de Cooperación Internacional" and Latin American Universities. Thanks are further due to the Brazilian "Conselho Nacional de Desenvolvimento Científico e Tecnológico" (CNPq) for financial support to VM, and to the Spanish Ministry of Science and Technology Project No. BOS2002-02870 of the DGI for support granted to JG.

Editor: João S. Morgante

Received: January 14, 2003; Accepted: August 15, 2003.

• Bernstein R and Bernstein S (1998) Assortative mating by size in two species of Chauliognathus (Coleoptera: Cantharidae). Southwest Nat 4:62-69.
• Brower LP, Brower JV and Collins CT (1963) Experimental studies of mimicry. 7. Relative palatability and Müllerian mimicry among Neotropical butterflies of the subfamily Heliconiinae. Zoologica 48:65-84.
• Brower AVZ (1996) Parallel race formation and the evolution of mimicry in Heliconius butterflies: a phylogenetic hypothesis from mitochondrial DNA sequences. Evolution 50:195-221.
• Clary DO and Wolstenholme DR (1985) The mitochondrial DNA molecule of Drosophila yakuba: nucleotide sequence, gene organization, and genetic code. J Mol Evol 22:252-271.
• Delkeskamp K (1939 Pars 165) Cantharidae. In: Junk W (ed) Coleopterorum Catalogus. Verlag für Naturwissenschaften, Gravenhage, 356 pp.
• Diehl-Fleig E and Araújo AM (1991) O polimorfismo cromático em uma população natural de Chauliognathus fallax (Coleoptera: Cantharidae) do Rio Grande do Sul. Rev Bras Biol 51:515-520.
• Edmunds M and Golding YC (1999) Diversity in mimicry. Trends Ecol Evol 14:150-151.
• Emerson BC, Oromí P and Hewitt GM (1999) MtDNA phylogeography and recent intra-island diversification among Canary Island Calathus beetles. J Mol Evol 13:149-158.
• Emerson BC, Oromí P and Hewitt GM (2000) Colonization and diversification of the species Brachyderus rugatus (Coleoptera) on the Canary Islands: evidence from mtDNA COII gene sequences. Evolution 54:911-923.
• Felsenstein J (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783-791.
• Fender KM (1964) The Chauliognathini of America North of Mexico (Coleoptera: Cantharidae). Northwest Sci 38:95-105.
• Funk DJ, Futuyma DJ, Ortí G and Meyer A (1995) Mitochondrial DNA sequences and multiple data sets: a phylogenetic study of phytophagous beetles (Chrysomelidae: Ophraella). Mol Biol Evol 12:627-640.
• Futuyma DJ and McCafferty SS (1990) Phylogeny and the evolution of the host plant associations in the leaf beetle genus Ophraella (Coleoptera: Chrysomelidae). Evolution 44:1885-1913.
• Futuyma DJ, Keese MC and Scheffer SJ (1993) Genetic constraints and the phylogeny of insect-plant associations: responses of Ophraella communa (Coleoptera: Chrysomelidae) to host plants of its congeners. Evolution 47:888-905.
• Futuyma DJ, Walsh J, Morton T, Funk DJ and Keese MC (1994) Genetic variation in a phylogenetic context: responses of two specialized leaf beetles (Coleoptera: Chrysomelidae) to host plants of their congeners. J Evol Biol 7:127-146.
• Gallego D and Galián J (2001) The internal transcribed spacers (ITS1 and ITS2) of the rDNA differentiates the bark beetle forest pests Tomicus destruens and T. piniperda Insect Mol Biol 10:415-420.
• Galián J, De la Rúa P, Serrano J, Juan C and Hewitt M (1999) Phylogenetic relationships in West Mediterranean Scaritina (Coleoptera, Carabidae) inferred from mitochondrial COI sequences and karyotype analysis. J Zool Syst Evol Res 37:85-92.
• Galián J, Hogan JE and Vogler AP (2002) The origin of multiple sex chromosomes in tiger beetles. Mol Biol Evol 19:1792-1796
• Gilbert LE (2002) Adaptive novelty through introgression in Heliconius wing patterns: evidence for shared genetic "tool box" from synthetic hybrid zones and a theory of diversification. In: Boggs CL, Watt WB and Ehrlich PR (eds) Evolution and ecology taking flight: butterflies as model systems. Rocky mountain biological lab symposium series, University of Chicago Press.
• Hasegawa M, Kishino H and Yano T (1985) Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. J Mol Evol 22:160-174.
• Howard DJ and Shields WM (1990) Patterns of genetic variation within and among species of Chauliognathus (Coleoptera: Cantharidae). Ann Entomol Soc Am 83:326-334.
• Jiggins CD and McMillan WO (1997) The genetic basis of an adaptive radiation: warning colour in two Heliconius species. Proc R Soc Lond 264:1167-1175.
• Joron M and Mallet JLB (1998) Diversity in mimicry: paradox or paradigm? Trends Ecol Evol 13:461-466.
• Juan C, Oromi P and Hewitt GM (1995) Mitochondrial DNA phylogeny and sequential colonization of Canary Islands by darkling beetles of the genus Pimelia (Tenebrionidae). Proc R Soc Lond (series B) 261:173-180.
• Juan C, Oromi P and Hewitt GM (1996) Phylogeny of the genus Hegeter (Tenebrionidae: Coleoptera) and its colonization of the Canary Islands deduced from cytochrome oxidase I mitochondrial DNA sequences. Heredity 77:392-403.
• Juan C, Ibrahim KM, Oromi P and Hewitt GM (1998) The phylogeography of the darkling beetle, Hegeter politus, in the eastern Canary Islands. Proc R Soc Lond (series B) 265:135-140.
• Kimura M (1980) A simple method for estimating evolutionary rates of base substitution through comparative studies of nucleotide sequences. J Mol Evol 16:111-120.
• Kumar S, Tamura K and Nei M (1993) MEGA: molecular evolutionary genetics analysis, version 1.01. University Park, The Pennsylvania State University, PA.
• Lunt DH, Zhang DX, Szymura JM and Hewitt GM (1996) The insect cytochrome oxidase I gene: evolutionary patterns and conserved primers for phylogenetic studies. Insect Mol Biol 5:153-165.
• MacDougall A and Dawkins MS (1998) Predator discrimination error and the benefits of Müllerian mimicry. Anim Behav 55:1281-1288.
• Machado V and Araújo AM (1995) The colour polymorphism in Chauliognathus flavipes (Coleoptera; Cantharidae). I. Geographic and temporal variation. Evolución Biologica 8/9:127-139.
• Machado V and Araújo AM (1998) Padrões de emergência em populações naturais de duas espécies de Chauliognathus (Coleoptera; Cantharidae). Rev Bras Entomol 41:235-238.
• Machado V and Araújo AM (1999) Colour polymorphism in Chauliognathus flavipes Fab. 1781, (Coleoptera; Cantharidae). II. Patterns of emergence of morphs and mating systems. Rev Bras Zool 16:441-446.
• Machado V, Araújo AM and Mosmann CS (2001) Morphometric analysis, mimicry, and colour polymorphism in five species of the genus Chauliognathus Hentz, 1830, (Coleoptera; Cantharidae). Rev Bras Zool 18:711-718.
• Machado V and Araújo AM (2001) The aggregation of Chauliognathus species (Coleoptera: Cantharidae) and its possible role for coexistence and mimicry. Iheringia Ser Zool 91:29-32.
• Machado V, Valente VG, Araújo AM and Galian J (1991) Cytogenetics of eight neotropical species of Chauliognathus Henzt, 1830: implications on the ancestral karyotype in Cantharidae (Coleoptera). Hereditas 34:121-124.
• Mallet J and Joron M (1999) Evolution of diversity in warning color and mimicry: polymorphism, shifting balance and speciation. Ann Rev Ecol Syst 30:201-233.
• Mccauley DE and Wade MJ (1978) Female choice and the mating structure of a natural population of the soldier beetle, Chauliognathus pennsylvanicus Evolution 32:771-775.
• McLain DK (1982) Density dependent sexual selection and positive phenotypic assortative mating in natural population of the soldier beetle, Chauliognathus pennsylvanicus. Evolution 36:1227-1235.
• McLain DK (1985) Clinal variation in morphology and assortative mating in the soldier beetle, Chauliognathus pennsylvanicus (Coleoptera: Cantharidae). Biol J Linn Soc 25:105-117.
• Rees DJ, Emerson BC, Oromí P and Hewitt GM (2001) Mitochondrial DNA, ecology and morphology: interpreting the phylogeography of the Nesotes (Coleoptera: Tenebrionidae) of Gran Canaria (Canary Islands). Mol Ecol 10:427-434.
• Sambrook J, Fritsch E and Maniatis T (1989) Molecular cloning. A laboratory manual. Cold Spring Harbour Laboratory Press, New York.
• Saitou N and Nei M (1987) The Neighbor-Joining method: a new method for reconstructing phylogenetic tree. Mol Biol Evol 4:406-425.
• Simon C, Frati F, Beckenbach A, Crespi B, Liu H and Flook P (1994) Evolution, weighting and phylogenetic utility of mitochondrial gene sequences, and a compilation of conserved polymerase chain reaction primers. Ann Entomol Soc Am 87:651-701.
• Speed MP (1993) Muellerian mimicry and the psychology of predation. Anim Behav 45:571-580.
• Swofford DL (1998) PAUP*. Phylogenetic analysis using parsimony (*and other methods), v. 4. Sinauer, Sunderland, Mass.
• Templeton AR (1998) The role of molecular genetics in speciation studies. In: De Salle R and Schierwater B (eds) Molecular approaches to ecology and evolution. Birkhäusel Verlag, Basel.
• Turner JRG, Kearney EP and Exton LS (1984) Mimicry and the Monte Carlo predator: the palatability spectrum and the origins of mimicry. Biol J Linn Soc 23:247-268.
• Vogler AP, Kelley CK (1998) Covariation of defensive traits in Cicindela tiger beetles: a phylogenetic approach using mtDNA. Evolution 52:357-366.

Publication Dates

• Publication in this collection
  13 Apr 2004
• Date of issue
  2004

History

• Accepted
  15 Aug 2003
• Received
  14 Jan 2003